Skip to main content

Main menu

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons

User menu

  • Subscribe
  • Log in

Search

  • Advanced search
The Journal of Immunology
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons
  • Subscribe
  • Log in
The Journal of Immunology

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Follow The Journal of Immunology on Twitter
  • Follow The Journal of Immunology on RSS

Caspase-1, Caspase-8, and Calpain Are Dispensable for IL-33 Release by Macrophages

Tatsukuni Ohno, Keisuke Oboki, Naoki Kajiwara, Eiichi Morii, Katsuyuki Aozasa, Richard A. Flavell, Ko Okumura, Hirohisa Saito and Susumu Nakae
J Immunol December 15, 2009, 183 (12) 7890-7897; DOI: https://doi.org/10.4049/jimmunol.0802449
Tatsukuni Ohno
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Keisuke Oboki
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Naoki Kajiwara
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Eiichi Morii
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Katsuyuki Aozasa
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Richard A. Flavell
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ko Okumura
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hirohisa Saito
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Susumu Nakae
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

In addition to IL-1 and IL-18, IL-33 was recently identified as a member of the IL-1 cytokine family. rIL-33 can promote production of Th2-type cytokines by Th2 cells and mast cells in vitro. Administration of rIL-33 to mice results in increases in IgE secretion and eosinophilic inflammation. However, the precise immune cell source of IL-33 remains unclear. Moreover, although recombinant pro-IL-33 is cleaved by recombinant caspase-1 in vitro, as are pro-IL-1β and pro-IL-18, the involvement of caspase-1 in pro-IL-33 cleavage remains controversial. In this study, we show that mouse peritoneal macrophages, but not splenic dendritic cells, produced IL-33 upon stimulation with LPS. Likewise, mouse bone marrow cell-derived cultured mast cells also produced a small, but significant amount of IL-33 via FcεRI cross-linking, but not in response to stimulation with LPS. To our surprise, IL-33 release was found even in caspase-1-deficient, caspase-8 inhibitor-treated, and calpain inhibitor-treated macrophages. These observations suggest that caspase-1-, caspase-8-, and calpain-independent IL-33 production by macrophages and/or mast cells may contribute to the pathogenesis of Th2-type allergic inflammation.

Interleukin-33 (also called IL-1F11 (1), DVS27 (2), or nuclear factor from high endothelial venule (3)) is a member of the IL-1 family of cytokines that includes IL-1β and IL-18 (1). DVS27 and nuclear factor from high endothelial venule were, respectively, identified as an up-regulated gene in vasospastic cerebral arteries after subarachnoid hemorrhage (2) and as a NF expressed in endothelial cells (3). Then IL-33 was identified as a ligand for ST2 (also called T1, DER-4, Fit-1, or IL-1R4 (1, 4)), which is preferentially expressed in Th2 cells (5) and mast cells (6). High levels of constitutive IL-33 mRNA expression were found in various murine tissues, such as the stomach, lung, spinal cord, brain, and skin (1). In humans, smooth muscle cells and epithelial cells constitutively express IL-33 mRNA. Moreover, IL-33 mRNA expression was up-regulated in human fibroblasts and keratinocytes by stimulation with TNF and IL-1β (1).

IL-33 can promote Th2 cell and mast cell activation, leading to such functions as Th2-type cytokine secretion or chemotaxis (1, 7, 8, 9, 10, 11). IL-33 contributes to Th2-associated host defense against nematode infection (12). IL-33 administration results in IL-13-mediated eosinophilic inflammation in the gut and lung of mice (1). Moreover, inhibition of IL-33 by soluble IL-33R leads to attenuation of murine asthma models (13). In contrast, IL-33 ameliorates Th1-associated autoimmune-like atherosclerosis (14). Thus, IL-33 is considered to be involved in Th2-type immune responses and to suppress Th1-type responses. Based on these findings, it is clear that IL-33 contributes to the immune responses by acting as a proinflammatory cytokine. It is unclear what kinds of immune cell types can release IL-33 protein, although LPS-stimulated bone marrow cell-derived macrophages and resting bone marrow cell-derived dendritic cells (DCs)3 were reported to express IL-33 mRNA (1). In a preliminary experiment, we examined the expression of IL-33 mRNA in various immune cells and detected it in activated mast cells as well as activated macrophages and DCs.

Similar to IL-1β and IL-18, IL-33 is considered to be produced intracellularly as pro-IL-33, which does not contain a signal peptide sequence for secretion, and then released extracellularly as mature IL-33 after cleavage (1). Caspase-1 and/or caspase-8 is required for the cleavage of pro-IL-1β and/or pro-IL-18 (15, 16), whereas calpain is important for the cleavage of pro-IL-1α (16, 17, 18). Although recombinant pro-IL-33 is cleaved by recombinant caspase-1 in vitro (1), the in vivo role of caspase-1 in the cleavage of pro-IL-33 remains controversial (19). In this study, we show that LPS-stimulated mouse peritoneal macrophages, but not splenic DCs, and IgE/Ag-stimulated bone marrow cell-derived cultured mast cells (BMCMCs) produced IL-33, and that caspase-1, caspase-8, and calpain were dispensable for IL-33 release.

Materials and Methods

Mice

BALB/cA mice (CLEA Japan) and BALB/c-caspase-1−/− mice (20) were housed under specific pathogen-free conditions in our institute (National Research Institute for Child Health and Development), and the animal protocols were approved by the Institutional Review Board of the National Research Institute for Child Health and Development.

Cells

For purification of CD4+ T cells, mouse spleen and inguinal, axillary, brachial, and submaxillary lymph nodes were harvested and pooled. The pooled cells were incubated with biotinylated anti-mouse B220 (RA3-6B2), CD8 (53-6.7), CD11b (M1/70), CD11c (HL3), CD25 (PC61.5), CD49b (DX5), CD119 (c-kit, 2B8), FcεRIα (MAR-1), Gr-1 (RB6-8C5), Ter119, and γδTCR (GL3) mAbs at 4°C for 20 min. These Abs were obtained from eBiosciences and BD Biosciences. After washing, the cells were incubated with Streptavidin Particles Plus-DM (BD Biosciences). Then CD4+ T cells (>95%) were isolated by negative selection using a BD IMag system (BD Biosciences).

For purification of peritoneal macrophages and splenic DCs, mouse peritoneal exudate cells (PECs) and spleen cells were collected and incubated with anti-mouse CD16/CD32 mAb (93; eBiosciences) at 4°C for 20 min. The PECs were then incubated with biotinylated anti-mouse F4/80 mAb (BM8; eBiosciences) at 4°C for 20 min. After washing, the cells were incubated with streptavidin-Microbeads (Miltenyi Biotec) at 4°C for 20 min. Spleen cells were incubated with CD11c-Microbeads (Miltenyi Biotec) at 4°C for 20 min. F4/80+ peritoneal macrophages (>92%) and CD11c+ splenic DCs (>92%) were isolated by positive selection using a MACS system (Miltenyi Biotec).

For collection of thioglycolate (TGC)-induced mouse peritoneal macrophages (TGC-macrophages), mice were i.p. injected with 5 ml of 2% TGC (Nissui). Three days after injection, PECs were collected.

Mouse BMCMCs were generated, as described elsewhere (11). In brief, mouse femoral bone marrow cells were cultured in the presence of 10 ng/ml mouse rIL (rmIL)-3 (PeproTech) for 6–8 wk, at which time flow cytometry showed the cells to be a >98% c-kit+ FcεRIα+ population. Before using the cells, rmIL-3 was removed by washing.

Cell culture

CD4+ T cells were cultured with plate-coated anti-CD3 mAb (1 μg/ml) (145-2C11; eBioscience). F4/80+ macrophages, CD11c+ DCs, or TGC-macrophages were stimulated with 100 ng/ml LPS (Salmonella enterica serotype typhimurium; Sigma-Aldrich), 100 ng/ml rmIL-33 (R&D Systems), or 0.1 μg/ml PMA (Sigma-Aldrich) plus 1 μg/ml ionomycin (Sigma-Aldrich). Naive BMCMCs were incubated with various concentrations of monomeric IgE (SPE-7; Sigma-Aldrich), LPS, and/or 0.1 μg/ml PMA plus 1 μg/ml ionomycin. For IgE/Ag-dependent mast cell activation, naive BMCMCs were sensitized overnight with 1 μg/ml anti-DNP IgE (SPE-7). After washing, IgE-sensitized BMCMCs were cultured with various concentrations of DNP-human serum albumin (DNP-HSA; Sigma-Aldrich). These cells were cultured for 1 h (RT-PCR), 6 h, or 24 h (ELISA, ELISPOT, and immunoprecipitation), respectively. For caspase-8 or calpain inhibition, F4/80+ peritoneal macrophages were incubated with and without a caspase-8 inhibitor (30 μM caspase-8 inhibitor II (Calbiochem)) for 1 h, or calpain inhibitor (10, 30, or 100 μM MDL 28,170 (Calbiochem)) for 45 min, and then stimulated with and without LPS for 24 h. For induction of necrosis, F4/80+ peritoneal macrophages and TGC macrophages were stimulated with 100 ng/ml LPS for 6 h, and then incubated with 1 M NaN3 or treated by freeze thawing.

RT-PCR

IL-33 mRNA expression was analyzed by RT-PCR. The PCR primers were 5′-gaagatcccaacagaagacc-3′ and 5′-ttccggaggcgagacgtcac-3′ for mIL-33, and 5′-gccgcctggagaaacctgc-3′ and 5′-tgaggtccaccaccctgttg-3′ for murine GAPDH. The PCR conditions were (94°C for 30 s; 55°C for 30 s; 72°C for 60 s) × 35 cycles (IL-33) or 25 cycles (GAPDH).

ELISA/ELISPOT

For IL-33 detection, Nunc-Immuno plates (Nunc) for ELISA and MultiScreen-IP plates (MAIPS4510; Millipore) for ELISPOT were coated with anti-mIL-33 polyclonal Ab (R&D Systems; 2 μg/ml in PBS) as a capture Ab at 4°C overnight. After blocking with PBS containing 1% BSA (ELISA) or 10% FCS (ELISPOT), samples, and rmIL-33 as a standard cytokine, the cells were incubated at room temperature (r.t.) for 2 h for ELISA or cultured at 37°C for 24 h for ELISPOT. After washing the wells, biotinylated anti-mouse/human IL-33 mAb (Nessy-1; Alexis Biochemicals, 400 ng/ml in PBS containing 1% BSA) as a detection Ab was applied and incubated at r.t. for 1 h for ELISA and ELISPOT. Then, after washing the wells, HRP-conjugated streptavidin (BD Biosciences) was added to the wells at r.t. for 1 h. Tetramethylbenzidine (eBioscience) and 3-amino-9-ethylcarbazole (Sigma-Aldrich) were used as substrates in ELISA and ELISPOT, respectively. For ELISPOT, positive spots on Ab-coated MultiScreen-IP plates (MAIPS4510; Millipore) were analyzed with NIH Image software. For IL-1α, IL-1β, and IL-6 detection, mIL-1α DuoSet (R&D Systems) and mIL-1β and mIL-6 ELISA sets (eBiosciences) were used for ELISA and ELISPOT.

Immunocytochemistry

Immunocytochemistry for IL-33 was conducted by the polymer-immunocomplex method (DakoCytomation), according to the manufacturer’s instructions. Briefly, cytospin samples were fixed with 4% performaldehyde at 4°C for 20 min and then blocked with peroxidase-blocking solution (DakoCytomation). The resultant complex was mixed with mouse anti-mouse/human IL-33 mAb (Nessy-2; Alexis Biochemicals) and EnVision detection reagent (DakoCytomation) at r.t. for 1 h, followed by addition of normal mouse serum and further incubation at r.t. for 1 h. Cytospin samples were incubated with the resultant complex at r.t. for 1 h, and then the IL-33/anti-IL-33/EnVision complex was detected with diaminobenzidine.

Immunoprecipitation and Western blot analysis

Cells that were stimulated with and without 100 ng/ml LPS or lungs that were harvested from mice at 6 h after inhalation of LPS (10 μg in 20 ml of sterile, pyrogen-free 0.9% NaCl (saline)) or saline were homogenized in cold lysis buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS; 250 mg of lung tissue/ml) and held at 4°C for 30 min. Then, after centrifugation (16,000 × g) at 4°C for 30 min, the supernatants were collected. For immunoprecipitation, the lysates were incubated with anti-mIL-33 mAb (10 μg; Nessy-1; Alexis) or anti-mIL-1β mAb (2 μg; B122; BD Biosciences) at 4°C for 12 h. The immunoprecipitants, lung and cell lysates, rmIL-33, and rmIL-1β were analyzed by SDS-PAGE and blotted onto polyvinylidene difluoride membranes (Invitrogen). The membranes were blocked and then incubated consecutively with anti-mIL-33 mAb (4G4; MBL) and HRP-conjugated anti-mouse IgG (Amersham) for IL-33, and anti-mIL-1β (166926; R&D Systems) and anti-rat IgG (Amersham) for IL-1β. Then the immunoreactive proteins were visualized with ECL reagents (ECL Western Blotting Detection Reagents; Amersham).

Cell survival

Cell viability was assessed using the MEBCYTO-Apoptosis Kit (MBL) with flow cytometry or a colorimetric lactate dehydrogenase (LDH) assay kit (CytoTox 96; Promega).

Multiple simultaneous Tag (MUSTag) assay

For modified immune PCR, called MUSTag technology, anti-mIL-1β polyclonal Ab (R&D Systems) and anti-mIL-33 polyclonal Ab (R&D Systems), as detection Abs, were conjugated with DNA. Briefly, the detection Abs (15 μg) were incubated with 100 pmol biotinylated double-strand MUSTag DNA fragment (Synthera Technologies) and 100 pmol MUSTag adaptor protein in binding buffer (500 mM NaCl, 0.1 mM EDTA, and 10 mM Tris-HCl (pH 7.4)) at r.t. for 2 h. Then the mixture, in which the Abs are DNA conjugated via the MUSTag adaptor protein, was subjected to gel filtration chromatography on a Superdex 200 PC 3.2/30 column connected to a SMART System (GE Healthcare Bio-Science). The peak fractions were collected, and the yield of the DNA-conjugated Abs was determined by ELISA. The biotinylated double-strand MUSTag DNA fragment was designed as follows: 5′-[biotin]-CACTGCTTACTGGCTTATCGAAATGGAATTCTGCATGCATCTAGAGGGCCCTATTCTATAGCATAGTG TCACCTAAATGCTAGGCACCTTCTAGTTGCCAGCCATCTGTTGC ACACCAAACGTGGCTTGCC-3′; the first box = EcoRI restriction site, the second box = MUSTag forward priming site, and the third box = MUSTag reverse priming site.

MUSTag assays were performed according to the manufacturer’s instructions (Synthera Technologies). Briefly, Maxisorp Immunomodule 96-well plates (Nalge Nunc International) were coated with 50 μl/well anti-mIL-1β mAb (2 μg/ml; 30311; R&D Systems) or anti-human/mouse IL-33 mAb (3 μg/ml; Nessy-1; Alexis Biochemicals) in 50 mM sodium carbonate buffer (pH 9.6) at 4°C overnight. After blocking with a blocking buffer (Synthera Technologies) for 1 h at r.t., serially diluted standard rmIL-1β (R&D Systems) or rmIL-33 (PeproTech; 10 ng/ml to 0.64 pg/ml) in sample dilution buffer (Synthera Technologies) and samples (50 μl/well) were incubated at r.t. for 1 h. After washing with wash buffer (Synthera Technologies), DNA-conjugated anti-mIL-1β or anti-mIL-33 polyclonal Ab in the dilution buffer (8 ng/ml, 30 μl/well) was added, followed by incubation at r.t. for 1 h. After washing, 7.5 U/ml EcoRI (30 μl/well; Nippon Gene) in digestion buffer was added, followed by incubation at r.t. for 15 min. A total of 3 μl of the solution in each well was subjected to real-time quantitative PCR (qPCR) analyses.

qPCR analyses were performed using the Mx3005P Real-Time PCR System (Agilent). The PCR mixtures consisted of 10 μl of 2× SYBR Premix EX Taq (Takara Bio), 100 nM MUSTag primers (Synthera Technologies), 0.4 μl of 50× 6-carboxy-X-rhodamine Reference Dye II (Takara Bio), 3 μl of each sample, and sterile distilled water added to a final volume of 20 μl. The temperature program for PCR was as follows: 1) 95°C for 10 s; 2) (95°C for 5 s) × 40 cycles; and 3) 60°C for 20 s. The fluorescence intensity was measured at the end of each cycle using excitation/emission filters of 492/516 nm for SYBR Green I and 585/610 nm for 6-carboxy-X-rhodamine (passive reference). The threshold cycle (Ct) values were calculated from amplification plots using MXPro qPCR software version 3.20 (Agilent) with adaptive baseline and amplification-based threshold algorithms, and further analyses were conducted with GraphPad Prism version 4.03 (GraphPad). Each standard was assayed in triplicate, and the mean Ct values with SD were plotted against the log of the concentration of each recombinant enzyme. The standard curves were fit to the following sigmoidal four-parameter logistic equation: Math where X is the enzyme concentration, Ct is the corresponding Ct value, Ctmax is the theoretical maximum Ct value (the minimum response), Ctmin is the theoretical minimum Ct value (the maximum response), EC50 is the concentration causing 50% of the maximum response, and Hill Slope is the slope of the linear portion of the sigmoidal curve. In all curve fittings, each Ctmax parameter was fixed to the mean Ct value of the blank concentration, and then Ctmin, EC50, and Hill Slope were obtained by a nonlinear least-squares method. The concentrations of IL-33 and IL-1β in unknown samples were calculated from the respective standard curves.

Statistics

An unpaired Student’s t test, two tailed, was used for statistical evaluation of the results.

Results

IL-33 mRNA is expressed in mouse macrophages, DCs, and BMCMCs

Macrophages, DCs, and mast cells express TLRs. These immune cells are considered to be important for host defense against various pathogens by activating innate immune responses via TLRs. TLRs are also important for the elicitation of acquired immune responses; for example, TLR signals contribute to, but are not essential for, the development of Th2-associated allergic responses (21). Thus, we used RT-PCR to examine IL-33 mRNA expression in those cells after LPS stimulation. Resting mouse F4/80+ peritoneal macrophages, but not CD11c+ splenic DCs or BMCMCs, constitutively expressed IL-33 mRNA (Fig. 1⇓). After PMA plus ionomycin stimulation, IL-33 mRNA was increased in CD11c+ splenic DCs and BMCMCs, but not in F4/80+ peritoneal macrophages (Fig. 1⇓). After LPS stimulation, IL-33 mRNA was up-regulated in F4/80+ peritoneal macrophages and CD11c+ splenic DCs, but not in BMCMCs (Fig. 1⇓). However, BMCMCs expressed IL-33 mRNA after addition of monomeric IgE (22) and rmIL-33, and also after IgE/Ag stimulation (Fig. 2⇓). IL-33 mRNA was not observed to be expressed by CD4+ T cells under any conditions (Fig. 1⇓).

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

IL-33 mRNA expression in macrophages, DCs, and BMCMCs after LPS stimulation. Mouse splenic CD4+ T cells, CD11c+ DCs, peritoneal F4/80+ macrophages (Mφ), and BMCMCs were stimulated for 1 h with plate-coated anti-CD3 mAb (1 μg/ml), 100 ng/ml LPS, or 0.1 μg/ml PMA plus 1 μg/ml ionomycin. –, Indicates no stimulation. IL-33 mRNA expression was determined by RT-PCR. GAPDH mRNA expression was used as an internal control. Densitometric analysis was performed using NIH Image software, and IL-33 mRNA expression was normalized against GAPDH mRNA expression (the value of IL-33 mRNA expression/the value of GAPDH mRNA expression × 100). The data show representative results from at least two to three independent experiments. Semiquantitative PCR analysis was performed using the serially diluted cDNA templates during the exponential phase of PCR amplification.

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

IL-33 mRNA expression in BMCMCs. Mouse BMCMCs were stimulated for 1 h with various concentrations of monomeric IgE (SPE-7), LPS, or rmIL-33 or 0.1 μg/ml PMA plus 1 μg/ml ionomycin. –, Indicates no stimulation. Mouse BMCMCs were sensitized overnight with 1 μg/ml anti-DNP IgE (SPE-7). After washing, IgE-sensitized BMCMCs were cultured for 1 h with various concentrations of DNP-HSA. IL-33 mRNA expression was determined by RT-PCR. GAPDH mRNA expression was used as an internal control. Densitometric analysis was performed using NIH Image software, and IL-33 mRNA expression was normalized against GAPDH mRNA expression (the value of IL-33 mRNA expression/the value of GAPDH mRNA expression × 100). The data show representative results from at least two to three independent experiments. Semiquantitative PCR analysis was performed using the serially diluted cDNA templates during the exponential phase of PCR amplification.

IL-33 protein is produced by mouse macrophages, but not by DCs

In contrast to IL-33 mRNA expression, IL-33 protein levels were always below the limit of detection by ELISA in the culture supernatants of F4/80+ peritoneal macrophages and CD11c+ splenic DCs after stimulation with LPS or PMA plus ionomycin (Fig. 3⇓), even though IL-6 production was detected in the same supernatants (data not shown). However, IL-33 protein was detected in whole-cell lysates of F4/80+ peritoneal macrophages, but not of CD11c+ splenic DCs, after LPS and PMA plus ionomycin stimulation (Fig. 3⇓). To detect released IL-33 protein, we next established an IL-33-specific MUSTag assay system (limit of detection: >0.64 pg/ml rmIL-33), which is much more sensitive than general ELISA (limit of detection: >30 pg/ml rmIL-33). Nevertheless, as shown in Fig. 3⇓, any IL-33 that was present in the culture supernatants of LPS- or PMA plus ionomycin-stimulated F4/80+ peritoneal macrophages was still below the limit of detection even with the MUSTag system, whereas IL-1β was able to be detected (data not shown).

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

IL-33 production by LPS-stimulated macrophages. Mouse peritoneal F4/80+ macrophages (5 × 105 cells/100 μl) and splenic CD11c+ DCs (1 × 106 cells/100 μl) were stimulated for 6 h with 100 ng/ml LPS or 0.1 μg/ml PMA plus 1 μg/ml ionomycin. IL-33 levels in the culture supernatants (Sup) and whole-cell lysates (WCL; 5 × 105 macrophages or 1 × 106 DCs in 100 μl of lysis buffer) were determined by ELISA. Data show the mean + SEM (n = 3). ∗, p < 0.05 vs medium.

Because IL-33 is localized in the nucleus as an intracellular NF (19), it has been unclear whether pro-IL-33 is cleaved and/or released. We next performed Western blot analysis for detection of processed-form IL-33. As shown in Fig. 4⇓A, >1.2 ng of rmIL-33 was detectable with our Western blot system. However, both pro-IL-33 (32 kDa) and processed-form IL-33 (18 kDa) in whole-cell lysates or culture supernatants of LPS-stimulated F4/80+ peritoneal macrophages (1 × 107 cells purified from pooled PECs from 20 mice) were below the limit of detection with Western blot analysis even after immunoprecipitation using anti-IL-33 Ab (data not shown). It has been shown that IL-33 mRNA is constitutively expressed in the lungs of mice (1). In support of this, pro-IL-33 (a 31-kDa protein), but not processed-form IL-33 (18 kDa), was detected in whole-lung homogenates from naive wild-type mice by the Western blot analysis (Fig. 4⇓B). Pro-IL-33 expression was increased in whole-lung homogenates from LPS-inhaled wild-type mice in comparison with saline-inhaled wild-type mice by Western blot analysis, but processed-form IL-33 expression could not be detected in those homogenates by Western blot analysis irrespective of LPS treatment (Fig. 4⇓B) or even by the Western blot analysis after immunoprecipitation using anti-IL-33 Ab (data not shown). Likewise, even though pro-IL-33 (32-kDa) expression was increased in whole-cell lysates, but not culture supernatants, of TGC macrophages after stimulation with LPS, processed-form IL-33 was below the limit of detection in both samples by Western blot analysis after immunoprecipitation using anti-IL-33 Ab (Fig. 4⇓C). In contrast, released-form IL-1β could be detected under similar cell culture conditions by Western blot analysis after immunoprecipitation using anti-IL-1β Ab (Fig. 4⇓D). However, in comparison with the amount of pro-IL-1β in whole-cell lysates of LPS-treated TGC-macrophages, the amount of released-form IL-1β in the culture supernatants was very small (Fig. 4⇓D). These observations suggest that detection of low levels of processed-form IL-33, like released-form IL-1β, was difficult with our Western blot system.

FIGURE 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 4.

Detection of IL-33 by Western blot analysis. Western blot analysis for IL-33 detection was performed by loading various concentrations of rmIL-33 (A) and whole-lung lysates from LPS- or saline-inhaled wild-type mice (B) onto Western blot gels. A total of 20 ng of rmIL-33 was used as a control (B). Immunoprecipitants of culture supernatants and lysates from LPS-treated and untreated TGC-macrophages, 200 ng of rmIL-33, or 20 ng of rmIL-1β with anti-mIL-33 Ab or anti-mIL-1β Ab were analyzed by Western blotting for IL-33 or IL-1β detection (C and D). Pro-IL-33 = 32 kDa, and rIL-33 = 18 kDa. Pro-IL-1β = 31 kDa, and released-form IL-1β = 17 kDa.

Therefore, we established an IL-33-specific ELISPOT system to detect IL-33-releasing cells. Consistent with the IL-33 levels detected in whole-cell lysates by ELISA, ELISPOT analysis found that F4/80+ peritoneal macrophages and TGC-induced macrophages, but not CD11c+ splenic DCs, released IL-33 at significant levels after LPS or PMA plus ionomycin stimulation (Fig. 5⇓A and data not shown). These findings suggest that macrophages, but not DCs, are a potential source of IL-33.

FIGURE 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 5.

Caspase-1-independent IL-33 release by macrophages. Peritoneal F4/80+ macrophages (2 × 104 cells/200 μl) from BALB/c wild-type mice or BALB/c-caspase-1-deficient mice were plated into an anti-mouse IL-1α, IL-1β, or IL-33 Ab-coated plate, and then stimulated with and without 100 ng/ml LPS or 0.1 μg/ml PMA plus 1 μg/ml ionomycin for 24 h. A, The levels of IL-1α, IL-1β, and IL-33 in the culture supernatants and the numbers of IL-1α-, IL-1β-, and IL-33-positive cells were determined by ELISA and ELISPOT, respectively. Data show the mean + SEM (ELISA, n = 3; ELISPOT, n = 4). ∗, p < 0.05 vs medium; †, p < 0.05 vs wild-type cells. B, The numbers of live cells in the cultures of A were determined by flow cytometry after staining with annexin V and PI. C, LDH levels in the culture supernatants shown in A were determined. Data show the mean + SEM (n = 3).

Caspase-1, caspase-8, and calpain are dispensable for IL-33 release by macrophages

It was reported that recombinant pro-IL-33 was cleaved by recombinant caspase-1 in vitro (1), suggesting that in vivo release of IL-33, as well as IL-1β and IL-18, is mediated by caspase-1. In contrast, as reported by Carriere et al. (19), the biological involvement of caspase-1 in pro-IL-33 cleavage remains controversial. To clarify this issue, we performed IL-33-specific ELISPOT assay using F4/80+ peritoneal macrophages from caspase-1-deficient mice. Both the ELISA and ELISPOT assays showed that release of IL-1β, but not IL-1α, by caspase-1-deficient macrophages after LPS stimulation was profoundly decreased in comparison with that by wild-type macrophages (Fig. 5⇑A). In contrast, interestingly, we found that even caspase-1-deficient macrophages were able to release a significant amount of IL-33 after LPS or PMA plus ionomycin stimulation (Fig. 5⇑A). Parallel experiments showed reduced IL-1β release, but normal IL-33 release by caspase-1-deficient peritoneal macrophages after LPS stimulation (Fig. 5⇑A). Meanwhile, the cell viability assessed by annexin V and propidium iodide (PI) staining and the LDH activity in the culture supernatants were not affected by the addition of LPS (Fig. 5⇑, B and C). Accordingly, both the IL-33 and IL-1β detected in the ELISPOT assay appeared to have been largely released by live cells rather than by apoptotic/necrotic/dead cells. Thus, these observations suggest that release of IL-33 is independent of caspase-1.

Like caspase-1, caspase-8 is involved in the cleavage of pro-IL-1β under certain conditions (18). Therefore, we used a caspase-8 inhibitor to examine whether caspase-8 is involved in IL-33 release by LPS-stimulated macrophages. Although both the ELISA-determined levels of IL-1β in the culture supernatants and the ELISPOT-determined number of IL-1β-releasing macrophages were reduced in the presence of the caspase-8 inhibitor after LPS stimulation, the number of IL-33-releasing macrophages was not affected (Fig. 6⇓).

FIGURE 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 6.

Caspase-8-independent IL-33 release by macrophages. Peritoneal F4/80+ macrophages (2 × 104 cells/200 μl) from BALB/c wild-type mice were plated into an anti-mouse IL-1β or IL-33 Ab-coated plate and incubated with and without 30 μM caspase-8 inhibitor for 1 h. Then the cells were stimulated with and without 100 ng/ml LPS for 24 h. The levels of IL-1β and IL-33 in the culture supernatants and the numbers of IL-1β- and IL-33-positive cells were detected by ELISA and ELISPOT, respectively. Data show the mean + SEM (n = 3). ∗, p < 0.05 vs DMSO.

Similar to IL-33, IL-1α, but not IL-1β or IL-18, is localized in the nucleus (17). Pro-IL-1α is cleaved by calcium-dependent activation of a membrane-associated cysteine proteinase, calpain (16, 17). Indeed, in the presence of calpain inhibitors, the levels of IL-1α in the culture supernatants and the number of IL-1α-releasing macrophages were reduced in ELISA and ELISPOT, respectively, after LPS stimulation (Fig. 7⇓). In contrast, the number of IL-33-releasing macrophages detected by ELISPOT was not influenced by the addition of calpain inhibitors to the culture (Fig. 7⇓). Taken together, these observations indicate that neither caspase-1, caspase-8, nor calpain is essential for IL-33 release by macrophages and suggest that the mechanism of cleavage of pro-IL-33 is different from the cleavage mechanisms for pro-IL-1α, pro-IL-1β, and pro-IL-18.

FIGURE 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 7.

Calpain-independent IL-33 release by macrophages. Peritoneal F4/80+ macrophages (2 × 104 cells/200 μl) from BALB/c wild-type mice were plated into an anti-mouse IL-1α or IL-33 Ab-coated plate and incubated with and without 10 μM calpain inhibitor, MDL 28,170. Then the cells were stimulated with and without 100 ng/ml LPS for 24 h. The levels of IL-1α and IL-33 in the culture supernatants and the numbers of IL-1α- or IL-33-positive cells were detected by ELISA and ELISPOT, respectively. Data show the mean + SEM (ELISA, n = 3; ELISPOT, n = 4). ∗, p < 0.05 vs DMSO.

IL-33 production is induced in BMCMCs after IgE/Ag stimulation

As shown in Figs. 1⇑ and 2⇑, the expression of IL-33 mRNA was up-regulated in BMCMCs upon stimulation with monomeric IgE, rmIL-33, or PMA plus ionomycin, but not LPS, and after IgE/Ag-FcεR cross-linking. However, IL-33 protein in the culture supernatants was below the limit of detection by ELISA under all conditions, whereas IL-6 in the supernatants was detectable in the same settings (data not shown). In contrast, with ELISA, IL-33 protein was detectable and increased in the whole-cell lysates of BMCMCs after PMA plus ionomycin stimulation (Fig. 8⇓A). Therefore, we surmised that mast cells were producing IL-33. However, IL-33 was not dramatically increased even in the whole-cell lysates of BMCMCs after stimulation with monomeric IgE, LPS, or IgE/Ag (Fig. 8⇓B). IL-33 release could not be detected by ELISPOT even after PMA plus ionomycin stimulation (data not shown). However, IL-33 protein was detected around the nuclear membrane of BMCMCs by immunohistochemistry after stimulation with IgE/Ag, but not LPS (Fig. 8⇓B).

FIGURE 8.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 8.

IL-33 protein production by mast cells. A, Naive BMCMCs (1 × 106 cells/100 μl) were stimulated for 6 h with various concentrations of monomeric IgE (SPE-7) and LPS or with 0.1 μg/ml PMA plus 1 μg/ml ionomycin, whereas IgE-sensitized BMCMCs (1 × 106 cells/100 μl) were stimulated with various concentrations of DNP-HSA. IL-33 levels in the culture supernatants (Sup) and whole-cell lysates (WCL; 1 × 106 BMCMCs in 100 μl of lysis buffer) were determined by ELISA. Data show the mean + SEM (n = 3 different batches of BMCMCs). ∗, p < 0.05 vs medium. B, BMCMCs were stimulated with and without LPS and IgE/Ag, as described above. IL-33-positive cells were detected by immunohistochemistry. Data show a representative result from three different batches of BMCMCs.

Discussion

IL-33 can promote Th2 cell and mast cell activation, suggesting that it contributes to the development of such Th2 cytokine- and mast cell-associated disorders as allergic diseases (1, 7, 8, 9, 10, 11). Indeed, administration of rIL-33 results in dramatic pathological changes in mice, as follows: splenomegaly, elevated numbers of blood eosinophils, increased serum IgE and IgA levels, and IL-5 and IL-13 levels, and eosinophil-dominant inflammation in the gut and lung (1). Thus, it is clear that IL-33, like IL-1β and IL-18, acts as a proinflammatory cytokine in immune responses. In contrast, the precise immune cell source of IL-33 remains poorly understood, although IL-33 mRNA was increased in the lungs of mice in an OVA-induced asthma model (13).

Schmitz et al. (1) demonstrated that LPS-stimulated bone marrow-derived macrophages and resting bone marrow-derived DCs expressed IL-33 mRNA in mice. We have now demonstrated that IL-33 mRNA was constitutively expressed in resting mouse F4/80+ peritoneal macrophages and up-regulated in those cells after LPS or PMA plus ionomycin stimulation. In contrast to the resting bone marrow-derived DCs reported by Schmitz et al. (1), CD11c+ DCs freshly isolated from mouse spleen did not express IL-33 mRNA. However, as in the case of F4/80+ peritoneal macrophages, IL-33 mRNA expression was strongly induced in CD11c+ splenic DCs by LPS or PMA plus ionomycin stimulation. We also found that mouse BMCMCs expressed IL-33 mRNA upon stimulation with monomeric IgE and rmIL-33, but not LPS, and after IgE/Ag cross-linking. Thus, these observations suggest that macrophages, rather than DCs or mast cells, may be a producer of IL-33 during bacterial infections.

Schmitz et al. (1) reported that recombinant pro-IL-33 was cleaved by recombinant caspase-1 in vitro. In contrast, Carriere et al. (19) noted that biological involvement of caspase-1 in pro-IL-33 cleavage remains controversial. Pro-IL-33 was recently demonstrated to show biological activity in inducing mast cell activation (23), but cleavage of pro-IL-33 by caspase-1 in vitro resulted in loss of that biological activity (24, 25). In addition, it was very recently reported that pro-IL-33 was released by necrotic cells independent of caspase-1 (25). We also confirmed that IL-33 was detected in the culture supernatants of LPS-treated F4/80+ peritoneal macrophages in the presence, but not absence, of NaN3, and also in the supernatants of LPS-treated F4/80+ peritoneal macrophages after freeze thawing (Fig. 9⇓A). Such treatments induced profound PI-positive necrosis (Fig. 9⇓A). In addition, pro-IL-33, but not a protease-cleaved form of IL-33, was detected in the culture supernatants from that setting (Fig. 9⇓B). The number of IL-33-positive F4/80+ peritoneal macrophages was dramatically increased after PMA plus ionomycin stimulation (13.4-fold increase vs the control condition, medium alone) in comparison with LPS stimulation (1.9-fold increase vs the control condition, medium alone) by ELISPOT (Fig. 9⇓C). Compared with this, the proportion of PI-positive necrotic macrophages was slightly increased after PMA plus ionomycin stimulation (2.8-fold increase vs the control condition, medium alone; Fig. 9⇓C). Although we cannot rule out the possibility that pro-IL-33 is released only by necrotic cells, our observations suggest that it is released by live cells in addition to necrotic cells.

FIGURE 9.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 9.

Necrotic cells release pro-IL-33. A, Peritoneal F4/80+ macrophages (5 × 105 cells/200 μl) from BALB/c wild-type mice were stimulated for 6 h with LPS. Cells were then treated with and without NaN3 (left panel) for 1 h or treated by freeze thawing (F & T: right panel). IL-33 levels in the culture supernatants were determined by ELISA. B, Culture supernatants from LPS-stimulated TGC-macrophages, with and without freeze-thaw treatment, were immunoprecipitated with anti-mouse IL-33 Ab, and rIL-33 was analyzed by Western blotting for IL-33 detection. Pro-IL-33 = 32 kDa, and rIL-33 = 18 kDa. C, Peritoneal F4/80+ macrophages (2 × 104 cells/200 μl) from BALB/c wild-type mice were plated into an anti-mouse IL-33 Ab-coated plate and then stimulated with and without 100 ng/ml LPS or 0.1 μg/ml PMA plus 1 μg/ml ionomycin (PMA + Iono) for 6 h. A and C, The proportion of necrotic cells was determined by flow cytometry after staining with annexin V and PI. Data show the mean + SEM (n = 3). ∗, p < 0.05 vs medium.

In our present study, we also clearly demonstrated for the first time that neither caspase-1, caspase-8, nor calpain is essential for IL-33 release by F4/80+ peritoneal macrophages after LPS stimulation. That is, whereas IL-1β release or IL-1α release was significantly impaired in caspase-1-deficient, caspase-8 inhibitor-treated, or calpain inhibitor-treated macrophages after stimulation, respectively, IL-33 release was unaffected by these treatments. It is also known that caspase-1-deficient mice show significantly reduced IL-1β and IL-18 release, but they still release significant amounts of IL-1β and IL-18 (18, 26), suggesting a caspase-1-independent alternative pathway(s) for IL-1β and IL-18 release. In support of this notion, pro-IL-18 is known to be cleaved predominantly by chymase, which is a proteinase expressed in mast cells, but not macrophages (27). These observations also suggest the existence of an alternative mechanism(s), independent of caspase-1, caspase-8, and calpain, for IL-33 release.

We also demonstrated that BMCMCs are a potential producer of IL-33 protein. In contrast to IL-33 release by F4/80+ peritoneal macrophages, IL-33 release by BMCMCs was hardly detected after stimulation with monomeric IgE, LPS, and IgE/Ag. However, the IL-33 protein was detected in whole-cell lysates of BMCMCs by ELISA after PMA plus ionomycin stimulation and around the nuclear membrane of BMCMCs by immunohistochemistry after IgE/Ag cross-linking. Therefore, we cannot rule out the possibility that mast cells release a very small amount of IL-33 protein, which might be below the limits of detection with ELISPOT and ELISA.

In the present study, we demonstrated that macrophages and mast cells are potential producers of IL-33, and that neither caspase-1, caspase-8, nor calpain is essential for the release of IL-33. These observations imply that caspase-1- and calpain-independent IL-33 production by macrophages and/or mast cells may contribute to the pathogenesis of certain infections and/or Th2-type allergic inflammation.

Acknowledgments

We thank Michiko Yamada, Hiromi Wakita, Masaharu Kohara, and Shuhei Fukuda for their invaluable technical assistance; Akane Nakamura for animal care; Dr. Noriko M. Tsuji (National Institute for Advanced Industrial Science and Technology, Tsukuba, Japan) for providing caspase-1-deficient mice; Drs. Kazuyoshi Takeda (Juntendo University) and Takeshi Fukuhara (Stanford University) for helpful discussions; and Synthera Technologies for development of the MUSTag assay.

Disclosures

The authors have no financial conflict of interest.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 This work was supported by grants from the National Institute of Biomedical Innovation (ID 05-24, to H.S.), the Ministry of Health, Labour, and Welfare, Research on Allergic Disease and Immunology (21200201, to H.S.), and the Ministry of Education, Culture, Sports, Science, and Technology (MEXT; 21390303, to H.S.; 18790694, to K.O.; 18890236, to T.O.), and by the Program for Improvement of Research Environment for Young Researchers, the Special Coordination Funds for Promoting Science and Technology of MEXT (to S.N.). R.A.F. is an investigator at the Howard Hughes Medical Institute.

  • ↵2 Address correspondence and reprint requests to Dr. Susumu Nakae, Frontier Research Initiative, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato, Tokyo, 108-8639, Japan; E-mail address: snakae{at}ims.u-tokyo.ac.jp or Dr. Hirohisa Saito, Department of Allergy and Immunology, National Research Institute for Child Health and Development, 2-10-1 Okura, Setagaya, Tokyo 157-8535, Japan; E-mail address: hsaito{at}nch.go.jp

  • ↵3 Abbreviations used in this paper: DC, dendritic cell; BMCMC, bone marrow cell-derived cultured mast cell; Ct, threshold cycle; HSA, human serum albumin; LDH, lactate dehydrogenase; mIL, mouse IL; MUSTag, multiple simultaneous Tag; PEC, peritoneal exudate cell; PI, propidium iodide; qPCR, quantitative PCR; r.t., room temperature; TGC, thioglycolate.

  • Received July 24, 2008.
  • Accepted October 16, 2009.
  • Copyright © 2009 by The American Association of Immunologists, Inc.

References

  1. ↵
    Schmitz, J., A. Owyang, E. Oldham, Y. Song, E. Murphy, T. K. McClanahan, G. Zurawski, M. Moshrefi, J. Qin, X. Li, et al 2005. IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity 23: 479-490.
    OpenUrlCrossRefPubMed
  2. ↵
    Onda, H., H. Kasuya, K. Takakura, T. Hori, T. Imaizumi, T. Takeuchi, I. Inoue, J. Takeda. 1999. Identification of genes differentially expressed in canine vasospastic cerebral arteries after subarachnoid hemorrhage. J. Cereb. Blood Flow Metab. 19: 1279-1288.
    OpenUrlPubMed
  3. ↵
    Baekkevold, E. S., M. Roussigne, T. Yamanaka, F. E. Johansen, F. L. Jahnsen, F. Amalric, P. Brandtzaeg, M. Erard, G. Haraldsen, J. P. Girard. 2003. Molecular characterization of NF-HEV, a nuclear factor preferentially expressed in human high endothelial venules. Am. J. Pathol. 163: 69-79.
    OpenUrlCrossRefPubMed
  4. ↵
    Trajkovic, V., M. J. Sweet, D. Xu. 2004. T1/ST2: an IL-1 receptor-like modulator of immune responses. Cytokine Growth Factor Rev. 15: 87-95.
    OpenUrlCrossRefPubMed
  5. ↵
    Lohning, M., A. Stroehmann, A. J. Coyle, J. L. Grogan, S. Lin, J. C. Gutierrez-Ramos, D. Levinson, A. Radbruch, T. Kamradt. 1998. T1/ST2 is preferentially expressed on murine Th2 cells, independent of interleukin 4, interleukin 5, and interleukin 10, and important for Th2 effector function. Proc. Natl. Acad. Sci. USA 95: 6930-6935.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Moritz, D. R., H. R. Rodewald, J. Gheyselinck, R. Klemenz. 1998. The IL-1 receptor-related T1 antigen is expressed on immature and mature mast cells and on fetal blood mast cell progenitors. J. Immunol. 161: 4866-4874.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Iikura, M., H. Suto, N. Kajiwara, K. Oboki, T. Ohno, Y. Okayama, H. Saito, S. J. Galli, S. Nakae. 2007. IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87: 971-978.
    OpenUrlCrossRefPubMed
  8. ↵
    Allakhverdi, Z., D. E. Smith, M. R. Comeau, G. Delespesse. 2007. Cutting edge: the ST2 ligand IL-33 potently activates and drives maturation of human mast cells. J. Immunol. 179: 2051-2054.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Chackerian, A. A., E. R. Oldham, E. E. Murphy, J. Schmitz, S. Pflanz, R. A. Kastelein. 2007. IL-1 receptor accessory protein and ST2 comprise the IL-33 receptor complex. J. Immunol. 179: 2551-2555.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Komai-Koma, M., D. Xu, Y. Li, A. N. McKenzie, I. B. McInnes, F. Y. Liew. 2007. IL-33 is a chemoattractant for human Th2 cells. Eur. J. Immunol. 37: 2779-2786.
    OpenUrlCrossRefPubMed
  11. ↵
    Ho, L. H., T. Ohno, K. Oboki, N. Kajiwara, H. Suto, M. Iikura, Y. Okayama, S. Akira, H. Saito, S. J. Galli, S. Nakae. 2007. IL-33 induces IL-13 production by mouse mast cells independently of IgE-FcεRI signals. J. Leukocyte Biol. 82: 1481-1490.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Humphreys, N. E., D. Xu, M. R. Hepworth, F. Y. Liew, R. K. Grencis. 2008. IL-33, a potent inducer of adaptive immunity to intestinal nematodes. J. Immunol. 180: 2443-2449.
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Hayakawa, H., M. Hayakawa, A. Kume, S. Tominaga. 2007. Soluble ST2 blocks interleukin-33 signaling in allergic airway inflammation. J. Biol. Chem. 282: 26369-26380.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Miller, A. M., D. Xu, D. L. Asquith, L. Denby, Y. Li, N. Sattar, A. H. Baker, I. B. McInnes, F. Y. Liew. 2008. IL-33 reduces the development of atherosclerosis. J. Exp. Med. 205: 339-346.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Dinarello, C. A.. 1998. Interleukin-1b, interleukin-18, and the interleukin-1b converting enzyme. Ann. NY Acad. Sci. 856: 1-11.
    OpenUrlCrossRefPubMed
  16. ↵
    Arend, W. P., G. Palmer, C. Gabay. 2008. IL-1, IL-18, and IL-33 families of cytokines. Immunol. Rev. 223: 20-38.
    OpenUrlCrossRefPubMed
  17. ↵
    Dinarello, C. A.. 1997. Interleukin-1. Cytokine Growth Factor Rev. 8: 253-265.
    OpenUrlCrossRefPubMed
  18. ↵
    Maelfait, J., E. Vercammen, S. Janssens, P. Schotte, M. Haegman, S. Magez, R. Beyaert. 2008. Stimulation of Toll-like receptor 3 and 4 induces interleukin-1β maturation by caspase-8. J. Exp. Med. 205: 1967-1973.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Carriere, V., L. Roussel, N. Ortega, D. A. Lacorre, L. Americh, L. Aguilar, G. Bouche, J. P. Girard. 2007. IL-33, the IL-1-like cytokine ligand for ST2 receptor, is a chromatin-associated nuclear factor in vivo. Proc. Natl. Acad. Sci. USA 104: 282-287.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Kuida, K., J. A. Lippke, G. Ku, M. W. Harding, D. J. Livingston, M. S. Su, R. A. Flavell. 1995. Altered cytokine export and apoptosis in mice deficient in interleukin-1β converting enzyme. Science 267: 2000-2003.
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Eisenbarth, S. C., D. A. Piggott, J. W. Huleatt, I. Visintin, C. A. Herrick, K. Bottomly. 2002. Lipopolysaccharide-enhanced, Toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med. 196: 1645-1651.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Kawakami, T., J. Kitaura. 2005. Mast cell survival and activation by IgE in the absence of antigen: a consideration of the biologic mechanisms and relevance. J. Immunol. 175: 4167-4173.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Talabot-Ayer, D., C. Lamacchia, C. Gabay, G. Palmer. 2009. Interleukin-33 is biologically active independently of caspase-1 cleavage. J. Biol. Chem. 284: 19420-19426.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Cayrol, C., J. P. Girard. 2009. The IL-1-like cytokine IL-33 is inactivated after maturation by caspase-1. Proc. Natl. Acad. Sci. USA 106: 9021-9026.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Luthi, A. U., S. P. Cullen, E. A. McNeela, P. J. Duriez, I. S. Afonina, C. Sheridan, G. Brumatti, R. C. Taylor, K. Kersse, P. Vandenabeele, et al 2009. Suppression of interleukin-33 bioactivity through proteolysis by apoptotic caspases. Immunity 31: 84-98.
    OpenUrlCrossRefPubMed
  26. ↵
    Tsutsui, H., N. Kayagaki, K. Kuida, H. Nakano, N. Hayashi, K. Takeda, K. Matsui, S. Kashiwamura, T. Hada, S. Akira, et al 1999. Caspase-1-independent, Fas/Fas ligand-mediated IL-18 secretion from macrophages causes acute liver injury in mice. Immunity 11: 359-367.
    OpenUrlCrossRefPubMed
  27. ↵
    Omoto, Y., K. Tokime, K. Yamanaka, K. Habe, T. Morioka, I. Kurokawa, H. Tsutsui, K. Yamanishi, K. Nakanishi, H. Mizutani. 2006. Human mast cell chymase cleaves pro-IL-18 and generates a novel and biologically active IL-18 fragment. J. Immunol. 177: 8315-8319.
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top

In this issue

The Journal of Immunology: 183 (12)
The Journal of Immunology
Vol. 183, Issue 12
15 Dec 2009
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Advertising (PDF)
  • Back Matter (PDF)
  • Editorial Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word about The Journal of Immunology.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Caspase-1, Caspase-8, and Calpain Are Dispensable for IL-33 Release by Macrophages
(Your Name) has forwarded a page to you from The Journal of Immunology
(Your Name) thought you would like to see this page from the The Journal of Immunology web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Caspase-1, Caspase-8, and Calpain Are Dispensable for IL-33 Release by Macrophages
Tatsukuni Ohno, Keisuke Oboki, Naoki Kajiwara, Eiichi Morii, Katsuyuki Aozasa, Richard A. Flavell, Ko Okumura, Hirohisa Saito, Susumu Nakae
The Journal of Immunology December 15, 2009, 183 (12) 7890-7897; DOI: 10.4049/jimmunol.0802449

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Caspase-1, Caspase-8, and Calpain Are Dispensable for IL-33 Release by Macrophages
Tatsukuni Ohno, Keisuke Oboki, Naoki Kajiwara, Eiichi Morii, Katsuyuki Aozasa, Richard A. Flavell, Ko Okumura, Hirohisa Saito, Susumu Nakae
The Journal of Immunology December 15, 2009, 183 (12) 7890-7897; DOI: 10.4049/jimmunol.0802449
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Disclosures
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

More in this TOC Section

  • Innate Immunity Together with Duration of Antigen Persistence Regulate Effector T Cell Induction
  • Regulatory Roles of IL-2 and IL-4 in H4/Inducible Costimulator Expression on Activated CD4+ T Cells During Th Cell Development
  • Induction of CD4+ T Cell Apoptosis as a Consequence of Impaired Cytoskeletal Rearrangement in UVB-Irradiated Dendritic Cells
Show more CELLULAR IMMUNOLOGY AND IMMUNE REGULATION

Similar Articles

Navigate

  • Home
  • Current Issue
  • Next in The JI
  • Archive
  • Brief Reviews
  • Pillars of Immunology
  • Translating Immunology

For Authors

  • Submit a Manuscript
  • Instructions for Authors
  • About the Journal
  • Journal Policies
  • Editors

General Information

  • Advertisers
  • Subscribers
  • Rights and Permissions
  • Accessibility Statement
  • FAR 889
  • Privacy Policy
  • Disclaimer

Journal Services

  • Email Alerts
  • RSS Feeds
  • ImmunoCasts
  • Twitter

Copyright © 2022 by The American Association of Immunologists, Inc.

Print ISSN 0022-1767        Online ISSN 1550-6606