Table II.

Sequence of PCR primer

TargetForwardReverse
GAPDHGAAGGTGAAGGTCGGAGTCGAAGATGGTGATGGGATTTC
IFN-γTGTAGCGGATAATGGAACTCTTTTCTTGAGACAATTTGGCTCTGCATTATTTTT
IL-4TGAAACGGCTCGACAGGAACCTCGAAGTTTTCCAACGTACTCTGGT
IL-5AAGAGACCTTGGCACTGCTTTCTATATGTACAGGAACAGGAATCCTCA
IL-8GTGTGTAAACATGACTTCCAAGCTGTCTTTAGCACTCCTTGGCAAAAC
IL-10GGGAGAACCTGAAGACCCTCATGCTCTTGTTTTCACAGGGAAG
IL-1βGAGGATGACTTGTTCTTTGAAGCTGAGAGGGCAGAGGTCCAGGTC
TNF-αTCTCTAATCAGCCCTCTGGCCCAGGTACAACATGGGCTACAGGCTTGTCAC
IL-12p35GTTCCCATGCCTTCACCACTTGTCTGGCCTTCTGGAGCA
IL-12p40CCAGAGCAGTGAGGTCTTAGGCGGCCAGCATCTCCAAACTCTT