Table I.

Oligonucleotide primers used for PCR amplification

Primers5′ to 3′UnderlinedAnnealing Temperature (°C)
AGATCAGATCTATGAAGCTCTTCGTCBglIIA + B : 54
BCCTGCTCTGCGAAGCCAGACACAGTCCAAGλ-like anti-sense aa 45–48
CCTGTGTCTGGCTTCGCAGAGCAGGGCCCTGλ-like sense aa 45–50C+ D : 55
DTAGCTGATCATGAACATTCTGCAGGGGCBclIA+ D : 54
ECGCAAAGCTTATGTCCTGGGCTCCTGTCHindIIIE + F : 56
FGCGGAATTCTGATCAAGGGACACGTGTCCEcoRI/BclI
GATCTCGAGGCGGCCGCATGTCCTGGGCTCCTGTCCTGXhoI/NotIG + H : 50
CTCATGCTGTTTGTCTACTGC
HGCTCTGCGAGGATCCGCCACCGCCAGAGCCACCTCCGanti-sense aa (GSSSS)3
CCTGAACCGCCTCCTCCAGGGAACGTGTCCTGGCTGC
ICGTGTCCCTGGAGGAGGCGGTTCAGGCGGAGGTGGCsense aa (GSSSS)3I+ J : 50
TCTGGCGGTGGCGGATCCTCGCAGAGCAGGGC
JATGCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCNotI, FlagM2, HindIIIG+ J : 70
AAGCTTTGAACATTCTGCAGGGGCCACCGTCTTCTC
LAAAAGCGGCCGCTTACTTGTCATCGTCGTCCTTGTAGTCNotI, FlagM2L+ M : 60
AATCACTGGAAGAGGCACGTTC
MCCCAAGCTTATGGACTGGACCTGGAGGATCHindIII
NCCCAAGCTTATGAAACACCTGTGGTTCTTCCTCCHindIIIL + N : 60