Table I.

PCR primer sequences

Subject5′ Primer3′ Primer
CBCB
AATGGGAAGGAGGTGCACAGATAGAGGATGGTGGCAGAC
VBCB
5.1GATGAATGTGAGCACCTTGGAGAGATCTCTGCTTCTGATGGCTC
7CCTGAATGCCCCAACAGCAGATCTCTGCTTCTGATGGCTC
112CTCTGGAGTCCGCTACCAGTAGATCTCTGCTTCTGATGGCTC
17ACTGTGACATCGGCCCAAAATGTGCACCTCCTTCCCATTCA
18GGATCCAGCAGGTAGTGCGAGATCTCTGCTTCTGATGGCTC
7CCTGAATGCCCCAACAGCTCTCTGTGCACCTCCTTCCCATTCA
216AGAGTCTAAACAGGATGAGTCCTGTGCACCTCCTTCCCATTCA
17ACTGTGACATCGGCCCAAAATGTGCACCTCCTTCCCATTCA
1CACAACAGTTCCCTGACTTGCATGTGCACCTCCTTCCCATTCA
38TCTGGTACAGACAGACCATGATTGTGCACCTCCTTCCCATTCA
13.1GACCAAGGAGAAGTCCCCAATGTGCACCTCCTTCCCATTCA
2ATACGAGCAAGGCGTCGAGAAGTGTGCACCTCCTTCCCATTCA
45.1GAGTGAGACACAGAGAAACAAATGTGCACCTCCTTCCCATTCA
22AAGTGATCTTGCGCTGTGTCCCCATGTGCACCTCCTTCCCATTCA
VBCDR3
5.1TCCCTGGTCGATTCTCAGGGCGGTTGGCCCCAGCCTCCTGTCCC
112TGGATGCTGGAATCACCCAGAGCCGCCCGAAGTACTGGGTCCTTAGGTC
17GGTACAGCGTCTCTCGGGAGGAACTCCCTGTCCCAAGA
7CTTAAACCTTCACCTACACGCCGTATCTGTTCTCCGAATCGATC
216CCCCAGCCACAGCGTAATAGAGTGCCATTGTACCCTGCCTGAGG
17CTGAAGGGTACAGCGTCTCTTGTAGCCATAGTTATCCCGG
38TCTGGTACAGACAGACCATGATGTCTCTTGGAGCCCTGTCCCGC
13.1TGCACAAGACCCAGGCATGGTGCTGGGGCTGATTACCCTG
VBJB
118GGATCCAGCAGGTAGTGCG1.3CAACTTCCCTCTCCAAAATAT
18GGATCCAGCAGGTAGTGCG2.3AGCACTGTCAGCCGGGTG
31CACAACAGTTCCCTGACTTGCA2.7ACCGTGAGCCTGGTGTCC