SOCS1 and SOCS3 Target IRF7 Degradation To Suppress TLR7-Mediated Type I IFN Production of Human Plasmacytoid Dendritic Cells

Chun-Feng Yu, Wen-Ming Peng, Martin Schlee, Winfried Barchet, Anna Maria Eis-Hübinger, Waldemar Kolanus, Matthias Geyer, Sebastian Schmitt, Folkert Steinhagen, Johannes Oldenburg and Natalija Novak
J Immunol June 15, 2018, 200 (12) 4024-4035; DOI: https://doi.org/10.4049/jimmunol.1700510

Abstract

Type I IFN production of plasmacytoid dendritic cells (pDCs) triggered by TLR-signaling is an essential part of antiviral responses and autoimmune reactions. Although it was well-documented that members of the cytokine signaling (SOCS) family regulate TLR-signaling, the mechanism of how SOCS proteins regulate TLR7-mediated type I IFN production has not been elucidated yet. In this article, we show that TLR7 activation in human pDCs induced the expression of SOCS1 and SOCS3. SOCS1 and SOCS3 strongly suppressed TLR7-mediated type I IFN production. Furthermore, we demonstrated that SOCS1- and SOCS3-bound IFN regulatory factor 7, a pivotal transcription factor of the TLR7 pathway, through the SH2 domain to promote its proteasomal degradation by lysine 48-linked polyubiquitination. Together, our results demonstrate that SOCS1/3-mediated degradation of IFN regulatory factor 7 directly regulates TLR7 signaling and type I IFN production in pDCs. This mechanism might be targeted by therapeutic approaches to either enhance type I IFN production in antiviral treatment or decrease type I IFN production in the treatment of autoimmune diseases.

Introduction

Type I IFNs (IFN-α/β) are well documented pleiotropic cytokines with antiviral activities that enable them to interfere with virus replication as well as immune modulation by the activation of APC, B, and T cells (1). They act as key mediators of both innate and adaptive immunity (1). Although many cell types are able to produce type I IFNs in response to pathogen infection, plasmacytoid dendritic cells (pDCs) are considered the “professional” type I IFN–producing cells because they are capable of secreting up to 1000 times more IFN-α/β upon activation than other cell types (2, 3).Type I IFN production by pDCs is controlled by the endosomal pathogen recognition receptors (PRRs) TLR 7 and 9, which recognize viral ssRNA and unmethylated CpG motifs in the dsDNA, respectively (4). Activation of TLR7 or TLR9 leads to the assembly of MyD88–IL-1 receptor-associated kinase 4-TNF receptor-associated factor 6 complexes, which further interact with other signal transduction proteins to phosphorylate and activate IFN regulatory factor (IRF) 7 for dimerization and nuclear translocation to initiate the transcription of type I IFNs (4–6).

Type I IFNs from activated pDCs are important for the immune homeostasis of the host. It has been widely reported that aberrant IFN-α/β production of pDCs triggered by self-RNA/DNA is responsible for the development or perpetuation of autoimmune diseases, such as systemic lupus erythematodes, psoriasis, dermatomyositis, and type I diabetes, through maturation of DCs and differentiation of autoreactive T and B cells (5–8). Therefore, the production of type I IFN by pDCs has to be tightly controlled. In recent years, suppressor of cytokine signaling (SOCS) proteins have elicited interest as negative regulators of type I IFN and proinflammatory cytokine signaling (9, 10). Functions of type I IFNs are suppressed by SOCS proteins through inhibition of cytokine receptor–JAK-STAT signaling. SOCS proteins structurally share a variable N-terminal region, a central SH2 domain, a conserved C-terminal SOCS box domain, and an N-terminal extended SH2 subdomain (ESS) (9, 10). The SH2 domain is responsible for interaction with substrates through recognition of phosphorylated tyrosine residues, whereas an N-terminal ESS enhances substrate interaction (10). The SOCS box recruits Elongin B/C, Cullin-5, Rbx2, and E2 ubiquitin transferase to form an E3 ligase complex that tags target proteins with ubiquitin for proteasome-mediated degradation (11). In addition, SOCS1 and SOCS3 use a unique kinase inhibitory region (KIR) as pseudosubstrate to JAKs (12, 13).

The importance of SOCS proteins in regulating type I IFN production is partially mirrored by the fact that some viruses target SOCS proteins to dampen antiviral immunity of the host. For example, Hepatitis C virus and HSV 1 impair IFN-α/β signal transduction through induction of SOCS3 expression in human hepatoma cells and amniotic cells (14, 15). Hepatitis B virus upregulates SOCS1 expression to suppress TLR9–mediated IFN-α production in human pDCs (16). Furthermore, respiratory syncytial virus induces expression of SOCS1 in mouse lung epithelial cells and SOCS3 in human bronchial epithelial cells; both result in decreased secretion of type I IFNs (17, 18). Accumulating evidence implies that SOCS proteins modulate TLR-mediated signaling, and vice-versa TLR-signaling modulates SOCS protein expression in various cell types (10, 19). For example, SOCS1-deficient DCs were hyper-responsive to LPS and SOCS1−/− mice developed systemic autoimmune-like diseases (20). It has been shown that the expression of SOCS1 and SOCS3 can be induced by TLR4 or TLR9 activation (19, 21, 22). As a feedback of TLR activation, SOCS1 suppresses the TLR-MyD88–dependent activation of NF-κB by targeting MyD88-adaptor–like protein (MAL), IL-1 receptor-associated kinase, p65 for ubiquitination and degradation (10, 13, 23) and controls MAPKs cascades by binding to apoptosis signal-regulating kinase 1 (10). Furthermore, SOCS3 prevents NF-κB–dependent transcription by inhibiting the association between TNF receptor-associated factor 6 and TGF-β–activated kinase 1 (24). However, mechanisms of SOCS protein–mediated regulation of TLR7 activation and IFN-α/β expression in pDCs remain largely unknown.

Therefore, the aim of our study was to investigate whether SOCS proteins are involved in the regulation of TLR7-mediated IFN-α/β signaling. Our results provide evidence that activation of TLR7 directly induces the expression of SOCS1 and SOCS3, which in turn suppress type I IFN production in pDCs by targeting IRF7 for ubiquitination and degradation.

Materials and Methods

Human pDCs purification

PBMCs were isolated as described and previously prepared by Ficoll gradient centrifugation (Lymphoprep 1.077 g/ml; Axis-Shield PoC AS, Oslo, Norway) from buffy coats of human healthy blood donors provided from the blood bank of the University Hospital of Bonn (25). Purification of pDCs was performed with the Diamond Plasmacytoid Dendritic Cell Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany) by a combination of negative and positive selection with the autoMACS Pro Separator (Miltenyi Biotec) according to the manufacturer’s instructions. The purity of BDCA2+CD123+ pDCs was >98%, verified by flow cytometry with BD FACSCanto (BD Biosciences, Heidelberg, Germany).

PDCs culture and stimulation

Freshly isolated pDCs were cultured as described previously (26). After 18 h, cultured pDCs were stimulated with 10 μM of the synthetic TLR7 ligand imiquimod (R837) (InvivoGen, Toulouse, France), with 3.3 × 106 genome equivalents/ml heat-inactivated influenza A virus (IAV), or with 15 μg/ml HIV-1 derived ssRNA VIFRNA327 (GUAUUACUUUGACUGUUUUU), ssRNA40 (GCCCGUCUGUUGUGUCACUC) or control ssRNA VIFRNA327A (5′-GAAAAACAAAGACAGAAAAA-3′), ssRNA41 (5′-GCCCGACAGAAGAGAGACAC-3′) (Eurofins MWG, Ebersberg, Germany) complexed with 30 mg/ml DOTAP Liposomal Transfection Reagent (Roche Diagnostics, Mannheim, Germany) (26). In the experiments of cytokine neutralization, pDCs were stimulated with R837 for 2 h in the presence or absence of 2 μg/ml anti–IL-6 (clone 1936, R&D Systems, Wiesbaden, Germany) (26), 20 μg/ml anti-IL-10 (clone: 23738, R&D Systems) (27), or 20 μg/ml anti-TNF-α (clone 6401, R&D Systems) (26) monoclonal neutralizing Ab or 3 μg/ml mAb against IFN-α/β receptor chain 2 (IFN-α/βR2) (clone MMHAR-2, Milipore, Darmstadt, Germany) (28).

Cell culture, transfection, and stimulation

The human pDC cell line CAL-1 (kindly provided by Drs. T. Maeda and S. Kamihira, Department of Island Medicine, Nagasaki University, Japan) was cultured in complete RPMI 1640 medium supplemented with 2 mM l-glutamine, 1 mM sodium pyruvate, and 10% FCS (29). Sixteen hours prior to stimulation, 1 × 106 CAL-1 cells/well were starved with 1 ml serum-reduced medium (1% FCS) in a 48-well plate and then stimulated with 5 μg R837 or 3.3 × 106 genome heat-inactivated IAV for the indicated time. For gene knockdown experiments, 1 × 106 CAL-1 cells were transfected with 50 mM of SOCSs siRNA or Silencer Select Negative Control No. 1 siRNA using 4D-Nucleofector X Unit (DN100, cell line SF; Lonza) (29). For gene overexpression experiments, 2 × 106 CAL-1 cells were transfected with 2 μg Flag-tagged SOCS plasmid or control plasmid pcDNA3.1 using Nucleofector II (Y-001, Human Monocyte Nucleofector Kit; Lonza). Transfected CAL-1 cells were recovered in 1 ml 5% FCS RPMI 1640 medium for 16 h and then starved in 2.5% FCS RPMI 1640 medium for 2 h prior to further stimulation.

293XL-hTLR7 cells (with stable expression of human TLR7) (InvivoGen) and 293T cells (ATCC) were cultured according to manufacturer’s instructions. Twenty four hours before transfection, 1.5 × 105 293T cells/well or 3 × 105 293XL-hTLR7 cells/well were seeded into 24-well plates in 500 μl DMEM medium. Alternatively, 1 × 106 HEK293 cells/well or 3 × 106 293XL-hTLR7 cells/well were seeded into six-well plates in 2 ml DMEM medium. Cells were transfected with 0.8 ∼ 2 μg plasmid DNA using 2 ∼ 4 μl Lipofectamine 3000 (Thermo Fisher Scientific, Schwerte, Germany), following the manufacturer’s instructions.

Plasmids and reagents

The Flag-tagged SOCS1 and SOCS3 plasmids were kindly provided by Dr. A. Yoshimura (Keio University School of Medicine Shinano-machi, Tokyo, Japan). The hemagglutinin (HA)-tagged IRF7 and IFN-α4 promoter luciferase constructs were kindly provided by Dr. Z. Jiang (Peking University, Beijing, China). The IFN-β reporter plasmid was from Dr. M. Schlee, and NF-κB luciferase reporter was from Dr. W. Kolanus (University of Bonn, Bonn, Germany). The Renilla reporter plasmid and pcDNA3.1 were from Promega (Mannheim, Germany) and Thermo Fisher Scientific. Myc-tagged wild-type and mutant ubiquitins were subcloned from HA-tagged wild-type and mutant ubiquitins (Addgene, Cambridge, MA) into the pMyc vector (Clontech, Saint-Germain-en-Laye, France). Primary Abs used were anti-HA (Clone: 3F10; Roche Diagnostics), anti-Flag (Clone: M2; Sigma-Aldrich, Taufkirchen, Germany), anti-Myc (Clone: 9E10; Clontech), anti-HA (Clone: Y-11), anti-Flag (Clone: D-8), anti-GAPDH (Clone: 0411), (Santa Cruz Biotechnology, Heidelberg, Germany), anti-SOCS1 (Clone: J192; IBL International, Hamburg, Germany), anti-SOCS3 (Clone: 19A5; IBL), anti-IRF7 (Clone:H-246; Santa Cruz Biotechnology), anti-histone H3 (Clone: D1H2), and anti-ubiquitin (Clone: P4D1) (Cell Signaling Technology, Frankfurt, Germany). HRP-conjugated secondary Abs were purchased from Santa Cruz Biotechnology. All chemicals were from Sigma-Aldrich if not otherwise mentioned.

Quantitative real-time PCR analysis

Total mRNA was isolated with the help of the NucleoSpin RNA XS kit or NucleoSpin RNA kit (Macherey-Nagel, Dueren, Germany). The cDNA was synthesized and real-time PCR was performed with special Taqman reagents of Applied Biosystems (Darmstadt, Germany) as described previously (30). Primers including probes were as follows: SOCS1 (Hs00864158_m1), SOCS3 (Hs01000485_g1), SOCS5 (Hs00751962_s1), IFN-β1 (Hs02621180_s1), and endogenous control 18s (4310893E) (Applied Biosystems).

Dual-luciferase reporter assays

293T or 293XL-hTLR7 cells were cotransfected with and without 50 ng IRF7, plus increasing amounts of Flag-tagged expression plasmid, and 25 ng firefly luciferase reporter construct driven by IFN-α4 promoter (IFN-α4-Luc), IFN-β promoter (IFN-β–luc), or 5× NF-κB responsive element (NF-κB-Luc), as well as 25 ng Renilla reporter plasmid (pRL-TK) as internal control. Control pcDNA3.1 was used to set total transfection plasmid amount at 800 ng/well. Twenty four hours posttransfection, cells were stimulated with 10 μg/ml R837 in fresh DMEM with 0.5% FCS for 6 h. Subsequently, cells were lysed using 100 μl of 1× Passive Lysis Buffer (Promega), and reporter gene activities were measured by Dual-Luciferase Reporter Assay kit (Promega) in a GloMax 96 Microplate Luminometer (Promega) following the manufacturer’s instructions. Data were normalized by the ratio of firefly luciferase activity to Renilla luciferase activity.

Measurement of IFN-α and IFN-β in cell culture supernatant

The IFN-α and IFN-β levels in the cell culture supernatant were quantified using VeriKine Human IFN-α ELISA kit and Human IFN-β ELISA kit (PBL Assay Science, NJ) according to manufacturer’s instructions.

Cell fractionation

After 24 h, Lipofectamine 3000 transfected cells were starved in 0.5% FCS DMEM medium for 3 h and stimulated with 10 μg/ml R837 for a further 5 h before harvest. Afterward, one-third of cells were lysed with RIPA buffer containing protease inhibitors (1 mM PMSF, 5 μg/ml Aprotinin, and 5 μg/ml Leupeptin) and 1× Halt Phosphatase Inhibitor Cocktail (Thermo Scientific, Bonn, Germany). Two-thirds of harvested cells were used for cell component protein isolation, which was performed as described previously (31). Briefly, the cell membrane was lysed in 200 μl buffer A supplemented with 0.5% Nonidet P-40. Cytoplasmic protein fraction was collected by centrifugation. The nuclear pellet was suspended in 15 μl of buffer B. After incubation and centrifugation, 15 μl of the supernatant was diluted with 75 μl of buffer C to obtain the final nuclear protein extracts. The protein concentration of different cell factions was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) or Protein Quantification Assay kit (Macherey-Nagel).

Immunoprecipitation and immunoblotting

Twenty four hours posttransfection, cells were lysed with lysis buffer and ultrasonic disintegration of cell structures (Branson Sonifier 250, G. Heinemann Ultraschall- und Labortechnik, Schwaebisch Gmuend, Germany). Fifty ∼ 150 μg of whole cell protein was incubated with 0.5 μg anti-Flag or anti-HA Ab for 1 h, followed by pull-down with 20 μl Protein G PLUS-Agarose (Santa Cruz Biotechnology) at 4°C. For direct coimmunoprecipitation (co-IP) experiments, cell lysates were incubated with 20 μl anti-FLAG M2 affinity gel (Sigma-Aldrich) or Anti-HA Affinity Matrix (Roche) for 3 h. After washing, bound proteins were eluted with 0.1 M Glycine (pH 2.8) (Thermo Fisher Scientific) or 1 mg/ml HA peptide and 100 μg/ml FLAG peptide.

Fifteen ∼30-μg protein or immunoprecipitated samples were denatured and separated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA). Proteins were detected by primary Ab and HRP-conjugated secondary Ab. Target proteins were visualized with ECL or ECL plus reagent (GE Healthcare, Munich, Germany) and images were acquired using ImageQuant LAS 4000 Luminescent Image Analyzer (GE Healthcare).

Immunofluorescence staining

Immunofluorescence staining was performed as described previously (29, 30). Briefly, primary pDCs remained unstimulated or stimulated with R837 or heat-inactivated IAV for 3 h. Cells were then fixed in 3% paraformaldehyde and permeabilized with 0.1% saponin. Cells were seeded onto Cell-Tak (BD Biosciences) treated cover slips (11.16 μg/cm2) and stained with anti-SOCS1 (Clone: J192; IBL), anti-SOCS3 (Clone: 19A5; IBL), and anti-IRF7 (Clone: H-246; Santa Cruz Biotechnology) Abs. After that, cells were stained with secondary Abs conjugated with Cy3 or Cy2 (Jackson ImmunoResearch Laboratories, Hamburg, Germany). The nuclei were counterstained with DAPI (Thermo Fisher Scientific). Confocal images were acquired by Leica SP5 AOBS with SMD confocal microscope with oil immersion objective lens 63 × 1.4 (Leica Microsystems, Wetzlar, Germany). Leica Application Suite X and CellProfiler 3.0.0 were used for picture analysis.

293XL-hTLR7 cells were cotransfected with HA-IRF7 and Flag-tagged SOCS construct for 24 h and seeded onto poly-l-lysine coated glass coverslips for overnight. After starvation in 0.5% FCS medium for 3 h, cells were stimulated with 10 μg/ml R837 for 1 h and then fixed and stained with the anti-FLAG M2 and anti-HA Abs followed by the Cy3-conjugated and anti-Rat IgG-NorthernLights 493 (R&D) secondary Abs. The nuclei were counterstained with DAPI. Confocal images were acquired by an Olympus FLUOVIEW FV1000 confocal microscope with a Plapo 60×, NA 1.49 oil immersion objective (Olympus, Hamburg, Germany). FV10-ASW 2.0 software (Olympus) was used for picture analysis.

In vivo ubiquitination assays

293T cells were transiently cotransfected with HA-IRF7, Flag-SOCS1/3, and wild-type or mutant Myc-tagged ubiquitin constructs. Twenty four hours later, cells were treated with 20 μM proteasome inhibitor MG132 (Tocris Bioscience, Bristol, U.K.) for 6 h before harvesting. Total proteins were purified with RIPA buffer containing 1 mM PMSF, 5 μg/ml Aprotinin, 5 μg/ml Leupeptin, 1 mM Na-orthovanadate, and 10 mM N-ethylmaleimide and denatured with 1% SDS at 95°C for 5 min to dissociate any noncovalently bound protein. Two hundred and fifty micrograms of denatured proteins were diluted 10 times with lysis buffer for immunoprecipitation (IP) with Anti-HA Affinity Matrix, and 10% was used for input controls. After IP, conjugated IRF7 was eluted with 0.1 M Glycine (pH 2.8), and ubiquitinated IRF7 was detected by immunoblotting (IB) with anti-Myc Ab.

In vitro ubiquitylation assays

HA-IRF7 and Flag-SOCS1/SOCS3 expressed in 293T cells were separately purified with MBL’s HA tagged protein purification kit (Clone: 5D8) and DDDDK-tagged protein purification kit (Clone: FLA-1) (Biozol, Eching, Germany). The assays were performed in 110 μl of ubiquitination assay buffer with 150 μM His-ubiquitin and 2.5 μM Ub-aldehyde, 0.3 μg of 3HA-IRF7, and 0.5 μg of Flag-SOCS1 or Flag-SOCS3 by using Ubiquitin Protein Conjugation kit (all from BostonBiochem, Cambridge, MA). Samples were incubated at 37°C for 3 h and reactions were quenched with 10 mM EDTA. Ubiquitination of IRF7 was evaluated by anti-His MicroBeads (Miltenyi Biotec) pull-down and further anti-HA IB.

Statistical analysis

The results were all from at least n = 3 independent experiments. Statistical analysis was performed with GraphPad Prism 5 (GraphPad Software, La Jolla, CA). Quantitative values were compared among the groups by using repeated measures one-way ANOVA with Tukey’s multiple comparisons test or paired Student t test for data normally distributed (passed Shapiro–Wilk normality test) and Friedmann’s test or Wilcoxon matched pairs test for data not normally distributed (not passed Shapiro–Wilk normality test). Results are shown as mean + SEM. Any p values are two-tailed and subject to a significance level of 5%.

Results

Elevated expression of SOCS1 and SOCS3 in pDC is directly induced by TLR7 activation

To investigate whether the expression of SOCS1, 3, and 5 are induced by TLR7 activation, freshly isolated human pDCs were stimulated with the synthetic TLR7 ligand R837. mRNA levels of SOCS1, SOCS3, and SOCS5 at 2 and 16 h after R837 stimulation were evaluated. mRNA expression of SOCS1 and SOCS3, but not SOCS5, was significantly upregulated after 2 h of stimulation (Fig. 1A). Next, pDCs were stimulated with synthetic HIV-1–derived ssRNA or heat-inactivated IAV, one natural TLR7 ligand. Interestingly, HIV-derived ssRNA VIFRNA327 and ssRNA40 exclusively enhanced SOCS3, but not SOCS1, mRNA expression as compared with control ssRNA stimulation (Fig. 1B). Furthermore, results from immunofluorescence staining demonstrated that both R837 and IAV stimulation induced elevated protein expression of both SOCS1 and SOCS3 in human primary pDCs (Fig. 1C). These results demonstrate that activation of TLR7 signaling via synthetic and natural ligands could induce SOCS1 and/or SOCS3 expression in pDCs and that different types of ligands distinctively modulate SOCS1 and/or SOCS3 expression.

FIGURE 1.
FIGURE 1.

the mRNA expression of SOCS1 and SOCS3 are directly induced by TLR7 activation in primary human pDCs. (A) pDCs were stimulated with 10 μM R837 or left unstimulated (n = 8 donors). (B) pDCs were stimulated for 2 h with 15 μg/ml HIV-1–derived ssRNA: VIFRNA327, ssRNA40 or individual control ssRNA VIFRNA327A, or ssRNA41 complexed with 30 μg/ml DOTAP liposomal transfection reagent (n = 5 donors). SOCSs mRNA were quantified by real-time PCR, and data represented relative fold change of mRNA level to unstimulated pDCs or control VIFRNA327–treated pDCs at 2 h. The mean + SEM from indicated individual experiments is shown. (C) pDCs were stimulated with R837, heat-inactivated IAV, or left unstimulated. After 3 h of stimulation, the cells were fixed and subjected to immunofluorescence staining for SOCS1 and SOCS3. Representative images (left, scale bar, 10 μm) and quantification of fluorescence intensity of SOCS1/3 in different groups (right) are shown (n = 4 independent experiments, five randomly selected out of 63× fields per sample were examined). (D) pDCs were stimulated with R837 for 2 h in the presence or absence of 2 μg/ml anti–IL-6 (n = 7), 20 μg/ml anti–IL-10 (n = 8), or 20 μg/ml anti–TNF-α neutralizing Ab (n = 3); or 3 μg/ml Ab against IFN-α/β receptor chain 2 (IFN-α/βR2) (n = 4). SOCSs mRNA was quantified by real-time PCR, and data represent relative fold change of mRNA level to unstimulated pDCs. The mean + SEM from indicated experiments is shown. *p < 0.05, **p < 0.01, ***p < 0.001.

It has been shown that upon activation, pDCs produce a large amount of type Ι IFNs (IFN-α/β) as well as proinflammatory cytokines, including IL-6, TNF-α, and IL-10 (32), which are able to induce SOCS1 and SOCS3 expression (12, 33–35). Therefore, we evaluated whether the upregulation of SOCS1 and SOCS3 after ligand stimulation in pDCs was related to primary TLR7 activation or a result of secondary effects mediated by cytokines released by pDCs. For this purpose, neutralizing or blocking Abs against IL-6, IL-10, TNF-α, or IFN-α/β receptor were added to R837-stimulated pDCs to block effects of those cytokines on pDCs (Fig. 1D). As a result, neutralization of IL-6, IL-10, TNF-α, or blockage of IFN-α/β receptor did not abrogate R837-induced SOCS1 and SOCS3 mRNA expression in pDCs, indicating that the increased expression of SOCS1 and SOCS3 mRNA in pDCs was induced directly by TLR7 activation, but not by secondary effects of autocrine/paracrine cytokines.

SOCS1 and SOCS3 suppress TLR7-mediated type I IFN production in human pDC cell line CAL-1

It has been shown that the pDC line, CAL-1 cells, share common phenotypic and functional properties of freshly isolated human pDCs after TLR7 activation (36, 37). Thus, we used CAL-1 cells to investigate the modulation of type I IFN production by SOCS1 and SOCS3 expression.

Similar to primary human pDCs, CAL-1 cells expressed high levels of SOCS1 and SOCS3 mRNA after stimulation with R837 (Fig. 2A). To investigate the effects of SOCS1 and SOCS3 on type I IFN production after TLR7 activation, as a next step, CAL-1 cells were transfected with SOCS1 or SOCS3 siRNAs, which reduced more than 60% of SOCS1 and SOCS3 expression without generating off-target effects (Fig. 2B). Either SOCS1 or SOCS3 knockdown significantly increased IFN-β mRNA expression as well as IFN-α and IFN-β protein production in response to TLR7 activation (Fig. 2C). In contrast, overexpression of SOCS1 or SOCS3 led to a significant decrease in type I IFN production after TLR7 activation (Fig. 2D). Together, the data indicate that SOCS1 and SOCS3 negatively regulate TLR7-mediated type I IFN production in human pDCs.

FIGURE 2.
FIGURE 2.

SOCS1 and SOCS3 negatively modulate type I IFN response in human pDC CAL-1 line following TLR7 activation (A) mRNA expression of SOCS1 and SOCS3 was strongly induced in TLR7-ligand–stimulated CAL-1 cells. 1 × 106/ml CAL-1 cells starved overnight were stimulated with R837 (5 μg/ml), heat-inactivated IAV, or left unstimulated for 3 h, and SOCSs mRNA expression was assessed by real-time PCR (n = 6). (B) 1 × 106/ml CAL-1 cells were transfected with siRNA (50 μM) to knock down gene expression. After 3 h of stimulation with the combination of R837 and IAV, the efficiency of mRNA knockdown was evaluated by real-time PCR and presented as percentage of mRNA levels of control siRNA transfected cells, which were set as 100% (n = 10). The products of one representative real-time PCR were proven by nuclear acid electrophoresis. (C) 1 × 106/ml CAL-1 cells were transfected with siRNAs and stimulated as described. The influence of SOCS1 and SOCS3 knockdown on type I IFN response in CAL-1 cells was evaluated by IFN-β mRNA real-time PCR (n = 10) (stimulated for 3 h) and secreted IFN-α (n = 6) and IFN-β (n = 7) by ELISA (stimulated for 24 h). (D) 2 × 106/ml CAL-1 cells were transfected with individual Flag-tagged plasmid or pcDNA3.1 plasmid and then stimulated with R837 plus IAV for a further 24 h. IFN-α (n = 7) and IFN-β (n = 7) in the cell supernatant were analyzed by ELISA. Data represent the mean + SEM from indicated independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

SOCS1 and SOCS3 suppress type I IFN production through IRF7

IRF7 is an essential transcription factor for type I IFN production in TLR7 signaling (5, 38). We could demonstrate that stimulation of TLR7 by R837 or IAV-induced transient expression of IRF7 protein in human primary pDCs (Fig. 3A). After 4–8 h stimulation, significantly higher IRF7 expression was detected in TLR7-activated pDCs compared with unstimulated primary pDCs. Interestingly, after 16 h of stimulation, remarkable decreased IRF7 expression was observed in stimulated pDCs, suggesting exit of a negative regulatory mechanism of IRF7 expression in TLR7-activated pDCs. Furthermore, knockdown of SOCS1 and SOCS3 expression in pDC cell line CAL-1 cells significantly increased the mRNA expression of IRF7 (Fig. 3B). We next wanted to investigate if SOCS1 and SOCS3 target IRF7 to downregulate type I IFN production in pDCs. For this purpose, we transfected 293T cells with IRF7-expressing vector and SOCS1/3 expression vector together with IFN-α4 or IFN-β luciferase reporter construct. Dual-luciferase reporter assays demonstrated that overexpression of either SOCS1 or SOCS3 suppressed both NF-κB activation and IFN-β transcription after R837 stimulation (Fig. 3C). Furthermore, overexpression of IRF7-induced robust IFN-α4 and IFN-β transcription, which was dose-dependently suppressed by SOCS1 or SOCS3 overexpression (Fig. 3D). Those results were further confirmed by real-time PCR assays in which IFN-β mRNA expression driven by IRF7 overexpression was significantly decreased by overexpression of SOCS1 and SOCS3 (Fig. 3E). Together, the data demonstrate that IRF7 is the key target for the suppression of SOCS1 and SOCS3 on type I IFN production.

FIGURE 3.
FIGURE 3.

SOCS1 and SOCS3 suppress TLR7-mediated activation of NF-κB and type I IFN production in an IRF7-dependent manner. (A) pDCs were stimulated with R837, heat-inactivated IAV, or left unstimulated. At 0, 4, 8, and 16 h, pDCs were collected and subjected to intracellular staining for IRF7. The expression of IRF7 was evaluated by flow cytometry (n = 10 donor). The mean fluorescence intensity (MFI) of IRF7 of primary pDCs is shown. (B) CAL-1 cells were transfected with siRNAs and stimulated as described elsewhere. The influence of SOCS1 and SOCS3 knockdown on IRF7 mRNA expression in CAL-1 cells was evaluated by real-time PCR (n = 8). (C) 293XL-hTLR7 cells were transfected with increasing amounts of FLAG, FLAG-SOCS1, or FLAG-SOCS3 expression plasmid (100; 250; 500 ng/well), plus 25 ng/well firefly luciferase reporter construct containing individual promotor NF-κB-Luc, IFN-α4-Luc, or IFN-β–luc, plus 25 ng/well pRL-TK as an internal control. After 24 h, transfected cells were left unstimulated or stimulated with R837 (10 μg/ml) for another 6 h. (D) 293T cells were transfected with or without IRF7 (50 ng/well), plus increasing amounts of FLAG, FLAG-SOCS1, or FLAG-SOCS3 expression plasmids (100; 250; 500 ng/well) as well as 25 ng/well IFN-α4-Luc or IFN-β–luc and 25 ng/well pRL-TK for 24 h. Promoter activities were measured by dual-luciferase reporter assays, and results were presented relative to the luciferase activity in control cells. One representative of four independent experiments is shown. (E) IFN-β mRNA level in 293T cells transfected with or without IRF7 (200 ng/well), together with Flag-tagged construct (600 ng/well), was evaluated by quantitative real-time PCR (n = 6). Mean value + SEM of n = 6 independent experiments is shown. *p < 0.05, **p < 0.01, ****p < 0.0001.

SOCS1 and SOCS3 directly interact with IRF7

To test in which way SOCS1 and SOCS3 interact with IRF7 to suppress type I IFN production, co-IP experiments were performed. 293T cells were transfected with expression plasmids of HA-tagged IRF7 and Flag-tagged SOCS1/3. Direct interaction between SOCS1/3 and IRF7 was detected in reciprocal co-IP assays with anti-Flag and anti-HA Abs (Fig. 4A, 4B). Results of immunofluorescence confocal microscopy demonstrated that TLR7 activation via R837 led to the aggregation of IRF7 in the nucleus within 60 min. Interestingly, Flag-SOCS1 or Flag-SOCS3, but not control Flag, colocalized with IRF7 in punctate nuclear structures after TLR7 activation (Fig. 4C merge). Furthermore, IB with subcellular fractions demonstrated that overexpression of SOCS1 or SOCS3 did not block the accumulation of IRF7 in the nucleus in both unstimulated and R837-stimulated cells (Fig. 4D, line 1 and 5). In consistence with the confocal data, stronger expression of SOCS1 and SOCS3 in nuclei upon R837 stimulation was observed (Fig. 4D, line 2 and 6). Moreover, we could show that SOCS1/3 interacted with IRF7 mainly in nuclear components, and this interaction was further enhanced by R837 stimulation (Fig. 4E). The direct interactions of SOCS1 and SOCS3 with IRF7 were further confirmed in TLR7-activated human primary pDCs (Fig. 4F). Confocal images demonstrated that IRF7 in pDCs translocated into nucleus following stimulation either with R837 or IAV. After TLR7 activation, the nuclear colocalization of SOCS1 and IRF7 was, remarkably, observed. Furthermore, the colocalization of SOCS3 and IRF7 were observed in both cytoplasm and nucleus of human primary pDCs. The data demonstrate that SOCS1 and SOCS3 do not affect nuclear translocation of IRF7 but might interact with IRF7 to perform modulatory functions.

FIGURE 4.
FIGURE 4.

SOCS1 and SOCS3 interact with IRF7. 293T cells were transiently transfected with combinations of HA-IRF7 and Flag or Flag-SOCS1 or Flag-SOCS3. Twenty four hours later, cell lysate was immunoprecipitated with anti-Flag (A) or anti-HA (B) or control mouse IgG followed by IB with anti-HA and anti-Flag. (C) SOCS1 or SOCS3 cotranslocates with IRF7 into the nucleus. 293XL-hTLR7 cells were transfected with combinations of HA-IRF7 and Flag-tagged constructs and stimulated with 10 μg/ml R837 for 1 h. Cellular location of IRF7 and SOCS1/3 was determined by immunofluorescence microscopy (original magnification ×600). (D) and (E) 293XL-hTLR7 cells were transiently transfected with combinations of HA-IRF7 and FLAG-SOCS1 or SOCS3. After 24 h, cells were stimulated with 10 μg/ml R837 for 5 h. Cells were lysed to purify nuclear proteins (NP), cytoplasm proteins (CP) and whole cell proteins (WP), and the expression of IRF7 and SOCS1/3 in individual subcellular components were detected by IB. (F) Colocalization of SOCS1 and SOCS3 with IRF7 in the human primary pDCs after 3 h stimulation with R837 or IAV. Confocal laser scanning microscopy images of SOCS1 (red), SOCS3 (red), IRF7 (green), and nuclei (blue) in human primary pDCs are shown. One of three repeatable experiments is shown (scale bar, 10 μm).

SH2 domains of SOCS1 and SOCS3 contribute to the binding to IRF7

To identify the binding region of SOCS1 and SOCS3 to IRF7, Flag-tagged deletion mutants of SOCS1/3 were constructed as described (39, 40) (Fig. 5A, 5B, upper panels), and their interactions with exogenous HA-tagged IRF7 were tested by co-IP assays (Fig. 5A, 5B, lower panels). SOCS1 mutants without KIR and ESS as well as SOCS box still bound IRF7. SOCS1 mutants lacking the N-terminal portion of the SH2 domain (SH2 Δ79–129) or C-terminal portion of the SH2 domain containing NLS domain (SH2Δ130–172) did not lose their affinity to IRF7 as well. In contrast, deletion of the whole SH2 domain (SH2 Δ78–153) or deletion of the SH2 domain together with the NLS domain (SH2 Δ79–172) completely abolished SOCS1 binding to IRF7. Similar results were achieved for SOCS3 (Fig. 5B, lower panel). Deletion of KIR and ESS or SOCS Box of SOCS3 did not interfere with the interaction of SOCS1/3 with IRF7. Because SOCS3 mutants with complete deletion of the SH2 domain were instable, SOCS3 mutants with submotif deletion in the SH2 domain were constructed (36). Neither deletion of PEST motif (SH2⊿129–163) nor BG-loop containing βG strand’s truncate (SH2⊿164–185) diminished the binding capacity of SOCS3 to IRF7. However, the truncation of the αβ helix of the SH2 domain (SH2⊿46–128) abrogated SOCS3 binding to IRF7. These results imply that the SH2 domain is responsible for SOCS1/3 binding to IRF7.

FIGURE 5.
FIGURE 5.

Deletion the SH2 domain of SOCS1 and SOCS3 prevents IRF7 binding. Various functional domains of SOCS1 and SOCS3 were sequentially deleted, which are schematically indicated in the upper panels of (A) and (B). Both wild-type and mutants of SOCS1 or SOCS3 were transfected together with IRF7 plasmids into 293T cells. The interaction of SOCS1/3 and IRF7 was detected by IP with an anti-HA Ab, followed by IB.

SOCS1 and SOCS3 target IRF7 for proteasomal degradation, which is mediated by polyubiquitination

We wanted to test whether SOCS proteins cause ubiquitin-mediated degradation of IRF7. We found that steady-state level of IRF7 protein was significantly and dose-dependently decreased by the expression of SOCS1 or SOCS3 in 293T cells (Fig. 6A). Analysis of the IRF7 half-life showed that the rate of IRF7 protein turnover increased when SOCS1 or SOCS3 were simultaneously expressed (Fig. 6B). Furthermore, the addition of the proteasome inhibitor MG132 prevented SOCS1- or SOCS3-mediated IRF7 degradation (Fig. 6C). Together, these data demonstrate that SOCS1 and SOCS3 target IRF7 for proteasomal degradation.

FIGURE 6.
FIGURE 6.

SOCS1 and SOCS3 promote ubiquitination and degradation of IRF7. (A) SOCS1 and SOCS3 promote the turnover of IRF7 in a dose-dependent manner. 293T cells were transfected with 150 ng of HA-IRF7 with increasing amounts of Flag-SOCS1 or 3 (100, 300, or 650 ng) for 24 h. The presence of IRF7 and SOCS1/3 were detected by IB. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to control (Flag-IRF7 transfected 293T cells, and the expression was set as 100) (n = 3). (B) Half-life analysis of IRF7 in the presence of SOCS1 or SOCS3 was performed. 293T cells were transfected with 150 ng HA-IRF7 and 650 ng Flag-tagged construct. After 24 h, cells were treated with protein synthesis inhibitor cycloheximide (CHX) 200 μg/ml for the indicated time before analysis of the protein level by Western blotting. One representative experiment data from two PVDF membranes (spliced by vertical lines) are shown. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (Flag-IRF7 transfected 293T cells, 0 h, and the expression was set as 100) (n = 3). (C) 293T cells were transfected with 200 ng HA-IRF7, 800 ng Flag-tagged SOCS, or 500 ng Myc-ubiquitin. Twenty four hour post transfection, cells were treated with MG-132 (10 μM) or DMSO as a control for 6 h before harvesting. IB was performed as indicated. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (the expression was set as 100) (n = 3). *p < 0.05, **p < 0.01. (D) 293T cells were transfected with 500 ng HA-IRF7, 1 μg Flag-tagged SOCS, or 1 μg Myc-ubiquitin for 24 h in the presence of MG-132 during the last 6 h. Ubiquitinated IRF7 was immunoprecipitated by using anti-HA Ab and detected by IB with an Ab against Myc. (E) HA-IRF7, Flag-SOCS1, and Flag-SOCS3 were expressed in 293T cells and purified with anti-HA tag and anti-Flag tag beads. In vitro ubiquitination of IRF7 promoted by increasing amounts of SOCS1/3 in the presence of His-Ubiquitin was performed and detected by IP followed by IB. (F) 293T cells were transfected with 150 ng of HA-IRF7, 650 ng of Flag-SOCS1 or 3, and 400 ng of Myc-tagged ubiquitin mutants for 24 h. Some cells were treated with 10 μM MG-132 during the last 6 h. Afterward, cells were lysed for IB assay. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (the expression was set as 100) (n = 3).

Ubiquitination is an essential pathway for protein degradation. As a next step, we investigated whether the observed IRF7 degradation was mediated by ubiquitination. In vivo ubiquitination assays revealed that remarkably more IRF7 was labeled with polyubiquitin in SOCS1 and SOCS3 overexpression groups than control groups (Fig. 6D). Furthermore, in vitro ubiquitination assays with synthesized proteins demonstrated that SOCS1 and SOCS3 could directly ubiquitinate IRF7 (Fig. 6E). Moreover, we determined that the ubiquitination of IRF7 was K48- or K63-linked by utilizing ubiquitin mutants in which only lysine 48 (K48) or 63 (K63) was retained, and other lysines were replaced by arginine residues. Either the expression of K63 ubiquitin or the addition of the proteasome inhibitor MG132 was able to reverse IRF7 degradation by SOCS1 and SOCS3 (Fig. 6F). In contrast, coexpression of K48 ubiquitin did not influence IRF7 degradation. The data suggest that IRF7 degradation induced by SOCS1 and SOCS3 depends on K48-linked ubiquitination (Fig. 7).

FIGURE 7.
FIGURE 7.

A model of feedback downregulation of TLR7-induced type I IFN by SOCS1 and SOCS3. Upon TLR7 activation, pDCs release type I IFN and immediately and directly upregulate expression of SOCS1 as well as SOCS3. SOCS1 and SOCS3 proteins are able to directly inhibit IFN-α/β production by targeting IRF7 for K48 ubiquitination-mediated degradation. In addition, SOCS1 protein is able to block IFN-α/β signal transduction by targeting JAK-STAT.

Discussion

In this study, we report that SOCS1 and SOCS3 are rapidly induced in human pDCs upon stimulation with natural as well as synthetic ligands to TLR7. We demonstrate that SOCS1 and SOCS3 downregulate TLR7-mediated type I IFN production through direct interaction with IRF7 via the SH2 domain. Furthermore, we show that binding of SOCS1 and SOCS3 to IRF7 leads to the degradation of IRF7 through K48-linked ubiquitination.

Activated pDCs regulate innate and adaptive immunity in antiviral and inflammatory responses with their unique ability of Ag presentation and marked type I IFN production. Due to their function as the main type I IFN producers, they are potential targets for invading pathogens. Several types of viruses, such as hepatitis C virus, hepatitis B virus, and respiratory syncytial virus, have developed strategies to use SOCS proteins to circumvent the protective effects of IFNs (14–16). This emphasizes the essential function of SOCS proteins in the regulation of immune responses. It has been shown that the expression of SOCS1 or SOCS3 can be induced by TLR signaling. For example, HIV-1, but not secreted cytokines such as IL-10 and IFN-β, induce SOCS3 expression in macrophages at early time points to inhibit antiviral IFN-β signaling (41). In line with this finding, we could demonstrate that HIV ssRNA ligands induced SOCS3 expression in pDCs at early stages of stimulation, which suggests HIV may use this immune escape strategy to suppress IFN-α/β production to infect other cell types.

The IRFs family represents a family of transcription factors important for type I IFN production (42). It has been shown that IRF3 is a major transcription factor for TLR3 and RIG-I to prime IFN-α/β production, whereas IRF7 is important for TLR7 and TLR9 (38). Inhibiting dimerization and nuclear translocation of IRF3 and/or IRF7 leads to impaired type I IFN production (43, 44). Furthermore, ubiquitin-mediated degradation of IRF3 and IRF7 represents another important mechanism to regulate type I IFN production (43). In humans, peptidyl-prolyl isomerase Pin1, E3 Ub ligase RBCK1, and transcription factor FoxO1 interact with IRF3 for proteasomal degradation (45–47), whereas HECT domain E3 Ub ligase RAUL, tripartite motif family member Ro52 (TRIM21), and TRIM25 lead to IRF3 or IRF7 ubiquitination and subsequent degradation upon simulation of TLR3/4 or TLR7/9 (48–51).

So far, it remains largely unknown how type I IFN signaling is regulated by SOCS proteins. In this article, we demonstrate that after TLR7 activation in pDCs, SOCS1/3 directly target IRF7 to mediate degradation. Such a negative regulation of type I IFN production via suppression of TLR7-IRF7 signaling by SOCS1/3 identified in this study might represent a new feedback mechanism to protect the host from damage by elongated and excessive IFN-α/β production at early stages of infection (Fig. 7). However, because many types of viruses have the potential to induce the expression of SOCS1 and/or SOCS3 in host cells during infection (14–18), this negative regulation might represent a novel SOCS1/3–mediated viral immune evasion mechanism, leading to the dampening of type I IFN production by pDCs to allow rapid viral replication.

Accumulating evidence suggests that the IRF family members are novel targets for SOCS proteins. Furthermore, ubiquitination is a common way of posttranslational modification of IRF expression to regulate immune responses (43). A recent observation demonstrated that the increased expression of SOCS1 induced by human T cell leukemia virus-1 directly interacts with IRF3 for ubiquitin-mediated degradation by SOCS-Box E3 ligase (52). In this study, we could demonstrate that the expression of IRF7 is regulated by SOCS1 and SOCS3 through K48-linked ubiquitination and proteasomal degradation of IRF7. Because many PRRs, such as TLRs and RLR employ IRF7 as a transcription factor in their signaling pathways, our data suggest that SOCS1/3 could act as part of endogenous E3 ligase to negatively regulate PRR-mediated type I IFN production. IRF proteins need to undergo phosphorylation at serine but not tyrosine residues, which are not typical substrates of SOCS1/3. Detailed mechanisms of how SOCS1/3 interact with serine-phosphorylated IRF proteins for ubiquitination and which components are recruited to the E3 ligase complexes need to be further elucidated.

In summary, we demonstrate that SOCS1 and SOCS3 are induced by TLR7-MyD88-IRF7 signaling in pDCs and serve as a negative feedback mechanism to directly downregulate type I IFN production by interacting with IRF7 for K48-linked ubiquitination and degradation. These results might identify SOCS1 and SOCS3 as putative therapeutic targets in human diseases in which aberrant type I IFN production of pDCs plays a role.

Disclosures

The authors have no financial conflicts of interest.

Acknowledgments

We thank the Microscopy Core Facility, University of Bonn, for offering the platform for the use of confocal microscopes and for facilitating image acquisition and analysis. We thank Juana Hart and Said Benfadal for excellent technical assistance.

Footnotes

  • This work was supported by Deutsche Forschungsgemeinschaft Grant SFB704, a Cluster of Excellence ImmunoSensation grant, and a Christine Kühne – Center for Allergy Research and Education grant.

  • Abbreviations used in this article:

    co-IP
    coimmunoprecipitation
    ESS
    extended SH2 subdomain
    HA
    hemagglutinin
    IAV
    influenza A virus
    IB
    immunoblotting
    IP
    immunoprecipitation
    IRF
    IFN regulatory factor
    KIR
    kinase inhibitory region
    pDC
    plasmacytoid dendritic cell
    PRR
    pathogen recognition receptor
    SOCS
    suppressor of cytokine signaling.

  • Received April 10, 2017.
  • Accepted April 10, 2018.

References

  1. ↵
    1. Theofilopoulos, A. N.,
    2. R. Baccala,
    3. B. Beutler,
    4. D. H. Kono
    . 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu. Rev. Immunol. 23: 307–336.
    OpenUrlCrossRefPubMed
  2. ↵
    1. Ito, T.,
    2. H. Kanzler,
    3. O. Duramad,
    4. W. Cao,
    5. Y. J. Liu
    . 2006. Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells. Blood 107: 2423–2431.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Liu, Y. J.
    2005. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu. Rev. Immunol. 23: 275–306.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Guiducci, C.,
    2. R. L. Coffman,
    3. F. J. Barrat
    . 2009. Signalling pathways leading to IFN-alpha production in human plasmacytoid dendritic cell and the possible use of agonists or antagonists of TLR7 and TLR9 in clinical indications. J. Intern. Med. 265: 43–57.
    OpenUrlCrossRefPubMed
  5. ↵
    1. Gilliet, M.,
    2. W. Cao,
    3. Y. J. Liu
    . 2008. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat. Rev. Immunol. 8: 594–606.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Blasius, A. L.,
    2. B. Beutler
    . 2010. Intracellular toll-like receptors. Immunity 32: 305–315.
    OpenUrlCrossRefPubMed
    1. Deane, J. A.,
    2. P. Pisitkun,
    3. R. S. Barrett,
    4. L. Feigenbaum,
    5. T. Town,
    6. J. M. Ward,
    7. R. A. Flavell,
    8. S. Bolland
    . 2007. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity 27: 801–810.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Pisitkun, P.,
    2. J. A. Deane,
    3. M. J. Difilippantonio,
    4. T. Tarasenko,
    5. A. B. Satterthwaite,
    6. S. Bolland
    . 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312: 1669–1672.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Elliott, J.,
    2. J. A. Johnston
    . 2004. SOCS: role in inflammation, allergy and homeostasis. Trends Immunol. 25: 434–440.
    OpenUrlCrossRefPubMed
  10. ↵
    1. Yoshimura, A.,
    2. T. Naka,
    3. M. Kubo
    . 2007. SOCS proteins, cytokine signalling and immune regulation. Nat. Rev. Immunol. 7: 454–465.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Piessevaux, J.,
    2. D. Lavens,
    3. F. Peelman,
    4. J. Tavernier
    . 2008. The many faces of the SOCS box. Cytokine Growth Factor Rev. 19: 371–381.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Croker, B. A.,
    2. H. Kiu,
    3. S. E. Nicholson
    . 2008. SOCS regulation of the JAK/STAT signalling pathway. Semin. Cell Dev. Biol. 19: 414–422.
    OpenUrlCrossRefPubMed
  13. ↵
    1. Dimitriou, I. D.,
    2. L. Clemenza,
    3. A. J. Scotter,
    4. G. Chen,
    5. F. M. Guerra,
    6. R. Rottapel
    . 2008. Putting out the fire: coordinated suppression of the innate and adaptive immune systems by SOCS1 and SOCS3 proteins. Immunol. Rev. 224: 265–283.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Bode, J. G.,
    2. S. Ludwig,
    3. C. Ehrhardt,
    4. U. Albrecht,
    5. A. Erhardt,
    6. F. Schaper,
    7. P. C. Heinrich,
    8. D. Häussinger
    . 2003. IFN-alpha antagonistic activity of HCV core protein involves induction of suppressor of cytokine signaling-3. FASEB J. 17: 488–490.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Yokota, S.,
    2. N. Yokosawa,
    3. T. Okabayashi,
    4. T. Suzutani,
    5. S. Miura,
    6. K. Jimbow,
    7. N. Fujii
    . 2004. Induction of suppressor of cytokine signaling-3 by herpes simplex virus type 1 contributes to inhibition of the interferon signaling pathway. J. Virol. 78: 6282–6286.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Xu, Y.,
    2. Y. Hu,
    3. B. Shi,
    4. X. Zhang,
    5. J. Wang,
    6. Z. Zhang,
    7. F. Shen,
    8. Q. Zhang,
    9. S. Sun,
    10. Z. Yuan
    . 2009. HBsAg inhibits TLR9-mediated activation and IFN-alpha production in plasmacytoid dendritic cells. Mol. Immunol. 46: 2640–2646.
    OpenUrlCrossRefPubMed
  17. ↵
    1. Moore, E. C.,
    2. J. Barber,
    3. R. A. Tripp
    . 2008. Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15). Virol. J. 5: 116.
    OpenUrlCrossRefPubMed
  18. ↵
    1. Oshansky, C. M.,
    2. T. M. Krunkosky,
    3. J. Barber,
    4. L. P. Jones,
    5. R. A. Tripp
    . 2009. Respiratory syncytial virus proteins modulate suppressors of cytokine signaling 1 and 3 and the type I interferon response to infection by a toll-like receptor pathway. Viral Immunol. 22: 147–161.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Heeg, K.,
    2. A. Dalpke
    . 2003. TLR-induced negative regulatory circuits: role of suppressor of cytokine signaling (SOCS) proteins in innate immunity. Vaccine 21(Suppl. 2): S61–S67.
    OpenUrlCrossRefPubMed
  20. ↵
    1. Hanada, T.,
    2. H. Yoshida,
    3. S. Kato,
    4. K. Tanaka,
    5. K. Masutani,
    6. J. Tsukada,
    7. Y. Nomura,
    8. H. Mimata,
    9. M. Kubo,
    10. A. Yoshimura
    . 2003. Suppressor of cytokine signaling-1 is essential for suppressing dendritic cell activation and systemic autoimmunity. Immunity 19: 437–450.
    OpenUrlCrossRefPubMed
  21. ↵
    1. Dalpke, A. H.,
    2. S. Opper,
    3. S. Zimmermann,
    4. K. Heeg
    . 2001. Suppressors of cytokine signaling (SOCS)-1 and SOCS-3 are induced by CpG-DNA and modulate cytokine responses in APCs. J. Immunol. 166: 7082–7089.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    1. Nakagawa, R.,
    2. T. Naka,
    3. H. Tsutsui,
    4. M. Fujimoto,
    5. A. Kimura,
    6. T. Abe,
    7. E. Seki,
    8. S. Sato,
    9. O. Takeuchi,
    10. K. Takeda, et al
    . 2002. SOCS-1 participates in negative regulation of LPS responses. Immunity 17: 677–687.
    OpenUrlCrossRefPubMed
  23. ↵
    1. Mansell, A.,
    2. R. Smith,
    3. S. L. Doyle,
    4. P. Gray,
    5. J. E. Fenner,
    6. P. J. Crack,
    7. S. E. Nicholson,
    8. D. J. Hilton,
    9. L. A. O’Neill,
    10. P. J. Hertzog
    . 2006. Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat. Immunol. 7: 148–155.
    OpenUrlCrossRefPubMed
  24. ↵
    1. Frobøse, H.,
    2. S. G. Rønn,
    3. P. E. Heding,
    4. H. Mendoza,
    5. P. Cohen,
    6. T. Mandrup-Poulsen,
    7. N. Billestrup
    . 2006. Suppressor of cytokine signaling-3 inhibits interleukin-1 signaling by targeting the TRAF-6/TAK1 complex. Mol. Endocrinol. 20: 1587–1596.
    OpenUrlCrossRefPubMed
  25. ↵
    1. Novak, N.,
    2. J. P. Allam,
    3. T. Hagemann,
    4. C. Jenneck,
    5. S. Laffer,
    6. R. Valenta,
    7. J. Kochan,
    8. T. Bieber
    . 2004. Characterization of FcepsilonRI-bearing CD123 blood dendritic cell antigen-2 plasmacytoid dendritic cells in atopic dermatitis. J. Allergy Clin. Immunol. 114: 364–370.
    OpenUrlCrossRefPubMed
  26. ↵
    1. Yu, C. F.,
    2. W. M. Peng,
    3. J. Oldenburg,
    4. J. Hoch,
    5. T. Bieber,
    6. A. Limmer,
    7. G. Hartmann,
    8. W. Barchet,
    9. A. M. Eis-Hübinger,
    10. N. Novak
    . 2010. Human plasmacytoid dendritic cells support Th17 cell effector function in response to TLR7 ligation. J. Immunol. 184: 1159–1167.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Doni, A.,
    2. M. Michela,
    3. B. Bottazzi,
    4. G. Peri,
    5. S. Valentino,
    6. N. Polentarutti,
    7. C. Garlanda,
    8. A. Mantovani
    . 2006. Regulation of PTX3, a key component of humoral innate immunity in human dendritic cells: stimulation by IL-10 and inhibition by IFN-gamma. J. Leukoc. Biol. 79: 797–802.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Moll, H. P.,
    2. H. Freudenthaler,
    3. A. Zommer,
    4. E. Buchberger,
    5. C. Brostjan
    . 2008. Neutralizing type I IFN antibodies trigger an IFN-like response in endothelial cells. J. Immunol. 180: 5250–5256.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Steinhagen, F.,
    2. L. G. Rodriguez,
    3. D. Tross,
    4. P. Tewary,
    5. C. Bode,
    6. D. M. Klinman
    . 2016. IRF5 and IRF8 modulate the CAL-1 human plasmacytoid dendritic cell line response following TLR9 ligation. Eur. J. Immunol. 46: 647–655.
    OpenUrl
  30. ↵
    1. Peng, W. M.,
    2. C. F. Yu,
    3. W. Kolanus,
    4. A. Mazzocca,
    5. T. Bieber,
    6. S. Kraft,
    7. N. Novak
    . 2011. Tetraspanins CD9 and CD81 are molecular partners of trimeric FcɛRI on human antigen-presenting cells. Allergy 66: 605–611.
    OpenUrlCrossRefPubMed
  31. ↵
    1. Wang, P.,
    2. P. Wu,
    3. M. I. Siegel,
    4. R. W. Egan,
    5. M. M. Billah
    . 1995. Interleukin (IL)-10 inhibits nuclear factor kappa B (NF kappa B) activation in human monocytes. IL-10 and IL-4 suppress cytokine synthesis by different mechanisms. J. Biol. Chem. 270: 9558–9563.
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Simpson, J.,
    2. K. Miles,
    3. M. Trüb,
    4. R. MacMahon,
    5. M. Gray
    . 2016. Plasmacytoid dendritic cells respond directly to apoptotic cells by secreting immune regulatory IL-10 or IFN-α. Front. Immunol. 7: 590.
    OpenUrl
  33. ↵
    1. Croker, B. A.,
    2. D. L. Krebs,
    3. J. G. Zhang,
    4. S. Wormald,
    5. T. A. Willson,
    6. E. G. Stanley,
    7. L. Robb,
    8. C. J. Greenhalgh,
    9. I. Förster,
    10. B. E. Clausen, et al
    . 2003. SOCS3 negatively regulates IL-6 signaling in vivo. Nat. Immunol. 4: 540–545.
    OpenUrlCrossRefPubMed
    1. Schindler, C.,
    2. C. Plumlee
    . 2008. Inteferons pen the JAK-STAT pathway. Semin. Cell Dev. Biol. 19: 311–318.
    OpenUrlCrossRefPubMed
  35. ↵
    1. Kimura, A.,
    2. T. Naka,
    3. S. Nagata,
    4. I. Kawase,
    5. T. Kishimoto
    . 2004. SOCS-1 suppresses TNF-alpha-induced apoptosis through the regulation of Jak activation. Int. Immunol. 16: 991–999.
    OpenUrlCrossRefPubMed
  36. ↵
    1. Hilbert, T.,
    2. F. Steinhagen,
    3. C. Weisheit,
    4. G. Baumgarten,
    5. A. Hoeft,
    6. S. Klaschik
    . 2015. Synergistic stimulation with different TLR7 ligands modulates gene expression patterns in the human plasmacytoid dendritic cell line CAL-1. Mediators Inflamm. 2015: 948540.
    OpenUrl
  37. ↵
    1. Maeda, T.,
    2. K. Murata,
    3. T. Fukushima,
    4. K. Sugahara,
    5. K. Tsuruda,
    6. M. Anami,
    7. Y. Onimaru,
    8. K. Tsukasaki,
    9. M. Tomonaga,
    10. R. Moriuchi, et al
    . 2005. A novel plasmacytoid dendritic cell line, CAL-1, established from a patient with blastic natural killer cell lymphoma. Int. J. Hematol. 81: 148–154.
    OpenUrlCrossRefPubMed
  38. ↵
    1. Honda, K.,
    2. T. Taniguchi
    . 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6: 644–658.
    OpenUrlCrossRefPubMed
  39. ↵
    1. Babon, J. J.,
    2. E. J. McManus,
    3. S. Yao,
    4. D. P. DeSouza,
    5. L. A. Mielke,
    6. N. S. Sprigg,
    7. T. A. Willson,
    8. D. J. Hilton,
    9. N. A. Nicola,
    10. M. Baca, et al
    . 2006. The structure of SOCS3 reveals the basis of the extended SH2 domain function and identifies an unstructured insertion that regulates stability. Mol. Cell 22: 205–216.
    OpenUrlCrossRefPubMed
  40. ↵
    1. Strebovsky, J.,
    2. P. Walker,
    3. R. Lang,
    4. A. H. Dalpke
    . 2011. Suppressor of cytokine signaling 1 (SOCS1) limits NFkappaB signaling by decreasing p65 stability within the cell nucleus. FASEB J. 25: 863–874.
    OpenUrlAbstract/FREE Full Text
  41. ↵
    1. Akhtar, L. N.,
    2. H. Qin,
    3. M. T. Muldowney,
    4. L. L. Yanagisawa,
    5. O. Kutsch,
    6. J. E. Clements,
    7. E. N. Benveniste
    . 2010. Suppressor of cytokine signaling 3 inhibits antiviral IFN-beta signaling to enhance HIV-1 replication in macrophages. J. Immunol. 185: 2393–2404.
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. Honda, K.,
    2. A. Takaoka,
    3. T. Taniguchi
    . 2006. Type I interferon [corrected] gene induction by the interferon regulatory factor family of transcription factors. Immunity 25: 349–360.
    OpenUrlCrossRefPubMed
  43. ↵
    1. Ning, S.,
    2. J. S. Pagano,
    3. G. N. Barber
    . 2011. IRF7: activation, regulation, modification and function. Genes Immun. 12: 399–414.
    OpenUrlCrossRefPubMed
  44. ↵
    1. Tsuchida, T.,
    2. T. Kawai,
    3. S. Akira
    . 2009. Inhibition of IRF3-dependent antiviral responses by cellular and viral proteins. Cell Res. 19: 3–4.
    OpenUrlCrossRefPubMed
  45. ↵
    1. Saitoh, T.,
    2. A. Tun-Kyi,
    3. A. Ryo,
    4. M. Yamamoto,
    5. G. Finn,
    6. T. Fujita,
    7. S. Akira,
    8. N. Yamamoto,
    9. K. P. Lu,
    10. S. Yamaoka
    . 2006. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1. Nat. Immunol. 7: 598–605.
    OpenUrlCrossRefPubMed
    1. Zhang, M.,
    2. Y. Tian,
    3. R. P. Wang,
    4. D. Gao,
    5. Y. Zhang,
    6. F. C. Diao,
    7. D. Y. Chen,
    8. Z. H. Zhai,
    9. H. B. Shu
    . 2008. Negative feedback regulation of cellular antiviral signaling by RBCK1-mediated degradation of IRF3. Cell Res. 18: 1096–1104.
    OpenUrlCrossRefPubMed
  47. ↵
    1. Lei, C. Q.,
    2. Y. Zhang,
    3. T. Xia,
    4. L. Q. Jiang,
    5. B. Zhong,
    6. H. B. Shu
    . 2013. FoxO1 negatively regulates cellular antiviral response by promoting degradation of IRF3. J. Biol. Chem. 288: 12596–12604.
    OpenUrlAbstract/FREE Full Text
  48. ↵
    1. Yu, Y.,
    2. G. S. Hayward
    . 2010. The ubiquitin E3 ligase RAUL negatively regulates type i interferon through ubiquitination of the transcription factors IRF7 and IRF3. Immunity 33: 863–877.
    OpenUrlCrossRefPubMed
    1. Higgs, R.,
    2. J. Ní Gabhann,
    3. N. Ben Larbi,
    4. E. P. Breen,
    5. K. A. Fitzgerald,
    6. C. A. Jefferies
    . 2008. The E3 ubiquitin ligase Ro52 negatively regulates IFN-beta production post-pathogen recognition by polyubiquitin-mediated degradation of IRF3. J. Immunol. 181: 1780–1786.
    OpenUrlAbstract/FREE Full Text
    1. Higgs, R.,
    2. E. Lazzari,
    3. C. Wynne,
    4. J. Ní Gabhann,
    5. A. Espinosa,
    6. M. Wahren-Herlenius,
    7. C. A. Jefferies
    . 2010. Self protection from anti-viral responses--Ro52 promotes degradation of the transcription factor IRF7 downstream of the viral Toll-like receptors. PLoS One 5: e11776.
    OpenUrlCrossRefPubMed
  51. ↵
    1. Wang, Y.,
    2. S. Yan,
    3. B. Yang,
    4. Y. Wang,
    5. H. Zhou,
    6. Q. Lian,
    7. B. Sun
    . 2015. TRIM35 negatively regulates TLR7- and TLR9-mediated type I interferon production by targeting IRF7. FEBS Lett. 589: 1322–1330.
    OpenUrlCrossRefPubMed
  52. ↵
    1. Olière, S.,
    2. E. Hernandez,
    3. A. Lézin,
    4. M. Arguello,
    5. R. Douville,
    6. T. L. Nguyen,
    7. S. Olindo,
    8. G. Panelatti,
    9. M. Kazanji,
    10. P. Wilkinson, et al
    . 2010. HTLV-1 evades type I interferon antiviral signaling by inducing the suppressor of cytokine signaling 1 (SOCS1). PLoS Pathog. 6: e1001177.
    OpenUrlCrossRefPubMed
View Abstract
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section