Table I. The primers used for RT-PCR and QRT-PCR analyses
GeneForward Primer (5′–3′)Reverse Primer (5′–3′)PurposesReferences
PLCεagaaagctggtctcctatggctgcctctagaagagaaccggRT-PCR12
PLCεbgctttgaaacgaggatatcgacatcttcagctgcggctttgcataaggtctgctgaattacatccRT-PCR16
PLCγ1gacatcacctacgggcagttcacacgctgttctctttggaRT-PCR
GAPDHgtgaaggtcggtgtgaacggatttcacagtcttctgagtggcagtgatRT-PCR12
β-actinctacaatgagctgcgtgtggcaacgtcacacttcatgatggRT-PCR12
IL-4acggcacagagctattgatgatggtggctcagtactacgaQRT-PCR
CD4ttcagagcacagctatcacgtcactcagtagacactgccaRT-PCR
CXCL-1acccaaaccgaagtcatagctggggacaccttttagcatcQRT-PCR13
CXCL-2agtttgccttgaccctgaagctttggttcttccgttgaggQRT-PCR13
TNF-αtgatcggtccccaaaggggtctgggccatagaactgaQRT-PCR
β-actinatgaagatcaagatcattgctcctcacatctgctggaaggtggacagQRT-PCR13
IL-17AtccagaaggccctcagactactcgaccctgaaagtgaaggQRT-PCR
IFN-γactggcaaaaggatggtgactgagctcattgaatgcttggQRT-PCR
IL-22tccgaggagtcagtgctaaaagaacgtcttccagggtgaaQRT-PCR17
IL-1αgtccataacccatgatctggcaagtggtgctgagatagtgQRT-PCR
IL-1βcaccctgcagctggagagtgacaaaccgcttttccatcttcQRT-PCR
CCL-20cacccagttctgctttggatcgactgttgcctctcgtacaQRT-PCR
RT-PCR
CD4aagaactggttcggcatgactcctctgcaaagttgagtggQRT-PCR
IL-1αtggcaaagttcctgacttgtttgcaggtcatttaaccaagtggtgctRT-PCR12
IL-1βatggcaactgttcctgaactcaactcaggacaggtatagattctttcctttRT-PCR12
CXCL-1gcttgttcagtttaaagatggtaggccgtgttgaccatacaatatgaaagacgRT-PCR12
CXCL-2ctgccgctcctcagtgctgcactggccttgcctttgttcagtatcttttggRT-PCR12
Keratin 1agcaaggctgaagctgagacgggcatctttgagtgctttcRT-PCR
Keratin 5gagctggctctcaaagatgctgactggtccaactccttccRT-PCR
Keratin 10tcaccacagaaatcgacagccggagatctggctttgaatcRT-PCR
  • a Primer set A used in Fig. 4.

  • b Primer set B used in Fig. 4.