Table II.

Summary of oligonucleotide primers used for RT-PCR analysis

RegionOligonucleotide PrimersResidue RangeProduct Size
orf1 + orf2CGGACGCAATCAAGCCGTACG695–716327
GTTTTTGAAATCTGTTG1005–1021
orf2 + cdtAGTATATGCTTGATACTAACACGG695–716264
CGAACAAGCCACTAAACCC1197–1215
orf1 + orf2 + cdtACGGACGCAATCAAGCCGTACG695–716521
CGAACAAGCCACTAAACCC1197–1215
cdtA + cdtBGATGGGACAAAATGGGGC1401–1418518
TTGCTTTACCCATTGCAT1848–1865
cdtA + cdtBGTGATGGGCGCAACAGAACC1754–1772772
CTTCCAGATTAACCGGCGC2454–2472
cdtB + cdtCCATGGGGGAACGCCAATTG2094–2112742
CAAGCTAATACGTGGAGGAGG2815–2835
cdtB + cdtCAGTTTTGTTCGTGATCGC2679–2696157
CAAGCTAATACGTGGAGGAGG2815–2835