Table I.

Primer pairs for RT-PCR

GenePrimers (5′–3′)
β-actinGTCCCTGTATGCCTCTGGTC
GATGTCACGCACGAATTTCC
MCP-1 AGGTCCCTGTCATGCTTCTG
GGTTCTGATCTCATTTGGTTCC
MCP-3 TAGGAATGTGAAATGGTCACG
ACTTCCATGCCCTTCTTTGTC
IL-8RB CAAGCTGATCAAGGAGACCTG
GCCATGCTGAAAGACAAGAAG
IL-10 CTGCCTGCTCTTACTGACTGG
CAATGCTCCTTGATTTCTGG
MIP-1βCCAGCTGTGGTATTCCTGACC
AATAGCAGAGTTTCAGCAATGG
CXCR4 ACTGCATCATCATCTCCAAGC
CTCTCGAAGTCACATCCTTGC
Cyclin D1 CAGCTTAATGTGCCCTCTCC
GGTAATGCCATCATGGTTCC
CD14 CTGATCTCAGCCCTCTGTCC
CAGGAGGATGCAAATGTTCC
XRCC1 TCTTCTCAAGGCGGACACTTA
CGGACTAACTTGTCAGGTCCAA