A Novel Recombinant Fusion Protein Encoding a 20-Amino Acid Residue of the Third Extracellular (E3) Domain of CCR2 Neutralizes the Biological Activity of CCL2

Liat Izhak, Gizi Wildbaum, Yaniv Zohar, Rachel Anunu, Leah Klapper, Adi Elkeles, Jane Seagal, Eitan Yefenof, Michal Ayalon-Soffer and Nathan Karin
J Immunol July 1, 2009, 183 (1) 732-739; DOI: https://doi.org/10.4049/jimmunol.0802746

Abstract

CCL2 is a key CC chemokine that has been implicated in a variety of inflammatory autoimmune diseases and in tumor progression and it is therefore an important target for therapeutic intervention in these diseases. Soluble receptor-based therapy is a known approach for neutralizing the in vivo functions of soluble mediators. Owing to the complexity of seven-transmembrane G protein-coupled receptors, efforts to generate neutralizing soluble chemokine receptors have so far failed. We developed a strategy that is based on the generation of short recombinant proteins encoding different segments of a G protein-coupled receptor, and tested the ability of each of them to bind and neutralize its target chemokine. We show that a fusion protein comprised of as few as 20 aa of the third extracellular (E3) domain of the CCL2 receptor, stabilized by the IgG H chain Fc domain (E3-IgG or BL-2030), selectively binds CCL2 and CCL16 and effectively neutralizes their biological activities. More importantly, E3-IgG (BL-2030) could effectively suppress the in vivo biological activity of CCL2, attenuating ongoing experimental autoimmune encephalomyelitis, as well as the development of human prostate tumor in SCID mice.

Chemokines are small (∼8–14 kDa), structurally related proteins that regulate cell trafficking via interactions with a subset of seven-transmembrane G-coupled protein receptor (1, 2, 3, 4). CCL2 (MCP-1) is a key CC chemokine that participates in the regulation of inflammatory responses. CCL2 and its predominant receptor, CCR2, have been implicated in a variety of autoimmune diseases including multiple sclerosis (MS),3 rheumatoid arthritis, atherosclerosis, myocarditis, and others (5, 6, 7, 8). Its major role involves the recruitment of macrophages to sites of inflammation, initiating a cascade of events that leads to tissue destruction in chronic inflammatory diseases. We have previously shown that during experimental autoimmune encephalomyelitis (EAE), the murine model of MS, a T cell-mediated autoimmune disease of the CNS, autoantibodies to CCL2 that are capable of suppressing the disease are being produced, supporting the rational of developing CCL2 inhibitors for MS treatment (7).

Many studies have shown the importance of chemokines in tumor progression. Various chemokines are being produced by tumor cells, which also express their cognate receptors (for a general review see Ref. 9). Functionally, they are likely to direct tumor progression, angiogenesis, and survival. Cancer of the prostate is the most common cancer in American males, and the second leading cause of cancer-related mortality (10, 11). The three major chemokines produced by human prostate cancer cells that also express their target receptors are CXCL12 (SDF-1α), CXCL8 (IL-8), and CCL2 (MCP-1) (12, 13, 14, 15, 16, 17, 18). These chemokines are likely to promote tumor development and angiogenesis (12, 13, 14, 15, 16, 17, 18). Thus far, most of the attention has focused on the role of CXCL12, which is likely to be the key chemokine that attracts these cells to the bones (19, 20, 21, 22, 23, 24). Interestingly, CCL2 became a major target of interest in a few recent reports showing that 1) in humans, CCR2 expression was correlated with the Gleason score and clinical pathologic stages, whereas lower levels of CCR2 were expressed in normal prostate tissues (25), 2) CCL2 is a potent regulator of prostate cancer cell migration and proliferation (12), 3) CCL2 acts as a paracrine and an autocrine factor for prostate cancer growth and invasion (13), and 4) CCL2 is involved in recruiting macrophages that assist tumor development (12, 14). These areas of interest have motivated us to select the third extracellular (E3) domain of the CCL2 receptor, stabilized by the IgG H chain Fc domain (E3-IgG) as a potential candidate for therapy of this disease.

Its pivotal role in cancer and autoimmunity has made CCL2 an attractive target for therapy. We have focused on developing a soluble receptor-based approach for inhibiting CCL2. Previous studies have shown that CCR2 binds its ligand CCL2 via the N-terminal region alone (26), or the N-terminal region combined with the third extracellular loop (E3 domain) element (27). We show in this study that a fusion protein, encoding 20 aa of the E3 domain, selectively binds and neutralizes CCL2 as effectively as a recombinant protein composed of the E3 domain fused to the N-terminal region. We then explored, for the first time, how in vivo neutralization of CCL2 with this compound affects the development of cancer of the prostate, as well as the manifestation of ongoing EAE in C57BL/6 mice.

Materials and Methods

Construction of soluble receptors

Human and mouse cDNA encoding the constant region (Fc, Hinge-CH2-CH3) IgG1 were constructed as follows: human Fc was generated by RT-PCR on RNA extracted from human PBMC that was cultured for 4 days with LPS and IL-4. The primers used for this reaction were 5′-ctcgagCCCAAATCTTGTGACAAAAC and 3′-gggcccTTTACCCGGGGACAGGGAGA (AF237583). The mouse Fc was extracted from Con A-stimulated spleen cells and the primers were 5′-ccgCCGCTCGAGGTGCCCAGGGATTGTGGTTG and 3′-gaacaaTTGTTCGGGCCCTTTACCAGGAGAGTGGGAGA (L35037).

The PCR products were digested with XhoI and ApaI and ligated into mammalian expression/secretion vector pSecTag2/Hygro B (Invitrogen Life Technologies). A different set of primers, 5′ (sense) and 5′ (antisense), were used to generate cDNA encoding the different human (NM000647) (28) and mouse (NM009915) (29) domains of CCR2 from the PC-3 and the TRAMP mouse C-1 cell line (30), respectively. The cDNA encoding the human CXCR4 (NM001008540) (31) was obtained from the PC-3 line. Primers were designed as follows: human CCR2 N terminus 5′-CCCAAGCTTATGCTGTCCACATCTCGTTCTCGGTT and 3′-CCGCTCGAG TGGGCCCCAATTTGCTTCACGTCAA; human CCR2-E1 5′-CCCAAGCTTTCTGCTGCAAATGAGTGGGT and 3′-CCGCTCGAGTTTGCACATTGCATTCCCAA; human CCR2-E2 5′-CCCAAGCTTACTAAATGCCAGAAAGAAGA and 3′-CCGCTCGAGTGTGTGGAAATTATTCCATC; human CCR2-E3 5′-CCCAAGCTTAACACCTTCCAGGAATTCTTCGGCCT and 3′-CCGCTCGAGTTGGTCCAGTTGACTGGTGCTTTCAC; human CXCR4 N terminus 5′-CCCAAGCTTTGGAGGGGATCAGTATATACACTTC and 3′-CCGCTCGAGATTTTATTGAAATTAGCATTTTCTTC; mouse CCR2 N terminus 5′-CCAAGCTTATGGAAGACAATAATATGTTAC and 3′-CCGCTCGAGCACACTGGTTTTATGACAAGGC; and mouse CCR2-E3 5′-CCCAAGCTTGAATCCTTGGGAATGAGTAACTGT and 3′-CCGCTCGAGTCCAAGAGTCTCTGTCACCTGCAT.

The constant region of the human Fc, (Hinge-CH2-CH3) alone (Ig) was also cloned and used later as a control for BiaCore analysis (see Fig. 3A). Each PCR product was digested with HindIII and XhoI and subcloned into the vector containing the human/mouse (h/m) IgG1 fragment. Each fused fragments was sequenced by dideoxynucleotide sequencing at our facility (Sequenase version 2; Upstate Biotechnology).

Expression and purification of fusion proteins

Expression and purification of the various fusion proteins was done using CHO dhfr−/− (DG44) cells provided by Dr. L. Chasin (Columbia University, New York, NY) according to the method described in detail (32). The fusion protein was expressed as a disulfide-linked homodimer similar to IgG1, and it was purified from the culture medium by the High-Trap protein G affinity column (BD Biosciences).

Evaluation of the affinity of E3-IgG to CCL2 by surface plasmon resonance

E3-IgG affinity to CCL2 was determined by BIAcore analysis, using the biosensor BIAcore 3000. CCR2-IgG or Fc, as a negative control, were immobilized directly to CM5 chip (100 μg/ml in 10 mM acetate (pH = 4)) using amine coupling kit (BIAcore) to reach up to 2500 response units binding level. All subsequent binding experiments were performed in HBS (0.01 M HEPES (pH = 7.4), 0.15 M NaCl, 3.4 mM EDTA, and 0.005% Tween 20 at 25°C). CCL2 (R&D Systems) was used in concentrations ranging from 94 to 1500 nM and a flow rate of 30 μl/min. The surface was regenerated back to baseline level by injecting 10 μl of 100 mM NaOH. For binding kinetics, BIA-evaluation (version 4.1 software; BIAcore) was applied, and the 1:1 Langmuir binding model was chosen.

Production of anti-human CCL2 mAb

BALB/c mice were administered 50 μg of human (h)CCL2 in CFA, followed by six injections every 3 wk, of 50 μg of hCCL2 in IFA. Splenocytes were isolated and fused with NSO myeloma cells by standard procedures (33). Hybridoma supernatants were first screened for their ability to bind hCCL2 by using an ELISA immunoassay. Selected clones were then tested for their binding specificity by Western blotting using different chemokines (PeproTech), and for their in vitro ability to inhibit CCL2-induced migration of the human monocyte cell line THP-1 in a Transwell system (Corning; Costar). Our anti-CCL2 mAb selectively binds and neutralizes human CCL2 with low cross-reactivity to its mouse counter molecule.

Evaluation of the affinity of our anti-hCCL2 mAb to CCL2

The evaluation of the affinity of our anti-hCCL2 mAb to CCL2 was conducted by indirect competitive ELISA (34). Briefly, microtiter plates were coated with recombinant CCL2 (dilution 1/10,000, 200 μl/well). After overnight incubation at 4°C the plates were washed three times with washing buffer, blocked with 1% BSA in PBS (w/v, 250 μl/well), and incubated for 20 min. To titrate mAb affinity, a mixture of 100-2000 ng/100 μl of unlabelled mAbs and 100,000 cpm of 125I-labeled mAb was added to each well for 90 min at room temperature. Wells were washed three times and radioactivity was counted in a gamma counter.

Cytokine/chemokine detection by ELISA

The specificity binding of the soluble receptors was detected by an ELISA as follows: each well was coated with 10 ng of either mouse or human proteins, respectively—CCL2, CCL4, CCL5, CCL7, CCL7, CCL8, CCL13, CCL11, CCL16, CCL19, CCL20, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, XCL1, IL-1β, CD40L (PeproTech) using coating buffer (PBS X1), and incubated at 4°C overnight. Wells were incubated with 200 μl of 1% BSA/PBS blocking buffer for 1 h at room temperature. Soluble chemokine receptors were added (50 μg/ml) in 1% BSA/PBS buffer (50 μl per well) and incubated overnight at 4°C and washed four times with PBS/Tween 20 (0.05%). Then 50 μl of goat anti-human IgG-HRP (Jackson ImmunoResearch) was added at 1/10,000 in 1% BSA/PBS for 1 h and washed four times with PBS/Tween 20 (0.05%). The substrate solution (tetramethylbenzidine) was then added at 50 μl/well. When a blue color appeared, the reaction was terminated by adding 50 μl of H2SO4 (1 M). OD was determined at 450 nm with the reference filter set to 620 nm.

Chemokine detection in sera by ELISA

Detection of mouse CCL2 was done by ELISA development kit (Mouse CCL2/JE ELISA kit; R&D Systems) and conducted according to the manufacturer’s instruction.

In vitro chemotaxis assays

Chemotaxis assays in which the chemokine-induced migration of monocyte cell lines (THP-1 and RAW 264.7 cells, 1 × 106) were determined, were performed in a Transwell system (5-μm pore size, Corning; Costar). Chemotaxis assays in which the chemokine-induced migration of PC-3 cells (1 × 106) were conducted using the CytoSelect cell migration assay (8-μm pore size; Cell Biolabs. Briefly, cells were loaded into the upper chamber of the two systems. The lower chambers were loaded with 20 ng/ml chemokines (h/m CCL2, h/m CCL7, h/m CCL8, h/m CCL11, hCCL16, hCCL13, mCCL12; PeproTech) and 50 μg/ml soluble receptors (h/m E3-Ig) or Abs. Cells were let to migrate for 2 h under a humidified 7.5% CO2 atmosphere at 37°C. The content of the lower chambers was collected and counted using the FACSCalibur (BD Biosciences). The chemotaxis index was then calculated by dividing the number of migrating cells in the presence of chemoattractant by the number of cells migrated in its absence.

Evaluation of IC50

Chemokine-induced cell migration was assessed using 5-μm pore Transwell filter membranes (Costar). A total of 1 × 106 THP-1, or RAW 264.7 cells, were loaded into each Transwell filter. Soluble receptors (h/m E3-Ig) or mAbs (our anti-hCCL2 mAb and commercial anti-mCCL2 mAb; R&D Systems) were added in the lower chamber at different concentrations (0.01–100 μg/ml) with 20 ng/ml CCL2. Plates were then incubated at 37°C for 2 h. The migrated cells were collected and counted by FACSCalibur (BD Biosciences). The IC50 calculation was performed by Origin8 software (OriginLab).

In vitro proliferation assay

A total of 1 × 104 PC-3 cells were cultured in 96-well flat-bottom tissue culture plates in their respective medium. After 24 h, wells were supplemented with fresh medium, 200 μg/ml neutralizing Abs, 200 μg/ml soluble receptors, or 200 μg/ml total IgG from preimmune mice. Cells were cultured in the presence and absence of these supplements for 5 days. Each well was pulsed with 2 μCi of thymidine (specific activity 10 Ci/mmol) for the final 16 h. The cultures were then harvested on fiberglass filters. Results are shown as the mean cpm of six replicates ± SE from three independent experiments, divided by the mean cpm of control cells.

Animal models

An animal model of EAE used C57BL/6 female mice purchased from Harlan Laboratories and maintained in independent ventilated cages under pathogen-free conditions. At 6 wk of age, mice were subjected to active disease induction by a single administration of MOG33–55 emulsified in CFA as described elsewhere (35). At the onset of disease only mice with an apparent clinical manifestation of disease were selected and separated into equally sick groups for therapy. Animals were then monitored for clinical signs daily by an observer blind to the treatment protocol. EAE was scored as follows: 0, clinically normal; 1, flaccid tail; 2, hind limb paralysis; 3, total hind limb paralysis, accompanied by an apparent front limb paralysis; and 4, total hind limb and front limb paralysis.

The animal xenograft model of prostate cancer used SCID/Beige male mice purchased from Harlan Laboratories and maintained in independent ventilated cages under pathogen-free conditions. At 6 wk of age, mice were s.c. injected between the two flanks with 5 × 106 PC-3 cell line (American Type Culture Collection). Mice were monitored daily for tumor volume. Tumor diameters were measured using a caliper. Tumor volume was calculated using the formula π/6 × a × b2, where a is the longest dimension, and b is the width.

Histology

Spinal cords were subjected to histology analysis. Briefly, tissue samples were fixed overnight in 4% paraformaldehyde in PBS, then dehydrated, paraffin-embedded, and sectioned into 5-μm sections. Sections were then deparaffinized and stained with H&E and with Luxol fast blue.

Statistical analysis

The significant difference was examined using Student’s t test. Values for p < 0.05 were considered statistically significant.

Results

A fusion protein encoding 20 aa of the E3 domain selectively binds CCL2 and neutralizes its biological function

In attempt to identify the CCL2 binding site on CCR2, we have cloned the first, second, and third extracellular loops of human CCR2 (E1, E2, and E3, respectively), as well as its N-terminal region and generated four different fusion proteins stabilized by human Ig (Fc) as follows: E1-Ig, E2-Ig, E3-Ig, and N-terminal region Ig. We have also generated a fusion protein encoding E3 and the N-terminal region of human CCR2 together. Fig. 1⇓ shows the domain structure of CCR2, a schematic view of the related constructs we have generated (Fig. 1⇓A) and the SDS-PAGE analysis of the resulted proteins (Fig. 1⇓B). As control fusion proteins, we have cloned the N-terminal region of human CXCR4 and fused it to Ig. Our working hypothesis has been that the N-terminal region alone or in combination with the E3 domain would bind CCL2. We have therefore compared the CCL2 binding properties of each of our fusion proteins. Fig. 1⇓C shows that of all fusion proteins the E3 domain, the N-terminal domain, or their fusion (E3-N-terminal) bind CCL2, with the first two exhibiting a slightly higher binding (OD450 nm 0.96 ± 0.1 and 0.92 ± 0.08, compared with 0.74 ± 0.06, p < 0.001).

FIGURE 1.
FIGURE 1.

CCR2 domain E3 binds CCL2 independently of the N-terminal domain of the receptor. A, Schematic presentation of CCR2 domain structure and the related constructs encoding the cloned human CCR2-Ig fusion proteins. B, SDS-PAGE analysis of the different CCR2-Ig fusion proteins shown in a Coomassie blue staining, under reducing and nonreducing conditions: N-terminal, E2, E1, E3, and E3 plus N-terminal under reducing (+2-ME) and nonreducing (−2-ME) conditions. C, Comparative analysis of CCL2 binding to human CCR2-Ig fusion proteins and human CXCR4-Ig (N-terminal region) as determined by ELISA: E1 of human CCR2 (E1-Ig), E2 of human CCR2 (E2-Ig), E3 of human CCR2 (E3-Ig), the E3-N-terminal region-Ig of human CCR2 (E3+N-Ig), the N-terminal region of human CCR2 (N-Ig), and the N-terminal region-Ig of human CXCR4 (CXCR4-Ig). Results are shown as mean triplicates ± SE.

Fig. 2⇓A shows the ability of each domain to inhibit the CCL2-induced migration of THP-1 cells. In these recombinant fusion proteins, the E3 domain alone (E3-Ig or BL-2030) not only could significantly inhibit CCL2-induced migration of THP-1 cells (chemotaxis index of 1.32 ± 0.2 compared with 14.34 ± 1.5, p < 0.001) but could also do so better than each of the other fusion proteins, including the E3-N-terminal fusion (chemotaxis index of 1.32 ± 0.2 vs 5.9 ± 0.6, p < 0.01). Human CCR2 binds multiple chemokines, including CCL2, CCL8, CCL16, CCL7, CCL11, and CCL13. We have determined the ability of human E3-Ig to inhibit the migration of THP-1 cells induced by each of these chemokines, as well as its direct binding to each of them (ELISA). Our observations clearly show that of these chemokines, E3-Ig (BL-2030) selectively inhibits THP-1-induced migration of two only of them: CCL2 and CCL16. It also exclusively binds both chemokines (Fig. 2⇓C). Its ability to block CCL2-induced migration is significantly higher than to inhibit CCL16-induced chemotaxis under the same conditions (Fig. 2⇓B, p < 0.01).

FIGURE 2.
FIGURE 2.

Human CCR2 E3-Ig selectively binds CCL2 and CCL16 and inhibits their chemokine-induced migration. A, Inhibition of CCL2-induced chemotaxis of THP-1 cells by CCR2-based fusion proteins. The chemotaxis index of THP-1 cells was determined in the absence or presence of 20 ng/ml CCL2 and 50 μg/ml soluble domains. Results are shown as mean triplicates ± SE. B, THP-1 cells were tested for their ability to migrate toward additional natural ligands of CCR2 (20 ng/ml each) in the presence of 50 μg/ml hE3-Ig. Results are shown as mean triplicates ± SE. C, Comparative analysis of E3-Ig binding to different recombinant human chemokines, and to CD40L and IL-1β, in comparison to CCL2 and anti-CCL2 Ab (ELISA). Results are shown as mean triplicates ± SE.

E3-Ig exerts lower affinity to CCL2 in comparison to mAb, yet effectively and selectively suppresses the biological activities of CCL2

The binding affinity of E3-Ig to recombinant CCL2 was determined using the BiaCore technology. As shown in Fig. 3⇓A, E3-Ig exhibited specific binding to CCL2 compared with human Fc, which did not show any binding to CCL2, with a calculated affinity of 2.02 × 10−7 M. The binding affinity of our anti-CCL2 mAb, determined as described in Materials and Methods, is 6.5 × 10−9 M, which is ∼300-fold higher than E3-Ig. We then examined for each of them the IC50 required for the inhibition of CCL2-induced migration of THP-1 cells. Fig. 3⇓B shows a dose-dependent inhibition assay for both CCL2 inhibitors, showing that although E3-Ig exhibits low affinity to CCL2, its CCL2 neutralization activity was comparable with the high affinity anti-CCL2 Ab (IC50 of 2 μg/ml compared with 2.5 μg/ml, respectively).

FIGURE 3.
FIGURE 3.

Despite low binding affinity to CCL2 E3-Ig effectively neutralizes chemotaxis induced by this chemokine. A, BiaCore analysis (a) of of E3-Ig binding to CCL2 (left). KD (2.02E-07) for CCL2 binding of CCR2-IgG immobilized on a CM-5 sensor chip was determined by surface plasmon resonance. The concentration range of CCL2 was 94–1500 nM in five serial dilutions. Data are presented as real-time graphs of response units (RU) against time and were analyzed using a 1:1 Langmuir model. B, Dose-dependent Inhibition of CCL2-induced chemotaxis of THP-1 cells by E3-Ig compared with anti-CCL2 Ab. The chemotaxis index for THP-1 cells was determined in the presence of 20 ng/ml CCL2 and different concentrations of hE3-Ig, anti-hCCL2, or control human IgG1. Results are shown as mean triplicates ± SE.

E3-Ig suppresses ongoing EAE in C57BL/6 mice

We have then cloned the reciprocal E3 domain of murine CCR2, and constructed the murine E3-Ig fusion protein. In murine CCR2 binds CCL2, CCL8, CCL7, CCL11, CCL12, and CCL13 (CCL16 is a human chemokine). The ability of murine E3-Ig to bind and inhibit chemokine-induced migration of the mouse monocytic cell line (RAW 264.7) in response to each of these chemokines was determined. Our observations clearly show that of these chemokines mE3-Ig exclusively inhibits the CCL2-induced migration of RAW 264.7 cells (Fig. 4⇓A). It also solely binds this chemokine (Fig. 4⇓B). We then examined the IC50 required for the inhibition of murine CCL2-induced migration of RAW 264.7, according the protocol used in Fig. 2⇑B. Our results show that the IC50 of murine E3-Ig (5.2 μg/ml) is comparable to the commercially available control mAb (clone 123616; R&D Systems) (Fig. 4⇓C), which is 4.7 μg/ml.

FIGURE 4.
FIGURE 4.

E3-Ig selectively binds and neutralizes murine CCL2 and suppresses ongoing EAE in C57BL/6 mice. A, The monocytic cell line (RAW 264.7) was tested for its ability to migrate toward additional natural ligands of CCR2 (20 ng/ml each) in the presence of 50 μg/ml mE3-Ig. Results are shown as mean triplicates ± SE. B, Murine E3-Ig was determined for its binding specificities to various chemokines. Results of triplicates are shown as mean OD at 450 nm ± SE. C, Dose-dependent inhibition of CCL2-induced chemotaxis of RAW 264.7 cells by mE3-Ig compared with anti-CCL2 mAb. The chemotaxis index for RAW 264.7 cells was determined in the presence of 20 ng/ml CCL2 and different concentrations of either mE3-Ig or anti-mCCL2. Results are shown as mean triplicates ± SE. D, C57BL/6 mice were subjected to active induction of EAE. Following disease onset (day 15) mice were treated (every 3 days) with 200 μg/mouse of E3-Ig (▪), control mouse IgG1 (○), or PBS (▴) and monitored for disease progression by an observer blind to the experimental protocol. Results of six mice/group are shown as mean EAE score ± SE. E, H&E (a, b, and c), or Luxol fast blue (d, e, and f) staining of spinal cord samples from mice treated with PBS (a and d), control IgG (b and e), and E3-Ig (c and f) at a magnification of ×20.

Although mice lacking CCL2 displayed markedly reduced EAE (5), there is a dispute whether its targeted neutralization in wild-type rodents suppresses the disease (6, 7, 36). Based on its high specificity in binding and neutralization of CCL2 we have explored the ability of E3-Ig to interfere in the regulation of ongoing EAE in C57BL/6 mice.

These mice were subjected to active induction of EAE and, following the onset of disease (day 15), treated (every 3 days) with 200 μg/mouse of E3-Ig, control mouse IgG1, or PBS and monitored for disease progression by an observer blind to the experimental protocol (Fig. 4⇑D). We show that administration of E3-Ig (BL-2030) rapidly suppresses EAE (mean maximal score of 1.3 ± 0.2, compared with 3 ± 1.2 and 3.3 ± 0.9 in PBS or control IgG treated mice, respectively, p < 0.01). At the peak of disease, representative mice were sacrificed, and lumbar spinal cords were subjected to histological analysis. Fig. 4⇑D shows the results of representative sections (of 18 sections per group), showing a marked decrease in leukocyte infiltrate around HEV of mice treated with E3-Ig but not with control IgG or PBS. A complementary Luxol fast blue staining was conducted to verify that recovery is associated with reduction in demyelination that occurs during EAE in C57BL/6 mice (Fig. 4⇑E). Thus, E3-Ig (BL-2030) effectively suppresses an ongoing EAE disease. Finally, We have measured the levels of CCL2 in circulating blood 1 day after the second mE3-Ig administration during EAE (Fig. 4⇑D). We identified an 1.8-fold increase in CCL2 levels in the circulation of treated mice (57.15 ± 6.1 ng/ml in E3-Ig-treated mice compared with 30.1 ± 4.2 ng/ml in PBS-treated mice.

E3-Ig inhibits the proliferation and CCL-2 induced migration of PC-3 cells in vitro

Three human prostate cancer cell lines are commonly used in xenograft experiments: LNCaP, an androgen-dependent cell line derived from a patient’s lymph node, and DU-145 and PC-3, both androgen-independent cell lines, derived from brain and bone metastases, respectively. Of these lines, PC-3 is the most aggressive (37) and has therefore been selected for our in vivo xenograft studies. After verification of CCR2 expression (FACS analysis, data not shown), we tested whether hE3-Ig would affect CCL2-induced migration of PC-3 cells in vitro (Fig. 5⇓A). We show that hE3-Ig effectively blocks CCL2-induced chemotaxis of PC-3 cells (chemotaxis index of 3.16 ± 0.2 vs 10.3 ± 0.09, p < 0.01), and that the migration of these cells is directed via the CCL2-CCR2 interaction (Fig. 5⇓A). An anti-CCR2 mAb (38) provided by Dr. C. Martinez-A (Centro Nacional de Biotecnologia, Universidad Autonoma de Madrid, Madrid, Spain) also effectively suppressed CCL2-induced migration of these cells (chemotaxis index of 2.6 ± 0.2 vs 10.3 ± 1.4, p < 0.01) (Fig. 5⇓A). We then determined the ability of this soluble receptor to inhibit the proliferation/growth of PC-3 cells. As shown in Fig. 5⇓B, addition of E3-Ig to cultured PC-3 cells significantly reduced the proliferation of these cells (41 ± 2.4 × 103 cpm vs 100 ± 8.7 × 103 cpm, p < 0.01). Similar results were obtained using the anti-CCR2 mAb (28 ± 1.9 × 103 cpm vs 100 ± 8.5 × 103 cpm, p < 0.01).

FIGURE 5.
FIGURE 5.

Human E3-Ig inhibits the proliferation and CCL2-induced migration of PC3 cells. A, Human E3-Ig inhibits CCL2-induced migration of PC-3 cells as determined by the CytoSelect cell migration assay. Results are shown as mean triplicates ± SE. Add amount of CCL2. B, Human E3-Ig inhibits PC-3 cell proliferation. The 96-well tissue culture plates were loaded with 1 × 104 PC-3 cells and cultured in the presence of culture medium, control IgG, anti-CCR2 mAb, and hE3-Ig. All gene products including control IgG, all mAbs, and E3-Ig were isotype matched (IgG1). Results are shown as mean of [3H] uptake of triplicates ± SE.

E3-Ig inhibits tumor growth in a prostate cancer xenograft model

Next, we explored the ability of hE3-Ig to suppress the growth of PC-3 in SCID/Beige mice. Briefly, mice were implanted with 5 × 106 PC-3 cells and beginning on day 7, when tumors were clearly identified in all animals, were treated (twice a week) with PBS, isotype-matched IgG1, or 50, 100, or 200 μg/mouse of hE3-Ig and monitored for tumor growth (Fig. 6⇓). Our results clearly show a dose-dependent blockade of primary tumor growth in E3-Ig-treated mice (tumor size at day 40, 1550 mm3 ± 123.7 and 2020 mm3 ± 134.8 in control groups, compared with 90.5 mm3 ± 26.1 and 505 mm3 ± 91.1 in those treated with 200 and 100 μg of E3-Ig, respectively, p < 0.001). Most importantly, E3-Ig inhibitory effect was still observed 15–35 days following treatment termination, hinting to its therapeutic potential as anticancer agent.

FIGURE 6.
FIGURE 6.

Human E3-Ig inhibits the development of primary tumor in PC3 prostate cancer xenograft model. A, SCID/Beige mice (six mice/group) were implanted with 5 × 106 PC-3 cells and were treated twice a week, starting from day 7, with either PBS (▴), isotype-matched IgG1 (▪), 50 μg/mouse (○), 100 μg/mouse (▵), or 200 μg/mouse (•) of hE3-Ig. Mice were monitored for the progression of the primary tumor until sacrificed on day 40. In the 100 and 200 μg/mouse groups, treatment was terminated on day 34 and mice were then monitored for tumor growth until tumors reached the volume of 1000 mm3 (day 54 for 100 μg/mouse group and day 68 for 200 μg/mouse group). Data presented represent one of three independent experiments with similar data. Results are shown as mean tumor volume ± SE. B, SCID/Beige mice (six mice/group) were implanted with 5 × 106 PC-3 cells and were treated twice a week, starting from day 7, with either PBS (▪), isotype-matched IgG1 (□), 200 μg/mouse anti-CCL2 (▵), or 200 μg/mouse E3-Ig (•). Mice were monitored for the progression of the primary tumor using a caliper. Data presented represent one of three independent experiments with similar data. Results are shown as mean tumor volume ± SE.

After determining the dissociation constant (Kd) and neutralizing activity (IC50) of our anti-human CCL2 mAb in comparison to hE3-Ig (Fig. 3⇑), we have compared their ability to suppress the growth of human prostate cancer cell line (PC-3) in SCID mice. It has been previously shown that in this xenograft model even though both the murine and tumor-derived CCL2 contribute to tumor development, targeted neutralization of the human-derived chemokine markedly suppresses tumor development (14). Our results clearly show that under the same experimental conditions, both equally very effectively suppressed tumor development (Fig. 6⇑B) despite the major difference in anti-human CCL2 mAb in comparison to hE3-Ig binding affinity to CCL2 (∼300-fold higher for the Ab).

Discussion

In this study, we describe a novel recombinant soluble form of the CCL2 receptor, E3-Ig (BL-2030). We have shown that E3-Ig selectively binds CCL2 and neutralizes its biological activity, mainly the chemotaxis of human monocytes in vitro. In addition, it inhibits the proliferation and migration of the human prostate cancer cell line PC-3 that expresses CCL2 and its receptor. The in vivo activity of E3-Ig was demonstrated in two separate disease models in which the CCL2-CCR2 pathway was shown to play a role, the EAE model of MS and the PC-3 prostate cancer model. E3-Ig (BL-2030) significantly suppressed ongoing EAE disease and exhibited dose-dependant inhibition of PC-3 tumor growth. The inhibition of PC-3 cell proliferation and migration in vitro together with the suppression of tumor growth in vivo indicate an anti-tumorigenic and anti-metastatic potential of E3-Ig. In support of our results, a previous study has demonstrated that an anti-CCL2-neutralizing Ab attenuates tumor burden in the PC-3 prostate cancer model (14).

Chemokine receptors belong to the superfamily of seven-transmembrane G protein-coupled receptors (2) that span the plasma membrane seven times generating three loops (domains). Their three-dimensional structure is dependent on plasma-membrane stabilization, and therefore the generation of soluble chemokine receptors that are highly effective in neutralizing their target chemokines is still a major challenge. In an attempt to overcome this obstacle, we generated short recombinant proteins encoding different segments of the G protein-coupled receptor CCR2, and tested their ability to bind and neutralize its target chemokine CCL2. We show that although both the E3 domain and the N terminus of CCR2 bind CCL2, only the E3 domain alone, or in combination with the N-terminal region, neutralizes the basic biological activity of CCL2; chemoattraction of monocytes. Surprisingly, the E3 domain alone comprising only 20 aa of CCR2 (fused to Ig) was the most effective inhibitor of CCL2-induced chemotaxis in vitro.

Neutralizing mAbs and soluble receptor-based fusion proteins were shown to be effective in the treatment of autoimmune diseases and cancer. Use of anti-TNF-α mAbs and recombinant soluble TNF-α receptor fusion proteins is a classical example of successful treatment of rheumatoid arthritis and other related autoimmune diseases (39, 40, 41). One of the major disadvantages of mAb-based therapies is their tendency to elicit anti-idiotypic neutralizing Abs, as a part of a natural regulatory network (42). From this perspective, soluble receptors have a therapeutic advantage. The CCL2/CCR2 axis has been implicated in the pathophysiology of a wide range of both acute and chronic inflammatory conditions, such as rheumatoid arthritis, MS, atherosclerosis, uveitis, asthma, psoriasis, diabetes, inflammatory bowel disease, lupus nephritis, transplant rejection, and several CCL2/CCR2 antagonists are currently under clinical development.

The role of CCL2 in EAE has been studied by either using deficient mice, or by administering anti-CCL2 polyclonal Abs to EAE in mice or rats. Izikson et al. (43) showed that mice lacking CCR2 are EAE-resistant. Nevertheless, at least six different chemokines bind CCR2, therefore other chemokines, aside of CCL2, might contribute to EAE resistance in CCR2-deficient mice as demonstrated in that study. A complementary publication of Huang et al. (5) showing that mice lacking CCL2 display a markedly reduced form of disease, further emphasizes the pivotal role of CCL2 in the pathogenesis of EAE. Thus far the evidence that targeting CCL2 alone, in wild-type rodents suppresses EAE emerged from studies that used polyclonal Ab-based therapies, with their limitations. There is a dispute in these studies whether targeted neutralization of CCL2 in wild-type rodents suppresses the disease (6, 7, 36). We show in this study that in C57BL/6 EAE mice injection of E3-Ig, that specifically and exclusively binds and neutralizes CCL2 (Fig. 4⇑, A–C), effectively suppressed an ongoing disease (Fig. 4⇑, D and E) further implies that this chemokine plays a pivotal role in EAE, as previously demonstrated in mice lacking CCL2 (5).

It has been reported that administration of anti-CCL2 mAbs to patients suffering from rheumatoid arthritis led to a 2000-fold increase in their circulating CCL2 (44), which may explain, in part, why therapy was ineffective. In the current study we show that repeated administration of E3-Ig only moderately increased circulating blood levels CCL2 (1.8-fold increase). It is possible that in human therapy with E3-Ig would also result in a moderated increase in circulating CCL2. This effect would be a major advantage to the recipients, though this feature has yet to be carefully detected along clinical trails.

In addition of being a key regulator of monocytes infiltration to sites of inflammation, CCL2 was shown to possess protumorigenic and proangiogenic functions. The mechanisms by which CCL2 promotes tumor progression are still unclear. CCL2 is primarily responsible for the recruitment of tumor infiltrating macrophages into the tumor site, stimulating angiogenesis and metastasis. In addition, CCL2 has been shown to have direct effects on the tumor cells in several neoplasms including breast, lung, cervix, ovary, sarcoma, and prostate, inducing cancer cell proliferation, migration, and survival.

We clearly show that E3-Ig well suppresses the establishment of human tumor cells in SCID mice. Our human E3-Ig (BL-2030) binds and neutralizes both CCL2 and CCL16 (Fig. 2⇑). Human cancer cells produce both chemokines (9). CCL16 is also likely to contribute to tumor invasion and angiogenesis (45). Therefore it could be that its neutralization by BL-2030 also contributes to tumor suppression in a xenograft model of cancer (Fig. 6⇑).

E3-Ig (BL-2030) represents a novel approach for inhibiting CCL2. Its potent anti-tumorigenic effect, together with its anti-inflammatory activity, suggests a therapeutic potential for the treatment of autoimmune disease, as well as various malignancies. Further studies exploring the therapeutic potential of E3-Ig in additional inflammatory disease models and various cancer models are required.

Disclosures

N.K., L.I., G.W. and Y.Z. hold a pending patent on therapy of inflammatory autoimmunity and cancer using CCL2 E3-Ig that has been licensed out to BiolineRx. L.K., M.A.-S., and A.E. are research scientists at BiolineRX and preformed part of the in vitro analysis within the manuscripts and also participate in discussing the results.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 This study was supported by grants from the Israel Science Foundation, the Israel Ministry of Health Chief Scientist, and a sponsored research grant from the Israel Ministry of Industry, together with BiolineRx.

  • ↵2 Address correspondence and reprint requests to Dr. Nathan Karin, Bruce Rappaport Faculty of Medicine, Technion, Rappaport Family Institute for Research in the Medical Sciences, PO Box 9697, Haifa 31096, Israel. E-mail address: nkarin{at}tx.technion.ac.il

  • ↵3 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental autoimmune encephalomyelitis.

  • Received August 20, 2008.
  • Accepted May 4, 2009.

References

  1. ↵
    Rollins, B. J.. 1997. Chemokines. Blood 90: 909-928.
    OpenUrlFREE Full Text
  2. ↵
    Zlotnic, A., O. Yoshei. 2000. Chemokines: a new clasification system and their role in immunity. Immunity 12: 121-127.
    OpenUrlCrossRefPubMed
  3. ↵
    Mackay, C. R.. 2001. Chemokines: immunology’s high impact factors. Nat. Immunol. 2: 95-101.
    OpenUrlCrossRefPubMed
  4. ↵
    Proudfoot, A. E.. 2002. Chemokine receptors: a multifaceted therapeutic targets. Nat. Rev. Immunol 2: 106-115.
    OpenUrlCrossRefPubMed
  5. ↵
    Huang, D. R., J. Wang, P. Kivisakk, B. J. Rollins, R. M. Ransohoff. 2001. Absence of monocyte chemoattractant protein 1 in mice leads to decreased local macrophage recruitment and antigen-specific T helper cell type 1 immune response in experimental autoimmune encephalomyelitis. J. Exp. Med. 193: 713-726.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Kennedy, K. J., R. M. Strieter, S. L. Kunkel, N. W. Lukacs, W. J. Karpus. 1998. Acute and relapsing experimental autoimmune encephalomyelitis are regulated by differential expression of the CC chemokines macrophage inflammatory protein-1α and monocyte chemotactic protein-1. J. Neuroimmunol. 92: 98-108.
    OpenUrlCrossRefPubMed
  7. ↵
    Youssef, S., G. Wildbaum, G. Maor, N. Lanir, A. Gour-Lavie, N. Grabie, N. Karin. 1998. Long-lasting protective immunity to experimental autoimmune encephalomyelitis following vaccination with naked DNA encoding C-C chemokines. J. Immunol. 161: 3870-3879.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Goser, S., R. Ottl, A. Brodner, T. J. Dengler, J. Torzewski, K. Egashira, N. R. Rose, H. A. Katus, Z. Kaya. 2005. Critical role for monocyte chemoattractant protein-1 and macrophage inflammatory protein-1α in induction of experimental autoimmune myocarditis and effective anti-monocyte chemoattractant protein-1 gene therapy. Circulation 112: 3400-3407.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Homey, B., A. Muller, A. Zlotnik. 2002. Chemokines: agents for the immunotherapy of cancer?. Nat. Rev. Immunol. 2: 175-184.
    OpenUrlCrossRefPubMed
  10. ↵
    Garnick, M. B.. 1993. Prostate cancer: screening, diagnosis, and management. Ann. Intern. Med. 118: 804-818.
    OpenUrlPubMed
  11. ↵
    Pienta, K. J., P. S. Esper. 1993. Risk factors for prostate cancer. Ann. Intern. Med. 118: 793-803.
    OpenUrlPubMed
  12. ↵
    Loberg, R. D., L. L. Day, J. Harwood, C. Ying, L. N. St. John, R. Giles, C. K. Neeley, K. J. Pienta. 2006. CCL2 is a potent regulator of prostate cancer cell migration and proliferation. Neoplasia 8: 578-586.
    OpenUrlCrossRefPubMed
  13. ↵
    Lu, Y., Z. Cai, D. L. Galson, G. Xiao, Y. Liu, D. E. George, M. F. Melhem, Z. Yao, J. Zhang. 2006. Monocyte chemotactic protein-1 (MCP-1) acts as a paracrine and autocrine factor for prostate cancer growth and invasion. Prostate 66: 1311-1318.
    OpenUrlCrossRefPubMed
  14. ↵
    Loberg, R. D., C. Ying, M. Craig, L. L. Day, E. Sargent, C. Neeley, K. Wojno, L. A. Snyder, L. Yan, K. J. Pienta. 2007. Targeting CCL2 with systemic delivery of neutralizing antibodies induces prostate cancer tumor regression in vivo. Cancer Res. 67: 9417-9424.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Caruso, D. J., A. J. Carmack, V. B. Lokeshwar, R. C. Duncan, M. S. Soloway, B. L. Lokeshwar. 2008. Osteopontin and interleukin-8 expression is independently associated with prostate cancer recurrence. Clin. Cancer Res. 14: 4111-4118.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Waugh, D. J., C. Wilson. 2008. The interleukin-8 pathway in cancer. Clin. Cancer Res. 14: 6735-6741.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Akashi, T., K. Koizumi, O. Nagakawa, H. Fuse, I. Saiki. 2006. Androgen receptor negatively influences the expression of chemokine receptors (CXCR4, CCR1) and ligand-mediated migration in prostate cancer DU-145. Oncol. Rep. 16: 831-836.
    OpenUrlPubMed
  18. ↵
    Mydlo, J. H., M. I. Gerstein, C. F. Harris, A. S. Braverman. 2003. Immune function, mitogenicity, and angiogenic growth factor concentrations in lean and obese rodent sera: implications in obesity-related prostate tumor biology. Prostate Cancer Prostatic Dis. 6: 286-289.
    OpenUrlCrossRefPubMed
  19. ↵
    Darash-Yahana, M., E. Pikarsky, R. Abramovitch, E. Zeira, B. Pal, R. Karplus, K. Beider, S. Avniel, S. Kasem, E. Galun, A. Peled. 2004. Role of high expression levels of CXCR4 in tumor growth, vascularization, and metastasis. FASEB J. 18: 1240-1242.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Engl, T., B. Relja, D. Marian, C. Blumenberg, I. Muller, W. D. Beecken, J. Jones, E. M. Ringel, J. Bereiter-Hahn, D. Jonas, R. A. Blaheta. 2006. CXCR4 chemokine receptor mediates prostate tumor cell adhesion through α5 and β3 integrins. Neoplasia 8: 290-301.
    OpenUrlCrossRefPubMed
  21. ↵
    Kukreja, P., A. B. Abdel-Mageed, D. Mondal, K. Liu, K. C. Agrawal. 2005. Up-regulation of CXCR4 expression in PC-3 cells by stromal-derived factor-1alpha (CXCL12) increases endothelial adhesion and transendothelial migration: role of MEK/ERK signaling pathway-dependent NF-κB activation. Cancer Res. 65: 9891-9898.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Sun, Y. X., J. Wang, C. E. Shelburne, D. E. Lopatin, A. M. Chinnaiyan, M. A. Rubin, K. J. Pienta, R. S. Taichman. 2003. Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in vivo. J. Cell Biochem. 89: 462-473.
    OpenUrlCrossRefPubMed
  23. ↵
    Taichman, R. S., C. Cooper, E. T. Keller, K. J. Pienta, N. S. Taichman, L. K. McCauley. 2002. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res. 62: 1832-1837.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Vaday, G. G., S. B. Hua, D. M. Peehl, M. H. Pauling, Y. H. Lin, L. Zhu, D. M. Lawrence, H. D. Foda, S. Zucker. 2004. CXCR4 and CXCL12 (SDF-1) in prostate cancer: inhibitory effects of human single chain Fv antibodies. Clin. Cancer Res. 10: 5630-5639.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Lu, Y., Z. Cai, G. Xiao, E. T. Keller, A. Mizokami, Z. Yao, G. D. Roodman, J. Zhang. 2007. Monocyte chemotactic protein-1 mediates prostate cancer-induced bone resorption. Cancer Res. 67: 3646-3653.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Monteclaro, F. S., I. F. Charo. 1997. The amino-terminal domain of CCR2 is both necessary and sufficient for high affinity binding of monocyte chemoattractant protein 1: receptor activation by a pseudo-tethered ligand. J. Biol. Chem. 272: 23186-23190.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Datta-Mannan, A., M. J. Stone. 2004. Chemokine-binding specificity of soluble chemokine-receptor analogues: identification of interacting elements by chimera complementation. Biochemistry 43: 14602-14611.
    OpenUrlCrossRefPubMed
  28. ↵
    Charo, I. F., S. J. Myers, A. Herman, C. Franci, A. J. Connolly, S. R. Coughlin. 1994. Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails. Proc. Natl. Acad. Sci. USA 91: 2752-2756.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Kurihara, T., R. Bravo. 1996. Cloning and functional expression of mCCR2, a murine receptor for the C-C chemokines JE and FIC. J. Biol. Chem. 271: 11603-11607.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Gingrich, J. R., R. J. Barrios, B. A. Foster, N. M. Greenberg. 1999. Pathologic progression of autochthonous prostate cancer in the TRAMP model. Prostate Cancer Prostatic Dis. 2: 70-75.
    OpenUrlCrossRefPubMed
  31. ↵
    Loetscher, M., T. Geiser, T. O'Reilly, R. Zwahlen, M. Baggiolini, B. Moser. 1994. Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J. Biol. Chem. 269: 232-237.
    OpenUrlAbstract/FREE Full Text
  32. ↵
    Carothers, A. M., G. Urlaub, J. Mucha, D. Grunberger, L. A. Chasin. 1989. Point mutation analysis in a mammalian gene: rapid preparation of total RNA, PCR amplification of cDNA, and Taq sequencing by a novel method. BioTechniques 7: 494-499.
    OpenUrlPubMed
  33. ↵
    Harlow, E., D. Lane. 1988. Antibodies, A Laboratory Manual Cold Spring Harbor Laboratory, New York.
  34. ↵
    Friguet, B., A. F. Chaffotte, L. Djavadi-Ohaniance, M. E. Goldberg. 1985. Measurements of the true affinity constant in solution of antigen-antibody complexes by enzyme-linked immunosorbent assay. J. Immunol. Methods 77: 305-319.
    OpenUrlCrossRefPubMed
  35. ↵
    Mendel, I., N. Kerlero de Rosbo, A. Ben-Nun. 1995. A myelin oligodendrocyte glycoprotein peptide induces typical chronic experimental autoimmune encephalomyelitis in H-2b mice: fine specificity and T cell receptor Vβ expression of encephalitogenic T cells. Eur. J. Immunol. 25: 1951-1959.
    OpenUrlCrossRefPubMed
  36. ↵
    Karpus, W. J., K. J. Kennedy. 1997. MIP-1α and MCP-1 differentially regulate acute and relapsing autoimmune encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J. Leukocyte Biol. 62: 681-687.
    OpenUrlAbstract
  37. ↵
    Rubio, N., M. M. Villacampa, N. El Hilali, J. Blanco. 2000. Metastatic burden in nude mice organs measured using prostate tumor PC-3 cells expressing the luciferase gene as a quantifiable tumor cell marker. Prostate 44: 133-143.
    OpenUrlCrossRefPubMed
  38. ↵
    Frade, J. M., M. Mellado, G. del Real, J. C. Gutierrez-Ramos, P. Lind, A. C. Martinez. 1997. Characterization of the CCR2 chemokine receptor: functional CCR2 receptor expression in B cells. J. Immunol. 159: 5576-5584.
    OpenUrlAbstract
  39. ↵
    Feldmann, M., F. M. Brennan, R. N. Maini. 1996. Role of cytokines in rheumatoid arthritis. Annu. Rev. Immunol. 14: 397-440.
    OpenUrlCrossRefPubMed
  40. ↵
    Moreland, L. W., G. Margolies, L. W. Heck, Jr, A. Saway, C. Blosch, R. Hanna, W. J. Koopman. 1996. Recombinant soluble tumor necrosis factor receptor (p80) fusion protein: toxicity and dose finding trial in refractory rheumatoid arthritis. J. Rheumatol. 23: 1849-1855.
    OpenUrlPubMed
  41. ↵
    Moreland, L. W., S. W. Baumgartner, M. H. Schiff, E. A. Tindall, R. M. Fleischmann, A. L. Weaver, R. E. Ettlinger, S. Cohen, W. J. Koopman, K. Mohler, et al 1997. Treatment of rheumatoid arthritis with a recombinant human tumor necrosis factor receptor (p75)-Fc fusion protein. N. Engl. J. Med. 337: 141-147.
    OpenUrlCrossRefPubMed
  42. ↵
    Hebert, J., D. Bernier, Y. Boutin, M. Jobin, W. Mourad. 1990. Generation of anti-idiotypic and anti-anti-idiotypic monoclonal antibodies in the same fusion: support of Jerne’s Network Theory. J. Immunol. 144: 4256-4261.
    OpenUrlAbstract
  43. ↵
    Izikson, L., R. S. Klein, I. F. Charo, H. L. Weiner, A. D. Luster. 2000. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J. Exp. Med. 192: 1075-1080.
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Haringman, J. J., D. M. Gerlag, T. J. Smeets, D. Baeten, F. van den Bosch, B. Bresnihan, F. C. Breedveld, H. J. Dinant, F. Legay, H. Gram, et al 2006. A randomized controlled trial with an anti-CCL2 (anti-monocyte chemotactic protein 1) monoclonal antibody in patients with rheumatoid arthritis. Arthritis Rheum. 54: 2387-2392.
    OpenUrlCrossRefPubMed
  45. ↵
    Strasly, M., G. Doronzo, P. Cappello, D. Valdembri, M. Arese, S. Mitola, P. Moore, G. Alessandri, M. Giovarelli, F. Bussolino. 2004. CCL16 activates an angiogenic program in vascular endothelial cells. Blood 103: 40-49.
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section