Table I. Primers used in this study
Sequence (5′-3′)
Primers used for cloning
 pTracerCMV2ΔGFP FwdACATGCATGCGCCAAGTTGACCAGTGCCGTT
   pTracerCMV2ΔGFP RevACATGCATGCCATGGTTTAGTTCCTCACCTT
   3×FLAG FwdATTTGCGGCCGCGACTACAAAGACCATGACGGT
   3×FLAG RevGCTCTAGATCACTTGTCATCGTCATCCTTGTA
   chTLR21 FwdATTTGCGGCCGCCACCATGATGGAGACACCGGAGAAGG
   chTLR21 RevATTTGCGGCCGCGCATCTGTTTGTCTCCTTCCCT
   hTLR9 FwdATTTGCGGCCGCCACCATGGGTTTCTGCCGCAGCGCC
   hTLR9 RevATTTGCGGCCGCGTTCGGCCGTGGGTCCCTGGCA
Small interfering RNA primers
   chTLR21-FwdGTACCTCGCAACTGCATTGAGGATGTCATCAAGAGTGAC
ATCCTCAATGCAGTTGCTTTTTGGAAA
   chTLR21-RevAGCTTTTCCAAAAAGCAACTGCATTGAGGATGTCACTCT
TGATGACATCCTCAATGCAGTTGCGAG
   chTLR4-FwdGTACCTCGTTTACAGGTCAACAGACTAATCAAGAGTTAG
TCTGTTGACCTGTAAACTTTTTGGAAA
   chTLR4-RevAGCTTTTCCAAAAAGTTTACAGGTCAACAGACTAACTCT
TGATTAGTCTGTTGACCTGTAAACGAG
  • Underlined sequences represent restriction sites used in cloning of the PCR products.