Enhanced Cytotoxic CD8 T Cell Priming Using Dendritic Cell–Expressing Human Papillomavirus-16 E6/E7-p16INK4 Fusion Protein with Sequenced Anti–Programmed Death-1

Tatiana M. Garcia-Bates, Eun Kim, Fernando Concha-Benavente, Sumita Trivedi, Robbie B. Mailliard, Andrea Gambotto and Robert L. Ferris
J Immunol March 15, 2016, 196 (6) 2870-2878; DOI: https://doi.org/10.4049/jimmunol.1502027

Abstract

The incidence of human papillomavirus (HPV)–related head and neck squamous cell carcinoma has increased in recent decades, though HPV prevention vaccines may reduce this rise in the future. HPV-related cancers express the viral oncoproteins E6 and E7. The latter inactivates the tumor suppressor protein retinoblastoma (Rb), which leads to the overexpression of p16INK4 protein, providing unique Ags for therapeutic HPV-specific cancer vaccination. We developed potential adenoviral vaccines that express a fusion protein of HPV-16 E6 and E7 (Ad.E6E7) alone or fused with p16 (Ad.E6E7p16) and also encoding an anti–programmed death (PD)-1 Ab. Human monocyte-derived dendritic cells (DC) transduced with Ad.E6E7 or Ad.E6E7p16 with or without Ad.αPD1 were used to activate autologous CD8 CTL in vitro. CTL responses were tested against naturally HPV-infected head and neck squamous cell carcinoma cells using IFN-γ ELISPOT and [51Cr]release assay. Surprisingly, stimulation and antitumor activity of CTL were increased after incubation with Ad.E6E7p16-transduced DC (DC.E6E7p16) compared with Ad.E6E7 (DC.E6E7), a result that may be due to an effect of p16 on cyclin-dependent kinase 4 levels and IL-12 secretion by DC. Moreover, the beneficial effect was most prominent when anti–PD-1 was introduced during the second round of stimulation (after initial priming). These data suggest that careful sequencing of Ad.E6E7.p16 with Ad.αPD1 could improve antitumor immunity against HPV-related tumors and that p16 may enhance the immunogenicity of DC, through cyclin-dependent pathways, Th1 cytokine secretion, and by adding a nonviral Ag highly overexpressed in HPV-induced cancers.

This article is featured in In This Issue, p.2429

Introduction

The incidence of human papillomavirus–positive (HPV+) head and neck squamous cell carcinoma (HNSCC), especially oropharyngeal carcinoma, has been rising over recent decades and now accounts for 70–80% of oropharyngeal carcinoma in the United States and Europe (1–4). Even though the overall survival of HPV+ cancers is better than the HPV-negative counterparts, the increasing incidence demands the discovery of more targeted therapies harnessing unique tumor-associated Ags (TAA).

HPV+ cancers have unique expression of virally encoded proteins that can be used as therapeutic targets. The main oncogenic proteins E6 and E7 are continuously expressed and necessary for the maintenance of malignant transformation (5). Our laboratory previously evaluated the endogenous level of circulating HPV type 16 E7-specific T cells in HPV+ cancer patients, showing a marked increase in HPV E7-specific T cells in the circulation compared with HPV-negative patients. These T cells were able to recognize the naturally HPV-infected SCC-90 HNSCC cells (6). Despite this finding of anti-HPV immunity, T cells are driven into a terminally differentiated phenotype, and tumor progression still occurs. Therefore, therapeutic vaccine strategies to induce immunogenicity and reverse exhaustion within the tumor microenvironment are critical for improved survival.

In HPV+ head and neck cancers, E6 and E7 oncoproteins have been used as therapeutic targets with encouraging results when combined with the current treatments of cisplatin and radiation (7–10). In normal tissues, p16 INK4 (p16) is known as a tumor suppressor that regulates cell-cycle progression by inhibiting the cyclin-dependent kinases cyclin-dependent kinase (CDK) 4 and CDK6 and consequently inhibiting retinoblastoma (Rb) phosphorylation and further proteasomal degradation (11). However, in HPV+ HNSCC, p16 protein is strongly overexpressed due to the loss of Rb caused by the E7 oncoprotein (12). This key feature also makes p16 a potential TAA for vaccine therapies.

In addition to using viral and TAA to induce cellular T cell responses, it is also imperative to target the inhibitory signals that may hinder their activity, such as the coinhibitory receptor on T cells, programmed death-1 (PD-1). Therefore, in this study, we developed adenoviral vectors expressing nononcogenic (mutated) E6 and E7 genes as a single hybrid gene or fused with p16INK4 gene as a therapeutic viral vaccine. Moreover, we compared these vectors alone or in combination with an adenovirus expressing the anti–PD-1 mAb to further enhance cellular anti-HPV immune responses against HNSCC, and we tested the optimal sequence of anti–PD-1 combination with T cell expansion. We investigated the surprising observation that p16 may have a salutary effect on dendritic cell (DC) stimulation through Th1 cytokine secretion and its effect on CDK4 levels, in addition to enhancing overall CD8 T cell responses against HPV-infected tumor cells.

Materials and Methods

Cell lines

HPV+ HNSCC SCC-90 and HPV-negative HNSCC PCI-13 were derived from patients treated at University of Pittsburgh Cancer Institute and characterized previously (6, 13). Cells were grown in IMDM (Sigma-Aldrich) in the presence of 10% FBS (Cellgro), 2% l-glutamine, and 1% penicillin/streptomycin (Invitrogen) and incubated at 37°C in 5% CO2.

Design of codon-optimized adenoviruses expressing HPV 16 E6 and E7 alone or fused with p16INK4

The HPV oncoproteins E6 and E7 are known to initiate malignant transformation by inactivating the tumor suppressors p53 and Rb, respectively (5, 14). In order to use these oncoproteins as immune therapeutic targets without causing transformation of the DC, we introduced genetic alterations in the E6 and E7 genes. The two mutations in E6 (L50G and G130V) disable its ability to degrade p53 (15, 16). The mutation on E7 (H2P) and the deletion of aa 21 to 24 (Δ21–24) prevent its binding and inactivation of pRb (17). The gene of HPV 16 E6E7 fusion protein (E6, GenBank AF486315.1; E7, GenBank AF486326.1) mutated L57G and G137V on E6 and H2P, and Δ21–24 on E7 was codon-optimized for optimal expression in mammalian cells using the UpGene codon optimization algorithm (18). Three genes with no significant similarity between any two genes having a SalI site in the 5′ end and BamHI-TGA–NotI in the 3′ end were synthesized (GenScript). Ad.E6E7-1, Ad.E6E7-2, and Ad.E6E7-3 were generated by subcloning the codon-optimized genes into the shuttle vector, pAdlox (GenBank U62024), at SalI/NotI sites. The coding sequence of p16 (GenBank NP000068.1) having SalI and BglII sites in the 5′ end and BamHI-TGA–NotI in the 3′ end was also codon optimized, synthesized, and generated as Ad.p16. To fuse the E6E7 gene with the p16 gene, p16 gene–digested BglII and NotI were cloned into Ad.E6E7-2 digested with BamHI and NotI and generated as Ad.E6E7p16 (Supplemental Fig. 1A). Replication-defective human adenovirus serotype 5, designated as Ad.E6E7-1, Ad.E6E7-2 Ad.E6E7-3, and Ad.E6E7p16, were generated by loxP homologous recombination on HEK-293 cells and purified by CsCl banding, followed by dialysis in 3% sucrose solution. As controls, the empty adenoviral vector was used (Αd.Ψ5) or the Ad.p16 was used. Infectious titers were determined using quantitative real-time PCR as previously described and ∼100-fold less than particle titers (19). Viruses were aliquoted and stored at −80°C until use.

Characterization of Ad.E6E7 and Ad.E6E7p16 expression on human cells

To evaluate the expression of these fused proteins in vitro, control HPV-negative HNSCC PCI-13 cells were left untreated (mock) or infected at different multiplicities of infection (MOIs) (10 and 50) with the three E6E7-containing vectors (Ad.E6E7-1, Ad.E6E7-2, and Ad.E6E7-3), Ad.E6E7p16, or Ad.p16 for 48 h. In order to select the optimal (highest) Ag-expressing vector, cell lysates were collected, and Western blot analysis was performed to detect E7 (Supplemental Fig. 1B, left panel) and p16 protein (Supplemental Fig. 1B, right panel). PCI-13 cells transduced with the three Ad.E6E7 vectors and the Ad.E6E7p16 contained abundant E7 protein at the appropriate molecular mass (31 kDa for E6E7 alone or 44 kDa for the fused E6E7p16). The levels of p16 were also detected in the cells that were transduced with Ad.p16 alone or Ad.E6E7p16 (Supplemental Fig. 1B). All vectors showed high levels of expression in these cells especially at an MOI of 50. Transgene expression was also tested in mature DC (mDC). Previous reports that use adenoviral vectors to deliver transgenes to DC have used MOIs that vary from 100 to 1000 (20, 21). We therefore tested three different MOIs (250, 500, and 1000) to assess transgene expression and toxicity. We observed that all three Ad.E6E7 constructs yielded high levels of transduction efficacy, and viability was not compromised at the lower MOIs of 250 and 500 (Supplemental Fig. 1C–E), with the 1000 MOI having the highest amount of protein of all three with slight increase in cell toxicity (Supplemental Fig. 1C–E). However, the Ad.E6E7 construct #2 (Ad.E6E7-2) had the highest expression. Therefore, for future experiments, we selected that construct. We were also able to detect high levels of expression of the fusion protein of E6E7 and p16, which yielded a protein at a molecular mass of 44 kDa (Supplemental Fig. 1C, right panel). For all of the experiments that follow, an MOI of 500 was chosen for its high level of Ag expression and lower toxicity to infected cells.

Stable cell line expressing human PD-1

The coding sequence for human PD-1 (hPD-1; GenBank NP005009.2) and near-infrared fluorescent protein (iRFP; GenBank AEL88490.1) (19) was codon-optimized for optimal expression in mammalian cells using the UpGene codon optimization algorithm (18) and synthesized (GenScript). EagI and BstBI sites for hPD-1 and SalI and BamHI sites for iRFP were generated at the 5′ and 3′ ends to clone each gene into the NotI and BstBI site under the EF-1 promoter and SalI and BamHI sites under the CMV promoter of pBUDCE4.1 mammalian expression vector (Invitrogen), respectively. A Kozak sequence was also generated at the 5′ end. The resulting plasmid containing both hPD-1 and iRFP gene was named pBudCE4.1/iRFP-hPD-1.

Plasmid pBudCE4.1/iRFP–hPD-1 was used to transfect HEK-293 cells using the Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's recommendations. After 24 h, cells were passaged at 1:20 dilution into fresh growth medium (DMEM containing 10% FBS) with Zeocin antibiotic (Invivogen) for selective pressure. Medium containing 100 μg/ml Zeocin was changed after every 3–4 d for 4 wk. Resistant colonies were pooled, and clonal lines were obtained by cell sorting those that produced iRFP using Cy5.5 filter set (665/45 nm exciter and 725/50 nm emitter) in FACSAria (BD Biosciences). After the selection, the stable cell line was termed 293/PD-1 and had expression of both hPD-1 and iRFP. Cells were maintained at 50 μg/ml Zeocin in DMEM containing 10% FBS. Frozen stocks were made.

Design and characterization of Ad.αPD1 and its secretion by human DC

To enhance the generation of tumor Ag-specific cytotoxic CD8 T cells, we also constructed an adenovirus expressing an anti–PD-1 mAb to target this coinhibitory checkpoint receptor on T cells. For the recombinant adenovirus expressing human anti–PD-1 Ab, H-chain gene (HC) was codon optimized, synthesized, and cloned into SalI and NotI site of pAdlox and generated as pAd.HC. The L-chain gene (LC) having EagI and KpnI site in 5′ end and SwaI and BstBI was codon optimized, synthesized, and cloned into NotI and BstBI site of pBudCE4.1 (Invitrogen) and generated as pBud.LC. The gene cassette of EF-1 promoter–LC-BGH polyadenylation sequence was prepared by digested with NheI and DrdI following the klenow treatment and cloned into the PvuII site of pAd/HC generated as Ad.αhPD1 (Supplemental Fig. 2A). To exchange the signal peptide of human IgG4 with that of mouse IgG, HC and LC were amplified with mspHC-S (5′-GATGTCGACGCCACCATGGCTGTCCTTGGCCTCCTGTTCTGCCTCGT GACGTTTCCCTCATGCGTGCTGTCGCAGGTGCAGCTCGTGGAGAGCGGG-3′) and Ad-R (5′-GTAACCATTATAAGCTGC-3′) primers and mspLC-S (5′-GCCGGTACCGCCAC CATGGTGTCTACCCCTCAGTTCCTGGTGTTCCTGCTCTTCTGGATTCCGGCTTCCAGGGGCGACATCCTGCTGACTCAGTCTCCGGCCACCCTC-3′) and BGH-R (5′- TAGAAGGCACAGTCGAGG-3′) primers, respectively. The mspHC PCR product digested with SalI and NotI and the mspLC PCR product digested with KpnI and SwaI replaced the HC or LC gene in Ad.αhPD1 serially and the vector termed Ad.msp-αhPD1 (Supplemental Fig. 2A). All constructions were confirmed by sequencing. Subsequently, replication-defective human adenovirus serotype 5, designated as Ad.αhPD1 and Ad.msp-αhPD1, were generated by loxP homologous recombination on HEK-293 cells and purified and stored as described previously.

Evaluation of binding of anti–hPD-1 to surface PD-1 on 293/PD-1

Before making the adenoviral construct, the plasmids were evaluated for the proper folding of the Ab and secretion from the cell. First, 293 cells were transfected with either a control empty vector or the two constructs (αhPD-1 and msp-αhPD-1) for 72 h. We then added the relevant supernatants to 293 cells that express PD-1 on the surface (293/PD-1). After a 1-h incubation, the binding of the anti–PD-1 Ab was tested by the addition of two secondary Abs, one against human IgG4 (Biotin–anti-IgG4–avidin PE) and one against whole human IgG conjugated to FITC (anti-hIgG FITC). We were able to detect between 70 and 72% IgG-positive cells when the anti–hPD-1 without the mouse signal peptide was used. When we used a vector encoding a mouse signal peptide (msp.αPD-1), a greater percentage of IgG4- (79%) and IgG-positive (80%) cells was detected than when anti–hPD-1 without mouse signal peptide was used (Supplemental Fig. 2B). After the respective adenoviruses were packaged and titered, we then tested the adenovirus in both immature DC (iDC) and mDC. iDC and mDC were transduced at an MOI of 500 for 72 h, and supernatants were collected. These supernatants were then added to 293/PD-1 cells, and we observed that both the Ad.αhPD1 and the Ad.msp.αPD1 were secreted from adenovirus-transduced iDC (85% from DC.αPD1 and 86% from DC.mspαPD1, respectively). However, when the same vectors were use in mDCs, the Ad.msp.αPD1-transduced mDC (DC.msp.αPD1) showed a greater proportion of IgG-positive cells (83%) than the Ad.αhPD1-transduced mDC alone (DC.αPD1, 53%) (Supplemental Fig. 2C). Therefore, we chose the Ad.msp.αPD1 for the in vitro stimulation (IVS) of CD8 T cells, and for brevity, we will use the connotation DC.αPD1 for the rest of the manuscript. mDC were also evaluated for the expression of maturation markers (CD80 and CD83) after 72 h postinfection. We did not observe any significant changes on the presence of CD80 or CD83 in the presence of anti–PD-1 (DC.αPD1) compared with mock-infected DC (DC.Mock) or Ad.Ψ5-infected DC (DC.Ψ5) (Supplemental Fig. 3A). We also tested these adenovirus-transduced DC for their ability to produce IL-12, IL-10, and TNF-α in the presence of CD40L-transfected J558 cells (provided by Dr. P. Lane, Birmingham, U.K.) (22). We did not observe a significant change in the amount of these cytokines in the presence of anti–PD-1 (Supplemental Fig. 3B). These results suggest that anti–PD-1 does not have an effect on the ability of DC to produce these cytokines upon stimulation. Human IL-10 and TNF-α ELISA Kits were purchased from Thermo Scientific.

Generation of human monocyte-derived DC

PBMCs were isolated from HLA-A2+ healthy donors using Ficoll–Paque PLUS gradient centrifugation (GE Healthcare Life Sciences, Piscataway, NJ). Monocytes were then isolated using the EasySep Human CD14 Positive selection kit (Stemcell Technologies, Vancouver, BC, Canada) and cultured for 5 d in the presence of 1000 IU/ml GM-CSF (R&D Systems, Minneapolis, MN) and 1000 IU/ml IL-4 (R&D Systems) to differentiate them into iDC. These iDC were then collected, and the purity was assessed by flow cytometry, giving >90% purity according to the expression of CD11c and HLA-DR and the loss of CD14 expression (data not shown). On day 5, an anti-DC1–polarizing mixture was added containing IL-1β (25 ng/ml), TNF-α (50 ng/ml), IFN-α (3000 IU/ml) (R&D Systems), IFN-γ (1000 IU/ml) (Miltenyi Biotec), and polyinosinic-polycytidylic acid (20 μg/ml) (Sigma-Aldrich) for an additional 36 h to generate mDC as previously described (23). mDCs were then transduced with different adenovirus vector at indicated MOIs for 2 h at 37°C before using them for IVS of CD8 T cells.

IVS of HPV-specific CD8+ T cells using autologous adenovirus-infected DC

CD8+ T cells were negatively selected from PBMC using an EasySep human CD8+ T cell enrichment kit (Stemcell Technologies). Briefly, 5 × 104 adenovirus-transduced mDC were use as stimulators of 5 × 105 autologous CD8+ T cells (1:10 DC to T cell ratio) in the presence of CD40L-transfected J558 cells (provided by Dr. P. Lane) (22). After 3 d of stimulation, 50 IU/ml IL-2 and 10 ng/ml IL-7 (R&D Systems) were added to the cultures. On day 12 of stimulation, T cells were counted and added to newly adenovirus-infected DCs at a 1:10 ratio for an additional 12 d. IL-2 and IL-7 were kept in the cultures and replaced every 3 to 4 d. When isolating naive versus memory CD8+ T cells, an EasySep Human Naive CD8+ T cell enrichment kit or an EasySep Human Memory CD8+ T cell enrichment kit (Stemcell Technologies) were used.

[51Cr]Release assay

Cytotoxicity using CD8+ T cells was determined using a [51Cr]release assay. Briefly, target HNSCC SCC-90 cells were incubated in 100 μl media with 25 μCi Na2 [51Cr]O4 (PerkinElmer, Boston, MA) for 60 min at 37°C and resuspended in RPMI 1640 medium supplemented with 25 mmol HEPES. Labeled SCC-90 cells were thoroughly washed and plated alone or in the presence of effector CD8+ T cells expanded under the different conditions at a 20:1 E:T ratio in 96-well plates. Plates were incubated for 4 h at 37°C in a 5% CO2 atmosphere. Controls for spontaneous (cells only) and maximal lysis (cells treated with 1% Triton X-100) were also included. Each reaction was done in triplicate, and the supernatants were collected and analyzed with a PerkinElmer 96-well plate γ counter. Results were normalized with the formula lysis = (experimental lysis − spontaneous lysis)/(experimental lysis − maximal lysis) × 100, and results are shown as fold change of specific lysis over Ad.Ψ5.

Western blots

Whole-cell extracts were collected using RIPA buffer (Abcam) with the addition of cOmplete mini protease inhibitors (Sigma-Aldrich), and total protein was quantified using Bradford Assay Kit (Pierce). Twenty to 30 μg protein was electrophoresed through a 4–12% SDS-PAGE gel (Lonza) and transferred to a polyvinylidene difluoride membrane (Millipore). The membranes were then analyzed for immunoreactivity with the indicated Abs.

Abs and reagents

Mouse monoclonal anti-HPV E7 (clone NM2) and anti-p16 (clone 50.1) were purchased from Santa Cruz Biotechnology. Rabbit mAb anti-CDK4 (D9G3E) and rabbit anti-Cyclin D1 were purchased from Cell Signaling Technology. The CDK4/6 inhibitor IV (CAS 359886-84-3) was from Santa Cruz Biotechnology.

Ab staining and flow cytometry

Cells were staining with Ab against cell-surface Ag CD3 (clone UCHT1; BD Biosciences), CD8 (clone RPA-T8; BioLegend), PD-1 (clone J105, eBioscience), and CD69 (clone CH/4; Life Technologies). For pentamer staining, a Pro5 MHC class I pentamer was used (A*02:01 YMLDLQPETT, HPV 16 E7 11–20; Proimmune). An amine-reactive viability dye was used to distinguish between live and dead cells (Zombie Aqua Fixable Viability Dye; BioLegend). All samples were acquired on an LSR Fortessa (BD Biosciences) flow cytometer, and data were analyzed using FlowJo software (Tree Star).

IL-12 ELISA

Mature monocyte-derived DC were generated as described earlier in this manuscript. mDC were either mock infected or infected with Ad.Ψ5, Ad.E6E7, Ad.E6E7p16, or Ad.p16 at an MOI of 500. An additional condition was included with simultaneous infection with Ad.E6E7 and 1 μmol CDK4 inhibitor. After 24-h treatment/infection, mDC were harvested and counted. Twenty thousand infected mDC were then added to 96-well plates, and 50,000 CD40L-expressing J558 cells were added to stimulate IL-12 secretion. After 48 h, supernatants were collected, and IL-12 was measured using an IL-12 ELISA kit (Pierce) following the manufacturer’s protocol.

IFN-γ ELISPOT assay

The IFN-γ ELISPOT was performed following the Mabtech Human IFN-γ ELISpotBasic protocol (Mabtech, Cincinnati, OH) using 96-well polyvinylidene difluoride ELISPOT plates from Millipore. Plates were coated with 10 μg/ml anti-human IFN-γ mAb 1-D1K overnight at 4°C. The next day, the coating Ab was washed, and plates were blocked with IMDM containing 10% inactivated human AB serum for 2 h. HNSCC SCC-90 cells were used as targets and added to the plates at a cell concentration of 2000 cells per well. A total of 20,000 in vitro-expanded CD8+ T cells was then added to the wells, giving a final target to T cell ratio of 1:10. Plates were then incubated for 18–20 h at 37°C, after which they were washed with 1× PBS containing 0.05% Tween-20 (PBS–0.05% Tween-20). Plates were then incubated with the detection anti-human IFN-γ biotinylated Ab 7-B6-1 biotin diluted in 1× PBS with 0.5% BSA (1 μg/ml; Mabtech) for 2 h at 37°C. After incubation, plates were washed with PBS–0.05% Tween-20, and then a 1:1000 dilution of a streptavidin-conjugated HRP (Mabtech) was added and incubated for 1 h at 37°C. Finally, 100 μl tetramethylbenzidine substrate was used to develop the spots, and numeration of spots was performed using a CTL ImmunoSpot reader and counting software (Cellular Technologies). IFN-γ background secretion by T cells alone was subtracted from the final results and was shown as fold change over Ad.Ψ5 control.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 6.0 (GraphPad). A two-tailed unpaired or paired t test was used, and statistical significance was defined as p < 0.05.

Results

Adenovirus-encoded anti–PD-1 effectively blocks PD-1 on CD8+ T cells to the same extent as soluble anti–PD-1 Ab

To confirm that the Ad-encoded anti–PD-1 (mAb) secreted by the DC binds to the PD-1 receptor on activated CD8+ T cells, we performed flow cytometric analysis on the CD8 T cells during a single 12-d IVS. Briefly, mDC derived from an HLA-A2+ donor were infected with Ad.Ψ5 (DC.Ψ5), Ad.E6E7 (DC.E6E7), or Ad.E6E7p16 (DC.E6E7p16) alone or coinfected with Ad.E6E7 and Ad.αPD1 (DC.E6E7.αPD1) or Ad.E6E7p16 and Ad.αPD1 (DC.E6E7p16.αPD1) at an MOI of 500. These adenovirus-transduced mDCs were then added to autologous purified CD8+ T cells at a ratio of 1:10 (DC/T). To compare the blocking capacity of Ad-encoded anti–PD-1 with that of soluble anti–PD-1 Ab (nivolumab; Bristol-Myers Squibb), we added either human IgG4 as a control (DC.E6E7.hIgG4 and DC.E6E7p16.hIgG4) or anti–PD-1 nivolumab (DC.E6E7.Nivo and DC.E6E7p16.Nivo) to the in vitro cultures. When CD8+ T cells were stimulated with either DC.Ψ5, DC.E6E7 or DC.E6E7p16 alone or in the presence of hIgG4 control Ab, the levels of PD-1 increased overtime, with a peak expression at day 7 of IVS. However, when CD8+ T cells were stimulated using Ad-αPD1–transduced DC (DC.E6E7.αPD1 or DC.E6E7p16.αPD1), the surface staining with anti–PD-1 was blocked almost completely, showing in most cases ∼5% or less PD-1+ CD8+ T cells (Fig. 1). Moreover, when we compared the anti–PD-1 secreted by Ad-αPD1–transduced DCs with the soluble anti–PD-1 Ab (DC.E6E7.Nivo or DC.E6E7p16.Nivo), we observed that they function with similar potency at blocking PD-1 on CD8+ T cells (Fig. 1).

FIGURE 1.
FIGURE 1.

Adenovirus-encoded anti–PD-1 effectively blocks PD-1 on CD8+ T cells to the same extent as soluble anti–PD-1 Ab. (A) Representative flow cytometry contour plots showing the gating strategy for PD-1–positive staining on day 7 in vitro–stimulated CD8+ T cells. Boxes are defined based on fluorescence with relevant isotype control Ab. (B) Percentage of PD-1–positive CD8+ T cells during one round (12 d) of IVS. DC derived from HLA-A2+ donors were infected with Ad.Ψ5 (DC.Ψ5), Ad.E6E7 (DC.E6E7), or Ad.E6E7p16 (DC.E6E7p16) alone or coinfected with Ad.E6E7 and Ad.αPD1 (DC.E6E7.αPD1) or Ad.E6E7p16 and Ad.αPD1 (DC.E6E7p16.αPD1) at an MOI of 500. After 36 h of infection, adenovirus-transduced DCs were used to stimulate CD8+ T cells at a ratio of 1:10 (DC/T). In some cases, control hIgG4 isotype (DC.E6E7.hIgG4 and DC.E6E7.hIgG4) or soluble anti–PD-1 mAb (DC.E6E7.Nivo and DC.E6E7p16.Nivo) was added for comparison. CD8+ T cells were evaluated over time for PD-1 expression by flow cytometry. Results are from three separate donors. *p < 0.05, **p < 0.01 when DC.E6E7 was compared with DC.E6E7.αPD1, ##p < 0.01 when DC.E6E7.hIgG4 was compared with DC.E6E7.Nivo.

Evaluation of CD8+ T cell specificity after IVS with autologous Ad-transduced mDCs

We next evaluated the specificity of the in vitro–generated CD8+ T cells against an immunodominant HLA-A2–binding epitope of E7 (E711–20). The stimulation of CD8+ T cells with DC.E6E7p16 yielded a higher percentage of E711–20 peptide-specific T cells (mean of 1.2%) than the T cells stimulated with control DC.Ψ5 (mean 0.2%) or DC.E6E7 (mean 0.5%). However, there was no induction of E711–20 peptide-specific T cells when there were stimulated with DC.E6E7p16 coinfected with Ad.αPD1 (DC.E6E7p16.αPD1) (Fig. 2).

FIGURE 2.
FIGURE 2.

Evaluation of CD8+ T cell specificity after IVS with autologous Ad-transduced mDCs. (A) Representative plots illustrating the frequency of HLA-A2–HPV-E711–20 pentamer-positive CD8 T cells after one round (12 d) of stimulation. CD8 T cells were stimulated with DCs infected with Ad.Ψ5 (DC.Ψ5), Ad.E6E7 (DC.E6E7), or Ad.E6E7p16 (DC.E6E7p16) alone or coinfected with Ad.E6E7 and Ad.αPD1 (DC.E6E7.αPD1) or Ad.E6E7p16 and Ad.αPD1 (DC.E6E7p16.αPD1). Specific recognition was observed only when CD8 T cells were stimulated with DC.E6E7p16. (B) Percentage of HPV-E711–20–specific CD8 T cells after 12 d of IVS. Symbols represent individual subjects, and horizontal lines represent means. *p < 0.05.

CD8+ T cell responsiveness is inhibited when anti–PD-1 is added from the priming phase of IVS

To determine whether addition of Ad.αPD1 at the priming phase conferred a deleterious effect on the induction of specific responses, we measured the activation and turnover of T cells during the priming (first) phase of stimulation. After 12 d, bulk CD8+ T cells stimulated with either DC.Ψ5 or DC.E6E7 or DC.E6E7p16 had 14, 10, and 12% CD69+CD8+ T cells, respectively. However, these percentages increased to 32 and 38% when they were stimulated with DC.E6E7.αPD1 or DC.E6E7p16.αPD1, respectively. These results suggest a heightened activation status when Ad.αPD1 is present. Moreover, when we looked at T cells stimulated in the presence of Ad-αPD1 (DC.E6E7.αPD1 or DC.E6E7p16.αPD1), the percent of dead cells (zombie dye positive) increased to 53 and 60% (Fig. 3A, 3B) compared with 23–25% dead cells in the absence of Ad-αPD1. As expected, the addition of anti–PD-1 during the priming phase increased activation of T cells, as measured by CD69 expression levels, but with a concomitant decrease in survival. Because increased activation and turnover might compromise the ability to respond to a second stimulation, we evaluated the IFN-γ secretion of these stimulated T cells when added to newly adenovirus-infected DC in an ELISPOT assay. CD8+ T cells generated with DC.E6E7 or DC.E6E7p16 that were restimulated with DC.E6E7 or DC.E6E7p16 had a 15-fold increase in IFN-γ–secreting T cells (154/104 IFN-γ–secreting cells) compared with T cells alone (10/104 IFN-γ–secreting cells). However, when CD8+ T cells were generated using DC.E6E7.αPD1 or DC.E6E7p16.αPD1 and were then restimulated with DC.E6E7.αPD1 or DC.E6E7p16.αPD1, respectively, there were fewer IFN-γ–secreting T cells than without anti–PD-1 (Fig. 3C). These results suggest that addition of Ad.αPD1 at the initial priming phase of the IVS impaired the ability of the T cells to expand or to respond to a second challenge with Ag-loaded DC.

FIGURE 3.
FIGURE 3.

Increased activation and turnover of CD8+ T cells when expanded in the presence of Ad-αPD1 makes them less responsive upon restimulation with new adenovirus-infected DCs. (A) CD8+ T cells were stimulated for 12 d with DC.Ψ5, DC.E6E7, or DC.E6E7p16 in the presence or absence of Ad.αPD1. The percentage of dead/dying CD8+ T cells was determined by using an amine-reactive dye (Live/Dead), and the activation status was evaluated by the expression of activation marker CD69. (B) Graphical representation of the percent CD69+ T cells (top panel) and the proportion of live and dead cells on each condition (bottom panel). (C) Graphical representation of ELISPOT assay depicting IFN-γ–secreting CD8+ T cells upon restimulation with new adenovirus-infected DC. The number of IFN-γ–secreting cells per 10,000 cells is shown. Results shown are of one representative donor. SSC, side scatter.

Naive CD8 T cells are known to express both markers (CD45RA+/CCR7+ double positive), whereas effector memory CD8 T cells lack both of these markers (24). Because we used bulk CD8+ T cells for our experiments (naive plus memory CD8 T cells), we evaluated the phenotype of the CD8+ T cells during the priming (initial) stimulation phase by evaluating CD45RA and CCR7 expression. We observed that the percent of naive (CCR7+/CD45RA+) and effector memory (CD45RA−CCR7−) populations were about equally distributed amount CD8 T cells with ∼37.2% naive versus 35.8% effector memory after 48 h (Supplemental Fig. 4A, representative flow cytometry of CD8+ T cells stimulated with DC.E6E7p16). However, after 12 d postpriming, the population of naive T cells were skewed to an effector memory phenotype with a decrease in the percent of naive CD8+ T cells to 9.44% and an increase in the percent effector memory to 76.2% of CD8+ T cells (Supplemental Fig. 4A). This skewing was observed for all of the different adenoviral-infected DC (data not shown). We then asked whether isolation of naive versus memory CD8+ T cells before priming had a different effect on the two distinct populations. We negatively selected naive and memory CD8+ T cell population prior to priming with adenovirus-transduced DC. We monitored the expression of CD45RA alone (Supplemental Fig. 4B) or in combination with CCR7 (Supplemental Fig. 4C), and we observed that 48 h postinfection the naive CD8+ T cells still had high levels of CD45RA, whereas the memory CD8 T cells remained CD45RA negative. However, similarly to what we observed with bulk CD8 T cells, the naive CD8 T cells eventually lost the expression of CD45RA and CCR7, as they became effector memory CD8 T cells (Supplemental Fig. 4B, 4C). The generation of effector memory CD8+ T cells was observed regardless of whether DC.E6E7 or DC.E6E7.p16 were used (Supplemental Fig. 4C). Lastly, we evaluated the activation status (CD69 upregulation) of these naive and memory CD8 T cells after 48-h post–initial stimulation. As shown in Supplemental Fig. 4D, there was a decrease in the levels of CD69 activation marker on naive CD8 T cells in the presence of anti–PD-1, whereas the memory CD8 T cells had similar levels of CD69 with or without anti–PD-1.

DC cotransduced with Ad.E6E7p16 and Ad.αPD1 stimulate greater antitumor CD8+ T cell responses mainly when Ad.αPD1 is added at the restimulation phase of the IVS

In light of our findings regarding the detrimental effect of adding anti–PD-1 at the priming phase of stimulation, we repeated the IVS conditions described above, except that Ad.αPD1 was introduced only to DC used for secondary restimulation [DC.E6E7.αPD1(restim) and DC.E6E7p16.αPD1(restim)]. To test the antitumor capability of these T cells, we used SCC-90, a naturally HPV-infected HNSCC cell line that expresses high levels of E6 and E7 and the protein p16 (6, 25). CD8+ T cells were tested for IFN-γ secretion using ELISPOT and for the ability to kill tumor cells using a [51Cr]release assay (Fig. 4A, 4B). Increased IFN-γ responses were observed when Ad.αPD1 was added at the secondary restimulation phase together with either DC.E6E7 or DC.E6E7p16 [DC.E6E7.αPD1(restim) or DC.E6E7p16.αPD1(restim)], reaching statistical significance in the latter conditions (Fig. 4A). We also tested the ability of CTL to lyse HPV+ HNSCC SCC-90 cells, observing significantly increased specific lysis of SCC-90 when CD8+ T cells were stimulated with DC.E6E7p16, regardless of whether Ad.αPD1 was added at the priming phase [DC.E6E7p16.αPD1(prim)] or at the restimulation phase [DC.E6E7p16.aPD1 (restim)], with 10–15-fold higher specific lysis than with Ad.Ψ5 control, respectively (Fig. 4B). These results suggest that addition of anti–PD-1 may be more beneficial when it is added sequentially during T cell stimulation and may have translation into vaccination strategies.

FIGURE 4.
FIGURE 4.

DC cotransduced with Ad.E6E7p16 and Ad.αPD1 stimulate greater antitumor CD8+ T cell responses mainly when Ad.αPD1 is added at the restimulation phase of the IVS. (A) CD8 T cells were stimulated for 24 d (two rounds of stimulation) using autologous DC infected with Ad.Ψ5 (DC.Ψ5), Ad.E6E7 (DC.E6E7), or Ad.E6E7p16 (DC.E6E7p16) alone or coinfected with both Ad.E6E7 and Ad.αPD1 [DC.E6E7.αPD1(prim)] or both Ad.E6E7p16 and Ad.aPD1 [DC.E6E7p16.αPD1(prim)]. In some cases, Ad.αPD1 was only added at the restimulation phase on the newly adenovirus-infected DC [DC.E6E7.αPD1(restim) and DC.E6E7p16.αPD1(restim)]. Responder CD8 T cells were assessed using IFN-γ ELISPOT assays (A) and [51Cr]release killing assay (B) for their functional reactivity on day 24 of IVS. IFN-γ responses and specific lysis are shown as fold change over DC.Ψ5. *p < 0.05.

Ad.E6E7p16-transduced DC have decreased CDK4 protein levels and produced higher levels of IL-12 upon CD40 ligation compared with Ad.Ψ5 or Ad.E6E7-transduced DC

Because we observed better antitumor responses when Ad.E6E7p16 was used in comparison with Ad.E6E7 alone, we next evaluated the effects of the presence of p16 on DC function. We observed the levels of CDK4 were decreased by about half-fold in DC infected with Ad.E6E7p16 and Ad.p16 when compared with Ad.Ψ5 control and Ad.E6E7, whereas the levels of cyclin D1 remained unchanged (Fig. 5A, 5B). Moreover, when Ad.E6E7p16 and Ad.p16-transduced DC were activated by CD40L, the levels of IL-12 secretion increased by half-fold over uninfected DC or Ad.Ψ5 control (Fig. 5C). To further test whether the increased IL-12 secretion was due to CDK4 inhibition, we treated Ad.E6E7-transduced DC with a CDK4 inhibitor (DC.E6E7+CDK4inh) and evaluated their IL-12 secretion upon CD40L activation. We observed a significant increase in IL-12 production by these DC compared with DC.Ψ5 or DC.E6E7 alone (Fig. 5C). These results suggest a possible novel role for p16 in inhibiting cell-cycle proteins in DC and promoting their maturation and skewing toward a Th1 phenotype.

FIGURE 5.
FIGURE 5.

Ad.E6E7p16-transduced DC have decreased CDK4 protein levels and produced higher levels of IL-12 upon CD40 ligation compared with Ad.Ψ5 or Ad.E6E7-transduced DC. (A) Expression levels of CDK4 and cyclin D1 in mDCs infected with Ad.Ψ5, Ad.E6E7, Ad.E6E7p16, and Ad.p16 were assessed 72 h postinfection by Western blot. β-Actin was used as loading control. (B) Relative intensity of CDK4 expression in three different donors. Values are expressed as fold change versus Ad.Ψ5 control. (C) IL-12 secretion upon CD40L stimulation of mDC left uninfected or infected with Ad.Ψ5, Ad.E6E7, Ad.E6E7p16, Ad.p16, and Ad.E6E7 plus 1 μmol CDK4 inhibitor. Values are expressed as fold change over uninfected mDC. *p < 0.05.

Discussion

With the rising epidemic of HPV+ HNSCC and toxicity of nonspecific chemoradiation, the need for new therapeutic vaccines to treat patients is a priority. In recent decades, therapeutic vaccine approaches have being tested against HPV-related cancers, especially against cervical cancer, which is more associated with HPV (26, 27). A few studies have been conducted in HPV+ HNSCC using nononcogenic forms of E6 and E7 in conjunction with chemoradiotherapy, which demonstrated enhance clearance of HPV+ tumors in vivo (9). These preclinical and clinical studies have demonstrated the ability to use viral oncoproteins to induce antitumor responses. However, these responses could be further enhanced by the addition of other tumor-associated Ags highly expressed in HPV cancers and harnessing immunological target molecules within the vaccine to broaden the repertoire of HPV cellular specificities. Another way to strengthen the antitumor immunity is to target the coinhibitory molecule PD-1 on dysfunctional, exhausted effector T cells. Blocking the interaction between PD-1 and its ligand PD-L1 can enhance both virus- and tumor-specific T cell responses in vitro and enhance antiviral and antitumor activity in preclinical and clinical trials (28–31).

In this study, we describe the development of several adenoviral vaccine vectors containing the nononcogenic HPV 16 E6 and E7 genes inactivated due to mutations and/or deletions that inhibit their ability to degrade p53 and Rb, respectively. Moreover, we fused these genes with the p16INK4 gene, which is known to be highly overexpressed in HPV+ HNSCC. We also combined these vectors with an adenoviral vector expressing the anti–PD-1 Ab. To evaluate whether these vaccines are immunogenic, we tested them in vitro using monocyte-derived DC from healthy donors as stimulators of autologous CD8+ T cells. We successfully demonstrated high expression of the fused E6E7 protein and/or E6E7p16 protein in DC, as well as secretion and binding of adenovirus-encoded anti–PD-1. Next, we corroborated that the secreted anti–PD-1 was able to bind to CD8+ T cells in the IVS, as observed by the blockade of PD-1 staining on CD8+ T cells by flow cytometry (Fig. 1), and this blockade was to the same extent as the soluble anti–PD-1. We then proceeded to use these adenoviral vectors in DC to stimulate autologous CD8+ T cells. We were able to induce HPV-specific T cells against the E7 11–20 peptide when T cells were stimulated with DC transduced with Ad.E6E7p16, but not with the Ad.Ψ5 or Ad.E6E7. However, the addition of Ad.αPD1 abrogated the induction of these HPV E7–specific T cells when combined with E6E7p16 (Fig. 2). These results could be explained, in part, by our previous findings (32), in which we showed that in PD-1+ T cells, phenotypic skewing is a major pathway of PD-1 suppression. We speculate that the effects of anti–PD-1 are that it enhances the phenotypic bias of the PD-1+ CD8 T cells to a more Th1 phenotype or improves the cytokine profile, but does not increase proliferation. Expansion of a T cell population requires active immunization, as we described in this study. In our system, perhaps it was because this was a single vaccination before we added anti–PD-1, but the anti–PD-1 did not have a proliferative effect specifically in the Ag-specific T cells. The reduced induction of Ag-specific CD8 T cells in the presence of anti–PD-1 prompted us to investigate the activation status (CD69 upregulation) of CD8 T cells during the initial stimulation (12 d postpriming). As expected, we observed heightened T cell activation and turnover when Ad.αPD1 was added during the initial priming phase; however, this also led to an increase in T cell turnover and hampered their responsiveness to further rounds of stimulation (Fig. 3). Concurrently, we evaluated the phenotype of CD8 T cells over time during the first 12 d of stimulation. We observed a shift on the phenotype of CD8 T cells going from naive to effector memory over time, when they were stimulated as bulk CD8 T cells (memory plus naive) or as separate populations (Supplemental Fig 4A–C). Interestingly, when we tested naive versus memory CD8 T cells, separated prior to stimulation, we observed a slight inhibition in the activation (CD69 upregulation) on naive CD8 T cells in the presence of Ad.αPD1, whereas memory CD8 T cells were stimulated to the same extent (by CD69 expression) in the presence or absence of anti–PD-1 (Supplemental Fig. 4D). These results suggest a different effect of anti–PD-1 on naive versus memory CD8 T cells, and it also suggests the need for more careful studies on the impact of anti–PD-1 on naive versus memory CD8 T responses in future research studies.

According to the results shown thus far, the addition of anti–PD-1 at the beginning of the IVS (initial priming phase) is having a deleterious effect on the induction of HPV-specific T cells. Therefore, we investigated whether delaying the exposure of CD8+ T cells to anti–PD-1 blockade until the boosting/restimulation phase of the IVS was a more efficacious approach to enhance HPV-specific T cell responses. Remarkably, CD8+ T cells generated with Ad.E6E7p16 had better antitumor activity when anti–PD-1 was added secondarily (i.e., at the restimulation phase via Ad.αPD1-transduced DC) (Fig. 4). These data suggest a novel strategy to deliver vaccines sequentially by priming with the Ag-expressing adenoviral vaccine and then boosting with a combination of vaccine plus anti–PD-1, particularly in the local tumor microenvironment in which PD-1 levels are highest, reflecting most potent T cell exhaustion (33), which could be relieved by local PD-1 blockade. Additionally, using an adenoviral vector to deliver anti–PD-1 instead of a soluble anti–PD-1 Ab has the advantage of high level and long-term expression without the possible side effects of systemic Ab therapy and autoimmunity (34, 35). These studies would increase the interest in combination immunotherapy using vaccine plus anti–PD-1 to expand the pool of HPV virus–specific T cells.

One important aspect of inducing effective antitumor immunity using DC-based therapies is the maturation and polarization of DC toward a more immunogenic, inflammatory Th1 phenotype that efficiently stimulate CTL responses (36). As mentioned previously, in normal tissues, p16 is a CDK inhibitor that prevents cell-cycle progression by inhibiting cyclin D–CDK4/6 complex formation (11), but it also plays an important role in polarizing macrophages to a Th1 inflammatory phenotype (37). In our study, we used the anti-DC1 mixture for maturation of DC before we transduced them with the adenoviral vectors. Because we observed better responses when p16 was in the adenoviral vector (Ad.E6E7p16), we investigated the effects of p16 on mDC. We observed decreased levels of the CDK4 in Ad.E6E7p16 and Ad.p16-transduced DC compared with Ad.Ψ5 and Ad.E6E7 (Fig. 5A, 5B). Moreover, we were able to induce higher Th1-polarizing cytokine IL-12 upon CD40 ligation in Ad.E6E7p16 and Ad.p16-transduced DC compared with Ad.Ψ5 and Ad.E6E7 (Fig. 5C). Additionally, IL-12 secretion was increased by one and a half–fold in Ad.E6E7-infected DC treated in with a CDK4 inhibitor compared with Ad.Ψ5-control infected DC (Fig. 5C). These results suggest that p16 might have an antiproliferative, prodifferentiation effect on mDC by inhibiting the cell-cycle kinase CDK4, and this might be skewing them toward a more immunogenic Th1 phenotype. It also suggests that the presence of p16 together with E6 and E7 could have a double purpose, not only presenting HPV-specific peptides, but also inducing better immunogenic DC for therapy.

Disclosures

The authors have no financial conflicts of interest.

Acknowledgments

We thank the members of Dr. Pawel Kalinski’s laboratory for providing the CD40L-expressing J558 cell line and advice on the project.

Footnotes

  • This work was supported by National Institutes of Health Grants R01 DE019727 and P50CA097190 and by the University of Pittsburgh Medical Center/University of Pittsburgh Cancer Institute Tumor Microenvironment Center. This project used the University of Pittsburgh Cancer Institute Flow Cytometry Facility that is supported in part by Award P30CA047904 from the National Institutes of Health.

  • The online version of this article contains supplemental material.

  • Abbreviations used in this article:

    CDK
    cyclin-dependent kinase
    DC
    dendritic cell
    HC
    H-chain gene
    HNSCC
    head and neck squamous cell carcinoma
    hPD-1
    human PD-1
    HPV
    human papillomavirus
    iDC
    immature DC
    iRFP
    near-infrared fluorescent protein
    IVS
    in vitro stimulation
    LC
    L-chain gene
    mDC
    mature DC
    MOI
    multiplicity of infection
    PD-1
    programmed death-1
    Rb
    retinoblastoma
    TAA
    tumor-associated Ag.

  • Received September 14, 2015.
  • Accepted January 4, 2016.

References

  1. ↵
    1. Chaturvedi A. K.,
    2. E. A. Engels,
    3. W. F. Anderson,
    4. M. L. Gillison
    . 2008. Incidence trends for human papillomavirus-related and -unrelated oral squamous cell carcinomas in the United States. J. Clin. Oncol. 26: 612–619.
    OpenUrlAbstract/FREE Full Text
    1. Hammarstedt L.,
    2. D. Lindquist,
    3. H. Dahlstrand,
    4. M. Romanitan,
    5. L. O. Dahlgren,
    6. J. Joneberg,
    7. N. Creson,
    8. J. Lindholm,
    9. W. Ye,
    10. T. Dalianis,
    11. E. Munck-Wikland
    . 2006. Human papillomavirus as a risk factor for the increase in incidence of tonsillar cancer. Int. J. Cancer 119: 2620–2623.
    OpenUrlCrossRefPubMed
    1. Chaturvedi A. K.,
    2. E. A. Engels,
    3. R. M. Pfeiffer,
    4. B. Y. Hernandez,
    5. W. Xiao,
    6. E. Kim,
    7. B. Jiang,
    8. M. T. Goodman,
    9. M. Sibug-Saber,
    10. W. Cozen,
    11. et al
    . 2011. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J. Clin. Oncol. 29: 4294–4301.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    1. Sturgis E. M.,
    2. K. K. Ang
    . 2011. The epidemic of HPV-associated oropharyngeal cancer is here: is it time to change our treatment paradigms? J. Natl. Compr. Canc. Netw. 9: 665–673.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Münger K.,
    2. A. Baldwin,
    3. K. M. Edwards,
    4. H. Hayakawa,
    5. C. L. Nguyen,
    6. M. Owens,
    7. M. Grace,
    8. K. Huh
    . 2004. Mechanisms of human papillomavirus-induced oncogenesis. J. Virol. 78: 11451–11460.
    OpenUrlFREE Full Text
  6. ↵
    1. Albers A.,
    2. K. Abe,
    3. J. Hunt,
    4. J. Wang,
    5. A. Lopez-Albaitero,
    6. C. Schaefer,
    7. W. Gooding,
    8. T. L. Whiteside,
    9. S. Ferrone,
    10. A. DeLeo,
    11. R. L. Ferris
    . 2005. Antitumor activity of human papillomavirus type 16 E7-specific T cells against virally infected squamous cell carcinoma of the head and neck. Cancer Res. 65: 11146–11155.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    1. Monie A.,
    2. S. W. Tsen,
    3. C. F. Hung,
    4. T. C. Wu
    . 2009. Therapeutic HPV DNA vaccines. Expert Rev. Vaccines 8: 1221–1235.
    OpenUrlCrossRefPubMed
    1. Bosch F. X.,
    2. T. R. Broker,
    3. D. Forman,
    4. A. B. Moscicki,
    5. M. L. Gillison,
    6. J. Doorbar,
    7. P. L. Stern,
    8. M. Stanley,
    9. M. Arbyn,
    10. M. Poljak,
    11. et al
    . 2013. Comprehensive control of human papillomavirus infections and related diseases. Vaccine 31(Suppl. 7): H1–H31.
    OpenUrlCrossRef
  9. ↵
    1. Wieking B. G.,
    2. D. W. Vermeer,
    3. W. C. Spanos,
    4. K. M. Lee,
    5. P. Vermeer,
    6. W. T. Lee,
    7. Y. Xu,
    8. E. S. Gabitzsch,
    9. S. Balcaitis,
    10. J. P. Balint Jr..,
    11. et al
    . 2012. A non-oncogenic HPV 16 E6/E7 vaccine enhances treatment of HPV expressing tumors. Cancer Gene Ther. 19: 667–674.
    OpenUrlCrossRefPubMed
  10. ↵
    1. Lee D. W.,
    2. M. E. Anderson,
    3. S. Wu,
    4. J. H. Lee
    . 2008. Development of an adenoviral vaccine against E6 and E7 oncoproteins to prevent growth of human papillomavirus-positive cancer. Arch. Otolaryngol. Head Neck Surg. 134: 1316–1323.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Sharpless N. E.
    2005. INK4a/ARF: a multifunctional tumor suppressor locus. Mutat. Res. 576: 22–38.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Lewis J. S., Jr..,
    2. R. D. Chernock,
    3. X. J. Ma,
    4. J. J. Flanagan,
    5. Y. Luo,
    6. G. Gao,
    7. X. Wang,
    8. S. K. El-Mofty
    . 2012. Partial p16 staining in oropharyngeal squamous cell carcinoma: extent and pattern correlate with human papillomavirus RNA status. Mod. Pathol. 25: 1212–1220.
    OpenUrlCrossRefPubMed
  13. ↵
    1. Lin C. J.,
    2. J. R. Grandis,
    3. T. E. Carey,
    4. S. M. Gollin,
    5. T. L. Whiteside,
    6. W. M. Koch,
    7. R. L. Ferris,
    8. S. Y. Lai
    . 2007. Head and neck squamous cell carcinoma cell lines: established models and rationale for selection. Head Neck 29: 163–188.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Doorbar J.
    2006. Molecular biology of human papillomavirus infection and cervical cancer. Clin. Sci. 110: 525–541.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Sekaric P.,
    2. J. J. Cherry,
    3. E. J. Androphy
    . 2008. Binding of human papillomavirus type 16 E6 to E6AP is not required for activation of hTERT. J. Virol. 82: 71–76.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Patel D.,
    2. S. M. Huang,
    3. L. A. Baglia,
    4. D. J. McCance
    . 1999. The E6 protein of human papillomavirus type 16 binds to and inhibits co-activation by CBP and p300. EMBO J. 18: 5061–5072.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Demers G. W.,
    2. E. Espling,
    3. J. B. Harry,
    4. B. G. Etscheid,
    5. D. A. Galloway
    . 1996. Abrogation of growth arrest signals by human papillomavirus type 16 E7 is mediated by sequences required for transformation. J. Virol. 70: 6862–6869.
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Gao W.,
    2. A. Rzewski,
    3. H. Sun,
    4. P. D. Robbins,
    5. A. Gambotto
    . 2004. UpGene: Application of a web-based DNA codon optimization algorithm. Biotechnol. Prog. 20: 443–448.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Bilbao R.,
    2. D. P. Reay,
    3. T. Hughes,
    4. V. Biermann,
    5. C. Volpers,
    6. L. Goldberg,
    7. J. Bergelson,
    8. S. Kochanek,
    9. P. R. Clemens
    . 2003. Fetal muscle gene transfer is not enhanced by an RGD capsid modification to high-capacity adenoviral vectors. Gene Ther. 10: 1821–1829.
    OpenUrlCrossRefPubMed
  20. ↵
    1. Naveh H. P.,
    2. L. Vujanovic,
    3. L. H. Butterfield
    . 2013. Cellular immunity induced by a recombinant adenovirus- human dendritic cell vaccine for melanoma. J. Immunother. Cancer 1: 19.
    OpenUrlCrossRefPubMed
  21. ↵
    1. Vujanovic L.,
    2. E. Ranieri,
    3. A. Gambotto,
    4. W. C. Olson,
    5. J. M. Kirkwood,
    6. W. J. Storkus
    . 2006. IL-12p70 and IL-18 gene-modified dendritic cells loaded with tumor antigen-derived peptides or recombinant protein effectively stimulate specific Type-1 CD4+ T-cell responses from normal donors and melanoma patients in vitro. Cancer Gene Ther. 13: 798–805.
    OpenUrlCrossRefPubMed
  22. ↵
    1. Kaliński P.,
    2. J. H. Schuitemaker,
    3. C. M. Hilkens,
    4. E. A. Wierenga,
    5. M. L. Kapsenberg
    . 1999. Final maturation of dendritic cells is associated with impaired responsiveness to IFN-gamma and to bacterial IL-12 inducers: decreased ability of mature dendritic cells to produce IL-12 during the interaction with Th cells. J. Immunol. 162: 3231–3236.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Kalinski P.,
    2. E. Wieckowski,
    3. R. Muthuswamy,
    4. E. de Jong
    . 2010. Generation of stable Th1/CTL-, Th2-, and Th17-inducing human dendritic cells. Methods Mol. Biol. 595: 117–133.
    OpenUrlCrossRefPubMed
  24. ↵
    1. Appay V.,
    2. R. A. van Lier,
    3. F. Sallusto,
    4. M. Roederer
    . 2008. Phenotype and function of human T lymphocyte subsets: consensus and issues. Cytometry A 73: 975–983.
    OpenUrlCrossRefPubMed
  25. ↵
    1. Klussmann J. P.,
    2. E. Gültekin,
    3. S. J. Weissenborn,
    4. U. Wieland,
    5. V. Dries,
    6. H. P. Dienes,
    7. H. E. Eckel,
    8. H. J. Pfister,
    9. P. G. Fuchs
    . 2003. Expression of p16 protein identifies a distinct entity of tonsillar carcinomas associated with human papillomavirus. Am. J. Pathol. 162: 747–753.
    OpenUrlCrossRefPubMed
  26. ↵
    1. Einstein M. H.,
    2. A. S. Kadish,
    3. R. D. Burk,
    4. M. Y. Kim,
    5. S. Wadler,
    6. H. Streicher,
    7. G. L. Goldberg,
    8. C. D. Runowicz
    . 2007. Heat shock fusion protein-based immunotherapy for treatment of cervical intraepithelial neoplasia III. Gynecol. Oncol. 106: 453–460.
    OpenUrlCrossRefPubMed
  27. ↵
    1. Roman L. D.,
    2. S. Wilczynski,
    3. L. I. Muderspach,
    4. A. F. Burnett,
    5. A. O’Meara,
    6. J. A. Brinkman,
    7. W. M. Kast,
    8. G. Facio,
    9. J. C. Felix,
    10. M. Aldana,
    11. J. S. Weber
    . 2007. A phase II study of Hsp-7 (SGN-00101) in women with high-grade cervical intraepithelial neoplasia. Gynecol. Oncol. 106: 558–566.
    OpenUrlCrossRefPubMed
  28. ↵
    1. Dong H.,
    2. S. E. Strome,
    3. D. R. Salomao,
    4. H. Tamura,
    5. F. Hirano,
    6. D. B. Flies,
    7. P. C. Roche,
    8. J. Lu,
    9. G. Zhu,
    10. K. Tamada,
    11. et al
    . 2002. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat. Med. 8: 793–800.
    OpenUrlCrossRefPubMed
    1. Iwai Y.,
    2. M. Ishida,
    3. Y. Tanaka,
    4. T. Okazaki,
    5. T. Honjo,
    6. N. Minato
    . 2002. Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc. Natl. Acad. Sci. USA 99: 12293–12297.
    OpenUrlAbstract/FREE Full Text
    1. Topalian S. L.,
    2. F. S. Hodi,
    3. J. R. Brahmer,
    4. S. N. Gettinger,
    5. D. C. Smith,
    6. D. F. McDermott,
    7. J. D. Powderly,
    8. R. D. Carvajal,
    9. J. A. Sosman,
    10. M. B. Atkins,
    11. et al
    . 2012. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. N. Engl. J. Med. 366: 2443–2454.
    OpenUrlCrossRefPubMed
  31. ↵
    1. Pen J. J.,
    2. B. D. Keersmaecker,
    3. C. Heirman,
    4. J. Corthals,
    5. T. Liechtenstein,
    6. D. Escors,
    7. K. Thielemans,
    8. K. Breckpot
    . 2014. Interference with PD-L1/PD-1 co-stimulation during antigen presentation enhances the multifunctionality of antigen-specific T cells. Gene Ther. 21: 262–271.
    OpenUrlCrossRefPubMed
  32. ↵
    1. Li J.,
    2. H. B. Jie,
    3. Y. Lei,
    4. N. Gildener-Leapman,
    5. S. Trivedi,
    6. T. Green,
    7. L. P. Kane,
    8. R. L. Ferris
    . 2015. PD-1/SHP-2 inhibits Tc1/Th1 phenotypic responses and the activation of T cells in the tumor microenvironment. Cancer Res. 75: 508–518.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Pauken K. E.,
    2. E. J. Wherry
    . 2015. Overcoming T cell exhaustion in infection and cancer. Trends Immunol. 36: 265–276.
    OpenUrlCrossRefPubMed
  34. ↵
    1. Ascierto P. A.,
    2. E. Simeone,
    3. M. Sznol,
    4. Y. X. Fu,
    5. I. Melero
    . 2010. Clinical experiences with anti-CD137 and anti-PD1 therapeutic antibodies. Semin. Oncol. 37: 508–516.
    OpenUrlCrossRefPubMed
  35. ↵
    1. Schmerling R. A.
    2014. Toxicity of checkpoint inhibitors. Chin. Clin. Oncol. 3: 31.
    OpenUrlPubMed
  36. ↵
    1. Figdor C. G.,
    2. I. J. de Vries,
    3. W. J. Lesterhuis,
    4. C. J. Melief
    . 2004. Dendritic cell immunotherapy: mapping the way. Nat. Med. 10: 475–480.
    OpenUrlCrossRefPubMed
  37. ↵
    1. Cudejko C.,
    2. K. Wouters,
    3. L. Fuentes,
    4. S. A. Hannou,
    5. C. Paquet,
    6. K. Bantubungi,
    7. E. Bouchaert,
    8. J. Vanhoutte,
    9. S. Fleury,
    10. P. Remy,
    11. et al
    . 2011. p16INK4a deficiency promotes IL-4-induced polarization and inhibits proinflammatory signaling in macrophages. Blood 118: 2556–2566.
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section