Table I.

PCR primers used for PCRs

Gene NameForwardReverseLength
GAPDH TGAAGGTCGGAGTCAACGGATTTGGTCATGTGGGCCATGAGGTCCACCAC983
Amphiregulin CTAGTAGTGAACCGTCCTCGCTCCTTCATATTTCCTGACG489
CXCL1 TGTCAACCCCAAGTTAGTTCTCAATAATTAAGCCCCTTTG400
CXCL2 CCAAAGTGTGAAGGTGAAGTATGGGAGAGTGTGCAAGTAG400
IL-8 ATGACTTCCAAGCTGGCCGTGGCTTCTCAGCCCTCTTCAAAAACTTCTC289
ICAM-1 AGTCACCTATGGCAACGACTCCGGCCATACAGGACACGAAGCT401
Rbx-1 AAGAAGCGCTTTGAAGTGAAGGTAACAGCAGGGAAAGTCA339
Skp-1 GGAAATTGCCAAACAATCTGTTGAAGGTCTTGCGAATCTC366
Proteasome ATPase 1 CAATCATGCCATCGTGTCTAGAGCCAACCACTCTCAAGAA405
Proteasome ATPase 6 CAGCTGGACTGCAATTTCTTGCGAACATACCTGCTTCAGT494