Table I.

Primers used for construction of various SPE C mutants by site-directed mutagenesis

Mutant ResiduesCorresponding Primersa (5′ to 3′)
D12AAATGTTAAAAGTGCCTTACTTTATGCA
Y15AAGTGATTTACTTGCCGCATACACTATA
Y17ATTACTTTATGCAGCCACTATAACTCCT
H35ATTTTCAACGACAGCCACATTAAACATT
N38DACACACACATTAGCCATTGATACTCAA
H35A/N38DTTTTCAACGACAGCCACATTAGATATT
  • a Underlined bases are areas in the primer that have been mutated to elicit the corresponding amino acid mutation. A complementary primer for each primer listed here was also made to perform the mutagenesis method outlined in Materials and Methods.