Table I.

Characteristics of NKC STS and Southern probes used in this study

LocusGenbank Accession No.Primers/ProbeProduct/Probe Size (bp)Primer Sequences (5′–3′)
Ly49b U10304BS2891079TAACTGGGTCAGTGTTGGTG
BX446CTGTTCTCTGTTGAGGTAGTG
D6Wum15 AF106670109B5L.F2135TGACAGGAATAGAGACACAG
109B5L.R2GATCATTGTTCCCAAGAC
D6Wum18 AF11550330B9L2.IF1179CTTCAAAGACAGAGAAGTGT
330B9L2.IR1TATTTGGAGAATCTTGTCCC
D6Wum16 AF106671242D11L2.F1337GAATTCCTGATTTGATTT
242D11L2.R1CCTGTGGATACATCCCTAGA
Prp M14
(D6Mit13.1) M23236D6Mit13.1F134ATATGCTTCTGGCTAAAAGACCC
D6Mit13.1RCCTAACATGCTGAAAGGAAACA
Southern Probe Source
Ly49b U10304Ly-49B746BstXI/PstI fragment of pLy49B
Prp Mp2a M21462Prp Mp2893XbaI fragment of pUMP2BE
D6Wum9 AF106665200H7L301EcoRI fragment of p200Lts.5
D6Wum10 AF10666679D7L226EcoRI/HindIII fragment of p79D7L
D6Wum12 AF106667242D11L1762SpeI/EcoRI fragment of p242D11L1.S18
D6Wum13 AF106668200H7R658EcoRI fragment of p200Rts.5
D6Wum14 AF106669109F12R244EcoRI fragment of p109Rts.3
D6Wum15 AF106670109B5L175EcoRI fragment of p109B5L.H5
D6Wum16 AF106671242D11L2349EcoRI/HindIII fragment of p242D11L2.F1R1
D6Wum18 AF11550330B9L2388EcoRI fragment of p330B9L2
D6Wum20 AF163323392D6L2793XbaI fragment of p392D6L2.S7
  • a Prp Mp2 sequence was cloned from CD-1 mouse genomic DNA (20).