Table I.

Primer sequences for amplification of ER and β-actin

PrimerForward Sequence (5′–3′)Reverse Sequence (5′–3′)
ERαCGCGCAGGTCTACGGTCAGCCACCCTGGCGTCGATTATCT
ERβCGCAGAAGTGAGCATCCCTCTACACCTGGGCACCTTTCTC
β-actinTCGCCGCGCGCTCGTCGTCTCTCTTGCTCTGGGCCTGGTC