Table I. Sequence-specific primers for connexin family genes
Gene NamePrimers (5′-3′)Size (bp)
Connexin 26CGGAAGTTCATGAAGGGAGAGAT (sense)531
ACGAGTCCTTTCAGGTTTTCTGG (antisense)
Connexin 29TCAAAATGGCTCTTTTGCCTC (sense)154
CTTGGAGCTTGCGCTTTTGGG (antisense)
Connexin 30GGCTTGGTTTTCAGAGATAG (sense)369
GAGTTGTGTTACCTGCTGC (antisense)
Connexin 31TGAAAGAAAGGAGATGGG (sense)364
GCTTTTAAGGAAACGGAC (antisense)
Connexin 32TCCATCAAACCTTCCCTC (sense)391
TTCTCTCTCCATAACTCCCTC (antisense)
Connexin 33AAACCATCTTCATCCTCTTC (sense)386
GCTTTTCTGTCTACCTAAAACC (antisense)
Connexin 36TACTGCCCAGTCTTTGTCTGCTGC (sense)296
CACACCATTATGATCTGGAAGACC (antisense)
Connexin 40TTTGGCAAGTCACGGCAGGG (sense)311
TTGTCACTGTGGTAGCCCTGAGG (antisense)
Connexin 43CCCCACTCTCACCTATGTCTCC (sense)519
ACTTTTGCCGCCTAGCTATCCC (antisense)
Connexin 45AAAGAGCAGAGCCAACCAAA (sense)313
GTCCCAAACCCTAAGTGAAGC (antisense)
Connexin 46GGAAAGGCCACAGGGTTTCCTGG (sense)331
GGGTCCAGGAGGACCAACGG (antisense)
Connexin 47TCCAAGTTCACCTGCAACACG (sense)111
GGAGATGACCACTATCTGGAAGACC (antisense)
Connexin 50GGAAGGAGGATGAGAAAG (sense)462
GAGAATGGAGGAGGAAAG (antisense)
GAPDHGGGCATCTTGGGCTACACT (sense)261
GCCGAGTTGGGATAGGG (antisense)