Table I.

Primers used for amplification of C4BPAand C4BPB prior to direct sequencing

ExonPrimers 5′–3’(Mg) mMTemp (°C)
C4BPA
 1(F) CAGTGCTGCTTTATTTCTGCTG1.551.2
(R) TCTGCTGAAAACACCTCCAA
 2(F) CACTCCAGGCTGTCATTTCC2.062.7
(R) TTGATGAAGCTGGGTCTCTG
 3(F) TAAGATGCTGTGTCCCAAGG1.551.2
(R) TCTGAGACAACTTTCCAAAGATAGG
 4(F) TGTGTTTCTGGAAGCAGAGGTG2.058.9
(R) ATCCTTTGCTTGAGGACGGGA
 5(F) TGGGAAATGATATCCAAGAACA1.554.2
(R) GGCTTACACTTGACAACTGAGGT
 6(F) TCCCTGTGCATCTTTACAGGTAT3.058.9
(R) TCAGGTGGCCAAATAAATGA
 7(F) AACTGGATTAGCAGTGGCAG1.558.9
(R) CAGTACGGGGTACCTTTAG
 8(F) TGATACATCAGGCCTTGCAG1.558.9
(R) GTCCCCTTCTGGCACTAACA
 9(F) TCTTCATATAAGTTTAATCC1.550
(R) ATTCCAAGAATCATGCAAG
 10(F) TACATGTATTCTGCAATGTGCTAC2.064.7
(R) GCTCTCAGGACACGTCCAC
 11(F) CCGAGACTGTTATCATGTCCTTC2.064.7
(R) ATGCCACCATTTTTAGGGG
 12A(F) CTTGTTTTCCCAGCCTCAAC1.562.7
(R) CATGAGCCACACAGAGGATG
 12B(F) GAAAATGGCCCTGGAGGTAT1.558.9
(R) TGGCCCAAACAGTAAAACAA
C4BPB
 1(F) GACTGGTCAACTGGATTTGCATTC1.558.0
(R) AGCTCCTATTGAGTGACGAGCAT
 2(F) GCAAAAAGACATGAGAATGGG1.558.0
(R) GGATGTGAAGGAGTAAAACAGG
 3(F) TGGCCTTTGCTGTGTTG1.555.0
(R) CAGGGATGTGGCAAATGTC
 4(F) AACAGCTGCAATTAGGGGTG1.055.0
(R) CCAAAACAATGCTGCCAAG
 5(F) CCAGTCTCCATTACCCAATTC1.058.0
(R) AGCATATGCCAGGAGTGATG
 6(F) TTACTTAAGCTAGCCTGGTTCTGAGC1.560
(R) ACATGGTGCATTATACAACTG1.5