Table II.

Polyclonality of the responding BV17+ T-cells specific to M1 (58-66): TCRβ CDR3 nucleotide and amino acid sequencies

ClonotypeBV17+ Gene 3′-EndN/D/NBJ Gene 5′-EndCDR3 Amino Acid MotifNo. of Coloniesa
J1.2-family
40GCCAGTAGTATCGGGAGCTATGGCTACACCTTCIGSY8
167GCCAGTAGTATCGGCAGCTATGGCTACACCTTCIGSY5
14GCCAGTAGTATTGGGAGCTATGGCTACACCTTCIGSY2
168GCCAGTAGTATCGGTTCCTATGGCTACACCTTCIGSY2
169GCCAGTAATATCGGCAGCTATGGCTACACCTTCIGSY1
54GCCAGTAGTAACGGGGCCTATGGCTACACCTTCNGAY9
38GCCAGTAGTATCGGGGTTTATGGCTACACCTTCIGVY2
48GCCAGCTCGACGGGCCTCTATGGCTACACCTTCTGLY1
170GCCAGTAGTATCGGGGCCTATGGCTACACCTTCIGAY1
171GCCAGTGGTACAGGGAGCTATGGCTACACCTTCTGSYc1
J2.3-family
4GCCAGTAGTATTCGATCGGCAGATACGCAGTATTTTIRSA1
118GCCAGTAGCTCTCGGAGTTCCGATACGCAGTATTTTSRSS1
20GCCAGTAGCTTCCGATCCACAGATACGCAGTATTTTFRST1
29GTCAGTAGTTCGAGGAGCACAGATACGCAGTATTTTSRSTc1
126GCCAGTAGCCACAGAAGCACAGATACGCAGTATTTTHRST1
172GCCAGTAGTGGACGGAGCACAGATACGCAGTATTTTGRSTc1
173GCCAGTAGTCCCAGGAGCACAGATACGCAGTATTTTPRSTc1
J2.1-family
82GCCAGTAGTATCAGAGCGGGGGGCCTGCAGTTCTTCIRAG2
93GCCAGTAGTACCAGATCAGGAGTCCTGCAGTTCTTCIRAS1
176GCCAGTAGTACCAGATCAGGAGTCCTGCAGTTCTTCTRSG1
177GCCAGTAGTATTCTCTCAGGCGGGCTGCAGTTCTTCILSG1
J2.5-family
7GCCAGTAGTATAAGGAGCGGAGAGACCCAGTACTTCIRSR3
31GCCAGTAGTTCCCGGTCCTCCGAGACCCAGTACTTCSRSS1
92GCCAGTAGTTCACGTTCCGGAGAGACCCAGTACTTCSRSG1
J1.5-family
100GCCAGTAGTATACGGTCCCAGGAGACCCAGCATTTTIRSQ4
129GCCAGTAGTATTCACAGCAATCAGCCCCAGCATTTTIHSN1
175GCCAGTAGTGACCGGAGCAATCAGCCCCAGCATTTTQRSN1
J2.4-family
77GCCAGTAGTACCCGGTCGGGACACATTCAGTACTTCTRSG1
178GCCAGTAGTATCCGTACGGGGGACATTCAGTACTTCIRTG1
J1.1-family
76GCCAGTAGTCCCCGCTCGAACACTGAAGCTTTCTTTPRSN1
174GCCAGTAGTATGAGGAGTGGGACTGAAGCTTTCTTTMRSG1
J1.4-family
85GCCAGTAGTTGGAGGTCGGTCGAGGAACTGTTTTTTWRSV1
J2.2-family
136GCCAGTAGTATACGTTCGGACGGGGAGCTGTTTTTTIRSDc2
  • a Number of colonies (294 total) which had the same nucleotide sequence.

  • b The CDR3 length is 9 amino acids as defined by Chothia et al. (23) and encoded as S-I/S-R-S-A/s-X-X-X-X except for the BJ1.2 containing CDR3 which are 8 residues. Bold nucleotide sequences were translated into deduced amino acid sequences in CDR3 region as shown on the right side.

  • c TCRβ CDR3 amino acids used by M1 (58-66) specific T-cell clones, from Lehner et al. (14).