Table II.

RT-PCR primers and probes used in this study

GenePrimer/ProbeSequence (5′ to 3′)
GAPDHForwardGCCGTCCTCTCTGGCAAAG
ReverseTGTAAACCATGTAGTTCAGATCGATGA
Probe(FAM)-AGTGGTGGCCATCAATGATCCC-(TAMRA)
IL-8ForwardGCCCTCCTCCTGGTTTCAG
ReverseCGCAGCTCATTCCCCATCT
Probe(FAM)-TGCTCTGTCGCAAGGTAGGACGCTG-(TAMRA)
IL-1βForwardGCTCTACATGTCGTGTGTGATGAG
ReverseTGTCGATGTCCCGCATGA
Probe(FAM)-CCACACTGCAGCTGGAGGAAGCC-(TAMRA)
IFN-βForwardACAACTTCCTACAGCACAACAACTA
ReverseGCCTGGAGGCGGACATG
Probe(FAM)-TCCCAGGTACAAGCACTG-(TAMRA)