Table I.

Polyclonality of the responding BV17+ T-cells specific to M1 (58-66): TCRβ CDR3 nucleotide and amino acid sequencies

ClonotypeBV17+ Gene 3′-EndN/D/NBJ Gene 5′-EndCDR3 Amino Acid MotifNo. of Coloniesaa
J2.7-family
1GCCAGTAGTATTAGGAGCTCCTACGAGCAGTACTTCbbIRSScc14
11GCCAGTAGTATACGGAGCTCCTACGAGCAGTACTTCIRSS10
94GCCAGTAGTATCAGGAGCTCCTACGAGCAGTACTTCIRSS10
78GCCAGTAGTATTAGAAGCTCCTACGAGCAGTACTTCIRSS8
71GCCAGTAGTATAAGGAGCTCCTACGAGCAGTACTTCIRSS3
144GCCAGTAGTATACGAAGCTCCTACGAGCAGTACTTCIRSS3
32GCCAGTAGCATTAGGAGCTCCTACGAGCAGTACTTCIRSS2
19GCCAGTAGCATACGGAGT TCCTACGAGCAGTACTTCIRSS2
22GCCAGTAGCATTCGGAGT TCCTACGAGCAGTACTTCIRSS2
90GCCAGTAGTATCAGGTCCTCCTACGAGCAGTACTTCIRSS2
137GCCAGTAGTATCCGGAGT TCCTACGAGCAGTACTTCIRSS2
145GCCAGTCGTATAAGGAGCTCCTACGAGCAGTACTTCIRSS2
49GCCAGTAGTATACGTTCT TCCTACGAGCAGTACTTCIRSS1
50GCCAGTAGTATTAGGAGT TCCTACGAGCAGTACTTCIRSS1
132GCCAGTAGTATTCGGAGCTCCTACGAGCAGTACTTCIRSS1
141GCCAGTAGTATCCGCTCTAGTGACGAGCAGTACTTCIRSS1
110GCCAGTAGTATAAGAAGCTCCTACGAGCAGTACTTCIRSS1
140GCCAGTAGTATAAGGAGT TCCGACGAGCAGTACTTCIRSS1
148GCCAGTAGTATAAGGTCCAGCGTGGAGCAGTACTTCIRSS1
147GCCAGTAGTATACGTAGCTCCTACGAGCAGTACTTCIRSS1
150GCCAGTAGTATTAGAAGT TCCTACGAGCAGTACTTCIRSS1
149GCCAGTAGTATCCGTTCCTCCTACGAGCAGTACTTCIRSS1
151GCCAGTAGTATCCGTAGCTCCTACGAGCAGTACTTCIRSS1
165GCCAGTAGTATTAGGTCCTCCTACGAGCAGTACTTCIRSS1
164GCCAGTAGTATACGAAGT TCCTACGAGCAGTACTTCIRSS1
180GCCAGTAGTATAAGGAGT TCCTACGAGCAGTACTTCIRSS1
142GCCAGTAGCGTCAGGAGCTCCTACGAGCAGTACTTCVRSS5
25GCCAGTAGTGTGCGGAGCTCCTACGAGCAGTACTTCVRSS2
42GCCAGTAGTGTCAGGAGCTCCTACGAGCAGTACTTCVRSS1
81GCCAGTAGCGTTAGGAGCTCCTACGAGCAGTACTTCVRSS1
57GCCAGTAGTGTCCGATCCTCCTACGAGCAGTACTTCVRSS1
156GCCAGTAGTGTCCGGTCCTCCTACGAGCAGTACTTCVRSS1
157GCCAGTAGTGTCAGGAGCTCCTACGAGCAGTACTTCVRSS1
10GCCAGTAGTATAAGGTCAG CCTACGAGCAGTACTTCIRSAcc47
12GCCAGTAGTATTCGTTCGG CCTACGAGCAGTACTTCIRSA28
130GCCAGTAGTATCCGGAGTG CCTACGAGCAGTACTTCIRSA2
152GCCAGTAGTATACGGTCAG CCTACGAGCAGTACTTCIRSA1
153GCCAGTAGTATTAGATCGGCTTACGAGCAGTACTTCIRSA1
154GCCAGTAGTATTAGATCGCGTTACGAGCAGTACTTCIRSA1
88GCCAGTAGTACTCGGAGCTCCTACGAGCAGTACTTCTRSS1
99GCCAGTAGTACACGATCCTCCTACGAGCAGTACTTCTRSS1
166GCCAGTAGTACCCGGTCCTCCTACGAGCAGTACTTCTRSS1
155GCCAGTAGTACACGCAGCTCCTACGAGCAGTACTTCTRSS1
62GCCAGTAGTTCGCGAAGCTCCTACGAGCAGTACTTCSRSScc15
27GCCAGTAGTTCCCGTTCA TCCTACGAGCAGTACTTCSRSS9
61GCCAGTAGTAGCAGGAGCTCCTACGAGCAGTACTTCSRSS5
18GCCAGTAGTTCGCGGAGCTCCTACGAGCAGTACTTCSRSS1
35GCCAGTAGTATAAGGTCGGGGACCGAGCAGTACTTCIRSG2
159GCCAGTAGTATCCGATCGGGATTCGAGCAGTACTTCIRSG1
160GCCAGTAGTATTAGGAGCGG CTACGAGCAGTACTTCIRSG1
8GCCAGTAGTTCAAGGGCCTCCTACGAGCAGTACTTCSRAS6
56GCCAGTAGTTCGCGGAGCTCCTACGAGCAGTACTTCSRAS1
84GCCAGTAGTATGCGTAGCAG CTACGAGCAGTACTTCMRSScc1
161GCCAGTAGTATGCGGAGCTCCTACGAGCAGTACTTCMRSS1
102GCCAGTAGTACCAGGGCCTCCTACGAGCAGTACTTCTRAS1
143GCCAGTTCTACCAGGTCTG CCTACGAGCAGTACTTCTRSA4
5GCCAGTAGTAGCCGGTCTG CCTACGAGCAGTACTTCSRSAcc1
74GCCAGTAGTCCCAGAAGCG CCTACGAGCAGTACTTCPRSS1
125GCCAGTAGTGGGCGGTCCTCCTACGAGCAGTACTTCGRSS1
146GCCAGTAGTATAAGGAGTAC CTACGAGCAGTACTTCIRST2
158GCCAGTAGTATTCGATCGCAAGAGGAGCAGTACTTCIRSQ1
162GCCAGTAGTTCCCGTACA TCCTACGAGCAGTACTTCSRTS1