Skip to main content

Main menu

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons

User menu

  • Subscribe
  • Log in

Search

  • Advanced search
The Journal of Immunology
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons
  • Subscribe
  • Log in
The Journal of Immunology

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Follow The Journal of Immunology on Twitter
  • Follow The Journal of Immunology on RSS

Downstream Signals for MyD88-Mediated Phagocytosis of Borrelia burgdorferi Can Be Initiated by TRIF and Are Dependent on PI3K

Ok S. Shin, Lloyd S. Miller, Robert L. Modlin, Shizuo Akira, Satoshi Uematsu and Linden T. Hu
J Immunol July 1, 2009, 183 (1) 491-498; DOI: https://doi.org/10.4049/jimmunol.0900724
Ok S. Shin
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lloyd S. Miller
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Robert L. Modlin
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shizuo Akira
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Satoshi Uematsu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Linden T. Hu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

We previously have shown that MyD88 is important for uptake of Borrelia burgdorferi by bone marrow derived macrophages (BMDMs). The mechanism by which MyD88 is involved in uptake of B. burgdorferi is currently is not well characterized. Here, we report that MyD88-mediated defect in the phagocytosis of B. burgdorferi can be complemented by TLR3/Toll/IL-1R domain-containing adaptor-inducing IFN-β (TRIF) activation in BMDMs from MyD88−/− mice. This effect of TLR3/TRIF activation was not due to its induction of type I IFNs, suggesting instead a convergence of signaling pathways downstream of MyD88 and TRIF. To characterize signaling pathways involved in MyD88-mediated phagocytosis of B. burgdorferi, BMDMs were treated with specific inhibitors of MAPK, protein kinase C, JAK/STAT, or PI3K. Only inhibition of PI3K resulted in a significant decrease of B. burgdorferi uptake. Consistent with this, B. burgdorferi activation of MyD88 or TLR3/TRIF signaling resulted in increased activity of PI3K. Additionally, association of B. burgdorferi with actin-related protein (Arp2/3) complexes, which facilitate actin rearrangements during phagocytosis, was similarly reduced in MyD88−/− BMDMs and in BMDMs treated with a PI3K inhibitor. Taken together, these findings define an essential pathway whereby downstream signals from MyD88 or TRIF converge on PI3K, which triggers actin polymerization to initiate the phagocytosis of B. burgdorferi.

Phagocytosis is a process by which macrophages, dendritic cells, and neutrophils internalize particles. It is an essential component of the innate immune system in defending against microbial pathogens (1). Upon contact with a microbe, phagocytic cells activate complex signaling networks that trigger and coordinate cellular processes as diverse as cytoskeletal rearrangement, alterations in membrane trafficking, activation of microbial killing mechanisms, production of pro- and anti-inflammatory cytokines and chemokines, activation of apoptosis, and production of molecules required for efficient Ag presentation to the adaptive immune system.

TLRs are pattern-recognition receptors for microbial products that participate in orchestrating the innate immune response to various microbial organisms (2, 3). In addition to activating the release of inflammatory cytokines, TLR signaling has been shown to play an important role in uptake (4, 5, 6, 7), phagolysosomal maturation (8), and NO formation (9) in response to various organisms. The role that TLR signaling plays in phagocytosis may vary depending on the organism involved and the signaling pathways that are activated. For example, signaling through the LPS receptor TLR4 has been shown to play an important role in activation of p38 MAPK that is important for phagolysosomal maturation (8).

For Borrelia burgdorferi, the causative agent of Lyme disease, it appears that signaling through the TLR adaptor MyD88 plays an important role in the uptake of the organism (4). Of note, in contrast to Escherichia coli, activation of p38 signaling does not play a major role in the uptake and processing of the organism. Loss of signaling through TLR2, TLR5, or TLR9, each of which is capable of recognizing a specific B. burgdorferi product (lipoproteins, flagellin, or CpG DNA, respectively) and signals through MyD88, is not sufficient to inhibit phagocytosis of B. burgdorferi (4). It is certainly possible that the phagocytic effects involving MyD88 are mediated through a different TLR that recognizes some other unknown borrelial product or that activation through any one of a number of TLRs is sufficient to activate MyD88-dependent phagocytosis. However, another possibility is that MyD88 signaling is not required for phagocytosis and that defects in uptake seen with MyD88 deficiency are due to developmental defects or a decreased activation state. This hypothesis has been proposed by Yates and Russell (10), who showed the requirement of MyD88 for phagolysosomal maturation, regardless of the presence of any TLR stimulus.

We are interested in determining the mechanism by which MyD88-mediated signaling plays a role in the uptake of B. burgdorferi. As we show herein, the defect in phagocytosis of B. burgdorferi in MyD88−/− cells is not due an intrinsic maturational defect or activation state, but instead is due to a lack of activation of a specific signaling pathway, which can be complemented by activation through an alternative pathway. Our results identify the mechanism of MyD88-mediated uptake of B. burgdorferi and the specific signaling pathways involved in the process.

Materials and Methods

Mice, cells, and bacteria

MyD88−/− mice were maintained as heterozygous breeding pairs at the sixth generation backcross on the C57BL/6 background. MyD88−/−, MyD88+/+, and MyD88+/− littermates were genotyped as described previously (11). C57BL/6 mice were purchased from The Jackson Laboratory. The procedures used for our animal studies were reviewed and approved by Tufts University Institutional Animal Care and Use Committee.

Mouse bone marrow-derived macrophages (BMDMs)3 were recovered from mouse femurs and differentiated as described previously (12). In brief, bone marrow cells were flushed from mouse femurs with sterile RPMI 1640 media (Mediatech) and cultured on plastic petri dishes for 5–7 days in medium containing RPMI 1640 supplemented with 30% L929 cell conditioned media, 20% FBS, and 1% penicillin-streptomycin. BMDMs were harvested from 100 × 15-mm petri dishes and plated at 0.5 × 106 macrophages/well in 24-well tissue culture plates. The murine macrophage cell line RAW 264.7 cells (American Type Culture Collection) were grown in DMEM (Mediatech) with l-glutamine, supplemented with 10% FBS and 1% penicillin-streptomycin. Clonal isolates of infectious, low passage B. burgdorferi sensu stricto (strain N40, clone D10E9) were used for all of the experiments. B. burgdorferi was cultured in Barbour-Stoenner-Kelly medium at 37°C as previously described (13).

Phagocytosis assay

Phagocytosis assays were performed as previously described (4). Briefly, coverslips in 24-well plates were coated with 1% rat collagen in 60% ethanol solution (Acros Organics) and dried overnight. Fully differentiated BMDMs were plated in RPMI 1640 supplemented with 30% L-cell conditioned media, 20% FBS, and 1% penicillin-streptomycin. Cells were maintained in this media for 24 h and then placed into serum-free RPMI 1640 overnight before use in assays. Serum-free conditions were used for experimentation to provide uniformity in the media and to avoid cross-reaction with bovine cytokines and inhibitors present in serum. B. burgdorferi was added to the cultures at a multiplicity of infection (MOI) of 10. Plates were centrifuged at 1200 rpm at 4°C for 5 min to bring B. burgdorferi in contact with the cells. To initiate phagocytosis, the plates were moved to 37°C (time 0). Coverslips were removed at various time points after the addition of B. burgdorferi and washed with cold PBS three times to remove unbound B. burgdorferi. Cells were fixed in 3.7% paraformaldehyde with 5% sucrose in PBS for 20 min at 25°C. Coverslips were washed three times in PBS and stored at 4°C until use.

For experiments with poly(I:C) stimulation, cells were treated with synthetic dsRNA (poly(I:C)) (InvivoGen) for 4 h before phagocytosis assay was performed. For experiments with IFN stimulation, macrophages were primed with either recombinant IFN-β (Sigma-Aldrich) or IFN-γ (eBioscience) overnight before phagocytosis. For experiments with pathway inhibitors, the inhibitors were added to the cells 1 h before addition of B. burgdorferi. U0126 (ERK inhibitor), SP600125 (JNK inhibitor), AG490 (JAK/STAT inhibitor), RO31-8220 (protein kinase C (PKC) inhibitor), and LY294002 (PI3K inhibitor) were purchased from Calbiochem. The concentrations (10 μM U0126, 20 μM SP600125, 10 μM AG490, 3μΜ RO31-8220, and 10 μM LY294002) of the inhibitors used were in conformity with earlier published reports and had no visible cytotoxic effect on the BMDMs as judged by trypan blue exclusion (14, 15, 16). The activity of the inhibitors at the concentrations was confirmed by testing for known effects of the inhibitors on expression of selected genes by quantitative RT-PCR (qRT-PCR).

Immunofluorescence microscopy

Immunofluorescence studies were performed as previously described (4) with the following modifications. Briefly, the coverslips were incubated three times for 5 min in blocking buffer (PBS containing 2% goat serum) at room temperature. All Ab incubations were continued for 1 h at 37°C in a humidified incubator. After blocking, the coverslips were incubated for 1 h at 37°C with an anti-B. burgdorferi polyclonal rabbit Ab (a gift from Dr. J. Coburn) diluted 1/10,000 in blocking buffer. Coverslips were then washed three times with blocking buffer and incubated with a FITC-conjugated goat anti-rabbit IgG Ab (Molecular Probes). Samples were again washed three times in PBS for 5 min and then permeabilized with chilled methanol for 10 s. After incubating three times for 5 min in blocking buffer, the coverslips were again incubated with the anti-B. burgdorferi rabbit Ab. After washing three times for 5 min in blocking buffer, samples were incubated simultaneously with a Texas Red-conjugated goat anti-rabbit IgG Ab (Molecular Probes). For studies of actin-related protein (Arp)3 localization, Arp2/3 complexes were detected by rabbit anti-Arp3 Ab (1/200), a gift from Dr. R. Isberg (Tufts University), and B. burgdorferi was identified by using mouse anti-OspA (outer surface protein A) Ab (1/5000) (Maine Biotechnology). After washing, coverslips were mounted by using 4′,6-diamidino-2-phenylindole in Vectashield mounting medium (Vector Laboratories) and examined by differential interference contrast and fluorescence microscopy by using a Zeiss Axioplan 2 microscope. Images were captured with a digital CCD camera (Hamamatsu). Analysis of colocalization of the fluorescent labels was performed by using OpenLab software (Improvision) with or without three-dimensional reconstruction and deconvolution as indicated.

For quantitative analyses, the percentages of cells with one or more internalized B. burgdorferi particles were counted by examining sequential fields from a minimum of three independent experiments (minimum three sets of 100–200 cells/set). Cells containing any internalized B. burgdorferi particles or cells containing internalized/intact B. burgdorferi were counted and expressed as a percentage of the total number of cells examined. The mean percentages of a minimum of three independent experiments were plotted over time and the statistical significance between groups was analyzed using the nonparametric Mann-Whitney U test.

qRT-PCR

After incubation with B. burgdorferi, cells were washed with PBS and RNA extracted by using TRIzol as per the manufacturer’s instructions (Invitrogen). First-strand synthesis of cDNA from total RNA was performed by using ImProm-II (Promega) as per the manufacturer’s instructions. Quantification of cDNA was performed by quantitative PCR (iCycler; Bio-Rad) by using QuantiTect SYBR Green PCR mix (Qiagen). Cycling parameters were 60°C for 5 min and 95°C for 15 min, followed by 40 cycles of 95°C for 30 s and 60°C for 1 min. The following primers were used: IFN-β forward, AGCTCCAAGAAAGGACGAACAT; IFN-β reverse, GCCCTGTAGGTGAGGTTGATCT; TNF-α forward, ATGAGCACAGAAAGCATGATC; TNF-α reverse, TACAGGCTTGTCACTCGAATT. The specificity of each reaction was checked by melt curve analysis and by agarose gel electrophoresis of PCR products. Expression of target genes was referenced to expression of β-actin. Calculations of expression were normalized by using the ΔΔCt method where the amount of target, normalized to an endogenous reference and relative to a calibrator, is given by 2−ΔΔCt, where Ct is the cycle number of the detection threshold.

Transient transfection of MyD88-dominant negative plasmid

RAW 264.7 cells were transiently transfected with a dominant-negative (DN) mutant of MyD88 (a gift from Dr. K. Fitzgerald, University of Massachusetts Medical School) (17) or pCDNA3-GFP plasmid (Invitrogen), by using a 4:1 lipid/DNA ratio of Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s protocol (18). The transfection mix was added to cells in DMEM serum-free media and incubated at 37°C. After 6 h, the medium was replaced with 10% FBS added to DMEM, and 24 h later, we performed a phagocytosis assay as described. We estimated transfection efficiency of RAW 264.7 cells by randomly choosing 10 fields and counting both total cells and cells expressing GFP after transient transfection of cells with pCDNA3-GFP plasmid. Estimated transfection efficiency for all experiments was ∼70–80%.

Western blotting

Cellular lysates of mouse macrophages were prepared by lysis buffer (0.05 M Tris (pH 7.4), 0.15 M NaCl, 0.5 mM PMSF, 50 μg/ml aprotinin, 10 μg/ml leupeptin, 50 μg/ml pepstatin, 0.4 mM sodium orothovanadate, 10 mM sodium fluoride, and 10 mM sodium pyrophosphate) and then separated by SDS-PAGE on 4–12% acrylamide gels and transferred to a polyvinyldifluoride membrane. The membrane was incubated in blocking buffer (5% milk in 0.2 M Tris base, 1.36 M NaCl with 0.1% Tween 20 (TBS/T)) for 1 h at room temperature and washed three times for 5 min each with 15 ml of TBS/T. Membranes were incubated with the primary Ab overnight at 4°C. Phospho-Akt (Ser473) Ab and total Akt Ab were purchased from Cell Signaling Technology. After washing three times with TBS/T, the membranes were incubated with anti-rabbit IgG HRP-conjugated secondary Ab for 1 h at 25°C. After washing three times with TBS/T, the membrane was incubated with LumiGLO substrate and exposed to the film.

Statistical analysis

Experiments were repeated three times as indicated. The statistical significance between groups was analyzed by using the nonparametric Mann-Whitney U test. Differences were considered statistically significant when the p values were ≤0.05.

Results

Deficiencies in MyD88-mediated phagocytosis of B. burgdorferi can be complemented by activation of TLR3-dependent signaling

We previously reported that MyD88 is required for uptake of B. burgdorferi, but not for E. coli (4). Among the differences between innate immune recognition of B. burgdorferi and E. coli is the fact that B. burgdorferi lipoproteins are recognized by TLR2, while E. coli LPS is recognized through TLR4. One potential implication of this difference is that TLR4, in addition to utilizing MyD88 for activation of signaling pathways, can also activate MyD88-independent pathways through the use of the Toll/IL-1R domain-containing adaptor-inducing IFN-β (TRIF) adaptor pathway. To determine whether signaling through TRIF can complement the loss of MyD88 and restore phagocytosis of B. burgdorferi in MyD88-deficient cells, we stimulated both wild-type (WT) and MyD88−/− BMDMs with the TLR3 ligand poly(I:C). Among TLRs, TLR3 is unique in that it is the only identified TLR that does not utilize MyD88 and activates pathways solely through recruitment and activation of TRIF.

We first confirmed the effect of poly(I:C) on activation of MyD88−/− cells by evaluating mRNA expression of type I IFN (IFN-β) and TNF (TNF-α). Poly(I:C) stimulation induced similar mRNA expression of IFN-β and TNF-α for both WT and MyD88−/− macrophages, indicating that MyD88-independent signaling pathways remained intact in both cells types as would be anticipated (Fig. 1⇓A). The addition of poly(I:C) in MyD88−/− cells significantly increased uptake of B. burgdorferi to WT levels at 20 and 60 min postinfection (p = 0.009, p = 0.016) (Fig. 1⇓B). Poly(I:C) did not affect the phagocytosis of B. burgdorferi in WT BMDMs (p = 0.602). Similar complementation of the phagocytic defect for B. burgdorferi with the addition of LPS to MyD88−/− cells was also seen (data not shown).

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

Poly(I:C) stimulation of MyD88−/− BMDMs complements a defect in uptake of B. burgdorferi. Both WT and MyD88−/− BMDMs were treated with 25 μg/ml poly(I:C) for 4 h. RNA was collected for qRT-PCR (A) and phagocytosis assay was performed for 5, 20, and 60 min (B). The transcriptional expression of IFN-β and TNF-α is shown. The expression of cytokines in WT BMDMs treated with media was arbitrarily set to 1 and relative expression is shown in parenthesis above each bar. Expression of target genes was normalized to that of β-actin. The qRT-PCR experiments were performed in duplicate and repeated three times, and the average of all experiments is shown. Error bars represent SDs. In phagocytosis assays, cells were fixed at each time point and then probed with various Abs. DAPI (4′,6-diamidino-2-phenylindole) (blue), nucleus; Bb (green), B. burgdorferi staining before cell permeabilization to identify extracellular organisms; Bb perm (red), B. burgdorferi staining after cell permeabilization to identify both internalized and extracellular B. burgdorferi. Merge shows a merged image of DAPI, Bb, and Bb perm. The image taken at 60 min postinfection is shown. Images are shown at ×100 magnification. Scale bar, 10 μm. For quantitative analysis of phagocytosis, cells containing internalized B. burgdorferi particles were counted and expressed as a percentage of the total number of cells examined. The experiments were repeated five times and average of all experiments is shown. Error bars represent SDs. *, p < 0.05, MyD88−/− BMDMs treated with poly(I:C) compared with MyD88−/− BMDMs alone at 20 min postinfection; #, p < 0.05, MyD88−/− BMDMs treated with poly(I:C) compared with MyD88−/− BMDMs alone at 60 min postinfection.

Restoration of phagocytosis of B. burgdorferi in MyD88−/− BMDMs by poly(I:C) is not due to cellular activation through IFNs

TLR3 signaling results in the induction of type I IFN, such as IFN-α and IFN-β. Both type I and type II IFNs are known activators of BMDMs (19, 20). To determine whether the effect of poly(I:C) in restoring phagocytosis to MyD88−/− BMDMs is due to cellular activation through IFNs or whether it is the result of activation of more specific pathways that converge downstream of MyD88 and TRIF, we studied the effects of activation of cells with IFN-β on the phagocytosis of B. burgdorferi.

BMDMs were first preincubated with recombinant IFN-β (100 U/ml) overnight to activate macrophages, and phagocytosis assays were performed the next day. We evaluated phagocytosis of B. burgdorferi by WT and MyD88−/− cells with and without IFN-β stimulation. In contrast to results with the addition of poly(I:C), priming MyD88−/− macrophages with IFN-β did not increase the phagocytosis of B. burgdorferi, and at 20 min and 60 min postinfection, there were still fewer cells containing internalized spirochetes, compared with WT cells primed with IFN-β (Fig. 2⇓). There was no significant increase in numbers of cells containing internalized B. burgdorferi, even in the presence of IFN-β priming in MyD88-deficient cells (32.87 ± 6.22% MyD88−/− BMDMs alone vs 29.09 ± 2.90% MyD88−/− BMDMs primed with recombinant IFN-β at 60 min postinfection; Fig. 2⇓). We also tested higher concentrations of IFN-β (1000 and 5000 U/ml), which also showed no effect (data not shown). These data suggest that poly(I:C)-mediated increases of B. burgdorferi uptake in MyD88-deficient cells are not due to TLR3-mediated induction of type I IFN. Of note, we also observed similar results with priming BMDMs with recombinant IFN-γ, which is often used as an activator of macrophages for killing of intracellular organisms, but which is not induced by TLR3 activation (data not shown).

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

Effect of type I IFN on the phagocytosis of B. burgdorferi. Both WT and MyD88−/− BMDMs were primed with recombinant IFN-β (100 U/ml) overnight. B. burgdorferi was added the next day and phagocytosis assay was performed for 5, 20, and 60 min. For quantitative analysis of phagocytosis, cells containing internalized B. burgdorferi particles were counted and expressed as a percentage of the total number of cells examined. The experiments were repeated three times and average of all experiments is shown. Error bars represent SDs.

IL-1 is not required for MyD88-mediated phagocytosis of B. burgdorferi

To examine the role of other potential mediators, we studied the requirement for IL-1 in phagocytosis of B. burgdorferi. IL-1 is an important cellular activator. IL-1β is induced from BMDMs by the presence of B. burgdorferi through activation of MyD88 (4). Additionally, IL-1R, similar to TLRs and IL-18R family members, utilizes the MyD88 adaptor protein to initiate signaling (21). We previously reported that phagocytosis of B. burgdorferi is not dependent on the presence of individual TLRs, such as TLR2, TLR5, or TLR9 (4). Previous reports have suggested that the IL-18 does not have a role in the inflammatory response to B. burgdorferi or in control of infection (22). IL-1R has been shown to promote neutrophil recruitment and control clearance of the organisms via MyD88 signaling in an effective innate immune response against Staphylococcus aureus infection (23). Therefore, we sought to examine whether IL-1R is also important for uptake of B. burgdorferi.

We performed phagocytosis assays by using BMDMs from IL-1R−/− mice as described above. WT control BMDMs ingested and degraded B. burgdorferi within phagolysosomes of macrophages by 20 min with almost no B. burgdorferi seen extracellularly in association with cells. The absence of IL-1R did not affect phagocytosis of B. burgdorferi and at 20 min and 60 min, almost all of the organisms were degraded with the same percentage of cells containing degraded B. burgdorferi as WT control BMDMs (71.29 ± 9.14% WT control BMDMs vs 67.88 ± 8.8% IL-1R−/− BMDMs at 60 min postinfection; Fig. 3⇓). Similar results were seen using BMDMs from mice deficient in IL-1α, IL-1β, or IL-1α/β (data not shown).

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

Uptake of B. burgdorferi in IL-1R−/− BMDMs. WT and IL-1R−/− BMDMs were plated in 24-well plates and infected with B. burgdorferi for 5, 20, and 60 min. For quantitative analysis of phagocytosis, cells containing internalized B. burgdorferi particles were counted and expressed as a percentage of the total number of cells examined. The experiments were repeated three times and average of all experiments is shown. Error bars represent SDs.

Activation of PI3K, but not MAPK, JAK/STAT, and PKC, is required for B. burgdorferi uptake

Since the defect in phagocytosis of B. burgdorferi by MyD88−/− BMDMs did not appear to be due to a lack of activation that could be complemented by a TLR3-dependent pathway, we began to examine signaling pathways that are activated downstream of both MyD88 and TRIF and/or have been shown to be activated by the presence of B. burgdorferi. We and other laboratories have shown that B. burgdorferi induces multiple signaling pathways, such as MAPK (p38, JNK, and ERK) (14, 24, 25), PKC (15), and JAK/STAT (14, 26). We have previously shown that inhibition of p38 MAPK does not suppress uptake and degradation of B. burgdorferi (4) despite the important role that p38 activation has been shown to play for phagocytosis of other bacteria through its role in phagolysosomal maturation (8). To determine which signaling pathways are involved in MyD88-mediated phagocytosis, we used pharmacological inhibitors of specific signaling pathways to investigate downstream targets of MyD88 in phagocytosis.

BMDMs from WT mice were preincubated with U0126 (ERK1/2 inhibitor), SP600125 (JNK inhibitor), AG490 (JAK/STAT inhibitor), or RO31-8220 (PKC inhibitor) for 1 h before the addition of B. burgdorferi (Fig. 4⇓). Concentrations of the inhibitors were chosen based on previously published studies showing optimal inhibition and specificity for the targeted receptors in the concentration range used without causing any cytotoxicity (14, 15, 16). The activity of each inhibitor was confirmed by examining the effect of inhibitors on the induction of downstream cytokines known to be associated with that pathway (data not shown).

FIGURE 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 4.

Signaling pathways involved in the uptake of B. burgdorferi. A, WT BMDMs were preincubated with either a vehicle control (DMSO) or 10 μM ERK inhibitor (U0126), 20 μM JNK inhibitor (SP600125), 10 μM JAK/STAT inhibitor (AG490), or 3 μM PKC inhibitor (RO31-8220) for 1 h and phagocytosis assay was performed as described in Materials and Methods. B, WT BMDMs were preincubated with either a vehicle control or 10 μM PI3K inhibitor LY294002 for 1 h, and phagocytosis assay was performed as described in Materials and Methods. Immunofluorescence microscopy was used to analyze the phagocytosis of B. burgdorferi. For quantitative analysis of phagocytosis, cells containing internalized B. burgdorferi particles were counted and expressed as a percentage of the total number of cells examined. The experiments were repeated three times and the average of all experiments is shown. Error bars represent SDs. *, p ≤ 0.05, compared with WT BMDMs treated with a vehicle control.

Although activation of ERK, JNK, JAK/STAT, or PKC signaling molecules are important for the induction of inflammatory signaling pathways, inhibition of these pathways did not affect phagocytosis of B. burgdorferi, and by 60 min, almost all of the organisms were degraded with the same percentage of cells containing degraded B. burgdorferi as vehicle treated controls (Fig. 4⇑A). This suggests that these pathways are either not involved in phagocytosis of B. burgdorferi or that the level of pathway activation required to support phagocytosis is far less than that needed for cytokine induction.

PI3K has been shown to play an important role in the phagocytosis of large particles (1, 27, 28, 29). PI3K activation has been shown to occur downstream of TLR signaling (16, 30, 31), and few studies have reported its importance for TLR-mediated phagocytosis (6, 32). We performed phagocytosis assays in the presence of PI3K inhibitor, LY294002. BMDMs from WT mice were preincubated with LY294002 for 1 h before the addition of B. burgdorferi (Fig. 4⇑B). As in Fig. 4⇑A, in the vehicle- (DMSO) treated controls, B. burgdorferi were found to be degraded and associated with phagolysosomes of WT BMDMs by 60 min with almost no B. burgdorferi seen extracellularly in association with cells (data not shown). In contrast, when WT BMDMs were pretreated with LY294002 before incubation with B. burgdorferi, phagocytosis was significantly inhibited (66.48 ± 4.79% vehicle-treated cells vs 29.08 ± 12.83% LY290402-treated cells (p ≤ 0.05, compared with vehicle-treated controls; Fig. 4⇑B), similar to what is seen in MyD88−/− BMDMs. These data demonstrate that PI3K activation is required for the uptake of spirochetes.

B. burgdorferi recognition through TLRs and MyD88 activates PI3K signaling

To determine whether PI3K was responsible for the phagocytic defect in MyD88−/− BMDMs, we sought to determine the relationship between B. burgdorferi activation of MyD88 and PI3K.

BMDMs from either WT or MyD88−/− mice were infected with B. burgdorferi and then harvested (Fig. 5⇓). Western blots of cellular lysates show that there is an increase in Akt phosphorylation in WT BMDMs by 20 min (Fig. 5⇓A). In contrast, there was substantially less phosphorylation of Akt in BMDMs from MyD88−/− mice. To confirm these data, we transiently transfected plasmids expressing a dominant negative MyD88 (MyD88-DN) or an empty vector control into the mouse macrophage cell line RAW 264.7. The effect of abrogating MyD88 signaling in these cells was confirmed by reduced TNF-α and IL-6 mRNA expression in response to B. burgdorferi (data not shown). MyD88-DN and control-transfected cells were incubated with B. burgdorferi for 20 min and then harvested (Fig. 5⇓B). Western blots of cellular lysates show that there is an increase in phosphorylation of Akt, a phosphorylation target of PI3K, in RAW cells transfected with control vector by 20 min. In contrast, there was a reduction in phosphorylation of Akt in RAW cells transfected with MyD88-DN. These data demonstrate that incubation of B. burgdorferi induces activation of PI3K and Akt phosphorylation at least in part through MyD88 signaling.

FIGURE 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 5.

Phosphorylation of Akt by B. burgdorferi infection is partly dependent on TLR signaling. A, BMDMs from either WT or MyD88−/− mice were incubated with B. burgdorferi (MOI of 10) for 20 min. The cells were lysed and the phosphorylation of Akt was determined by Western blotting. B, RAW 264.7 cells were transiently transfected with either control vector or a dominant negative (DN) form of MyD88. Twenty-four hours later, cells were either treated with a vehicle control or 10 μM PI3K inhibitor LY294002 1 h before stimulation with B. burgdorferi (MOI of 10) for 20 min. The cells were lysed and the phosphorylation of Akt was determined by Western blotting. Lanes: 1, RAW cells treated with DMSO; 2, RAW cells treated with LY294002; 3, RAW cells transfected with control vector; 4, RAW cells transfected with MyD88-DN; 5, RAW cells treated with DMSO and stimulated with B. burgdorferi; 6, RAW cells treated with LY294002 and stimulated with B. burgdorferi; 7, RAW cells transfected with control vector and stimulated with B. burgdorferi; 8, RAW cells transfected with MyD88-DN and stimulated with B. burgdorferi. The Western blots are representative of three independent experiments. Ab to total Akt was used to control for differences in sample loading.

Downstream signals from TRIF converge on PI3K to trigger phagocytosis of B. burgdorferi

To determine whether TLR3-mediated complementation of phagocytic defect by MyD88−/− cells also requires the activation of PI3K, we examined first whether stimulation of TLR3-dependent pathways by using poly(I:C) induces phosphorylation of Akt, and second, whether blocking PI3K pathway after rescuing phagocytic defect in MyD88−/− cells with poly(I:C) stimulation leads to suppression in B. burgdorferi uptake.

BMDMs were treated with various concentrations of poly(I:C) (0–100 μg/ml), and phosphorylation levels of the Akt was examined by Western blotting. Phosphorylation of the Akt was substantially increased upon poly(I:C) stimulation and this was dependent on the concentration used (Fig. 6⇓A). Therefore, this suggests that TLR3 induces phosphorylation of Akt in BMDMs in a concentration-dependent manner.

FIGURE 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 6.

Downstream signals from TRIF converge on PI3K to trigger uptake of B. burgdorferi. A, BMDMs were treated with 10, 25, and 100 μg/ml of poly(I:C) for 30 min. The cells were lysed and the phosphorylation of Akt was determined by Western blotting. The Western blots are representative of two independent experiments. Ab to total Akt was used to control for differences in sample loading. B, Both WT and MyD88−/− BMDMs were treated with 25 μg/ml poly(I:C) for 4 h. Cells were then treated with either a vehicle control or 10 μM PI3K inhibitor LY294002 for 1 h, and phagocytosis assay was performed as described in Materials and Methods. Immunofluorescence microscopy was used to analyze the phagocytosis of B. burgdorferi. For quantitative analysis of phagocytosis, cells containing internalized B. burgdorferi particles were counted and expressed as a percentage of the total number of cells examined. The experiments were repeated three times and the graph shows an average of all experiments at 60 min postinfection. Error bars represent SDs. *, p ≤ 0.05, compared with WT cells treated with vehicle after poly(I:C) stimulation; #, p ≤ 0.05, compared with MyD88−/− cells treated with vehicle after poly(I:C) stimulation.

Next, we tested whether blocking PI3K pathway inhibits uptake of B. burgdorferi in MyD88−/− BMDMs pretreated with poly(I:C). BMDMs from WT or MyD88−/− mice were pretreated with poly(I:C) for 4 h and control or the PI3K inhibitor, LY294002 (PI3Ki), was added for 1 h before B. burgdorferi incubation.

Similar to results in Fig. 1⇑, stimulation of MyD88−/− cells with poly(I:C) resulted in a marked increase of B. burgdorferi uptake at 60 min postinfection (Fig. 6⇑B). However, in the presence of PI3Ki, both WT and MyD88−/− cells internalized statistically significant less B. burgdorferi, compared with control-treated cells (64.60 ± 5.04% WT plus poly(I:C) with a control treatment vs 23.83 ± 2.70% WT plus poly(I:C) with a LY290402 treatment (p ≤ 0.05); 69.82 ± 1.70% MyD88−/− cells plus poly(I:C) with a control treatment vs 21.13 ± 4.15% MyD88−/− cells plus poly(I:C) with a LY290402 treatment (p ≤ 0.05). Thus, PI3K is activated by both TRIF and MyD88 signaling pathways. These data demonstrate that PI3K activation is a critical pathway that is required for the optimal phagocytosis of B. burgdorferi.

MyD88-mediated uptake of B. burgdorferi involves the recruitment of Arp2/3 complexes

Actin polymerization has been well characterized to be a driving force for the formation and extension of membrane protrusions, which is important for the successful phagocytosis of microbial organisms (33). PI3K signaling has been shown to play an important role in actin polymerization through activation of Rac (34). The Rho family GTPases, Rac1 and CDC42, subsequently recruit Arp2/3 to form the actin complex (35, 36). To determine whether the defect in B. burgdorferi uptake by MyD88−/− BMDMs was due to a loss of PI3K-directed actin polymerization, we examined the localization of the Arp2/3 complex of actin with B. burgdorferi. The cellular distribution of Arp2/3 complexes was evaluated by using an Ab directed against the 50 kDa Arp3 subunit of the Arp2/3 complex (37, 38). At 5 min after B. burgdorferi infection, Arp2/3 was found clearly associated with contact points where B. burgdorferi were adhered to the WT cell surface and throughout the entire length of organisms as they are been taken up into WT cells (Fig. 7⇓). In contrast, recruitment of Arp2/3 colocalized with B. burgdorferi attached to the surface of MyD88−/− cells was not observed. Similarly, BMDMs treated with the PI3K inhibitor also did not show colocalization of Arp2/3 with attached B. burgdorferi. This suggests that MyD88 signaling is important for the coordination of actin polymerization and efficient recruitment of Arp2/3 required for uptake of B. burgdorferi. These data provide further evidence that PI3K signaling pathway, by directing cellular distribution of Arp2/3 complexes, is required for MyD88-dependent phagocytosis of B. burgdorferi.

FIGURE 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 7.

Association of Arp2/3 complexes with B. burgdorferi in BMDMs. WT BMDMs, treated or untreated with 10 μM PI3K inhibitor LY294002, and BMDMs from MyD88−/− mice were plated and B. burgdorferi was added (MOI of 10) as in Fig. 1. At 5 min postinfection, cells were washed with PBS three times and fixed. Samples were serially incubated with different Abs: Arp3, anti-Arp3 (actin-related protein complex) Ab (Green); Bb, mouse anti-OspA Ab (Red). Merged deconvoluted images are shown. The image is a composite of 0.45-μm z-axis sections. Data are representative of three independent experiments. Images are shown at ×100 magnification. Scale bar, 10 μM.

Discussion

A role for MyD88 in different aspects of phagocytosis, including effects on uptake, phagolysosomal maturation, and oxidative killing, has been proposed (4, 5, 8, 9). In this study, we investigated the mechanisms by which MyD88 participates in the phagocytosis of B. burgdorferi. We have previously shown that MyD88 plays an important role in uptake, but not in phagolysosomal processing of B. burgdorferi (4). There have only been a few reports on the role of TLR signaling on the uptake of organisms (4, 5, 6, 7). A study by Doyle et al. suggested that the role of MyD88 in uptake of organisms occurs through up-regulation of specific phagocytic receptors, such as scavenger receptors (5). Up-regulation of specific scavenger receptors, including scavenger receptor-A (SR-A), macrophage receptor with a collagenous structure (MARCO), and lectin-like oxidized low density lipoprotein receptor-1 (LOX-1), does occur in response to B. burgdorferi infection (O. S. Shin, unpublished data). However, consistent with the results seen for induction of scavenger receptors by other organisms (5), up-regulation of these receptors by B. burgdorferi appears to occur at a time point after uptake of the organism into the cells, suggesting that scavenger receptors are not major contributors to the early uptake of B. burgdorferi seen in our phagocytic assays.

Instead, we have shown that the uptake of B. burgdorferi is mediated by downstream signaling events activated in response to the organism. We found that the role of MyD88 activation in phagocytosis can be replaced by activation of the other major TLR signaling adaptor, TRIF (Fig. 1⇑B). By pretreating MyD88−/− cells with a TLR3 ligand, poly(I:C), which is able to activate downstream signaling through TRIF without the involvement of MyD88, we were able to restore the ability of MyD88−/− cells to phagocytose B. burgdorferi. The ability to restore phagocytosis with the addition of poly(I:C) confirms that there is not an intrinsic defect in the ability of MyD88−/− cells to take up B. burgdorferi and provides clues as to the possible downstream pathways responsible for controlling phagocytosis of B. burgdorferi.

Activation downstream of TRIF occurs along two major pathways: 1) activation of TNFR-associated factor (TRAF)3, which leads to a subsequent induction of type I IFN and activation of IFN-responsive genes, and 2) activation of TRAF6 (also utilized by MyD88), which leads to downstream activation of many signaling pathways and translocation of NF-κB. Activation of macrophages by type I and type II IFNs has been shown to increase phagocytic capacity of these cells (19, 20, 39). However, unlike poly(I:C), addition of IFN-β was unable to restore phagocytosis of B. burgdorferi in MyD88−/− cells (Fig. 2⇑), making it unlikely to be the mechanism by which TRIF activation complements the loss of MyD88.

Thus, we focused on pathways directly downstream of TRAF6 as well as those that may be activated indirectly as a result of TRAF6 activation. We examined downstream pathways that can be activated by recognition of B. burgdorferi products, including p38, ERK, JNK, PKC, JAK/STAT, and PI3K, using chemical inhibitors. Of these, only inhibition of PI3K blocked uptake of B. burgdorferi (Fig. 4⇑B) (results for p38 were previously reported in Ref. 4). PI3K is a major regulator for phagocytosis of large particles (28). Inhibition of PI3K can block new membrane formation at the site of particle internalization and reduce membrane extension and fusion of the bound particle (27, 28, 29). Previous studies have shown the involvement of PI3K in the induction of phagocytosis of the parasite Cryptosporidium parvum and of some intracellular pathogens such as Legionella pneumophila, Listeria monocytogenes, and Chlamydia pneumoniae (40, 41, 42, 43). Consistent with these findings, Wang et al. have shown that expression of TRAF6 increases PI3K-dependent cytoskeletal changes required for reorganization of actin cytoskeleton (44).

Successful phagocytosis relies on the rearrangements of the actin cytoskeleton and the plasma membrane to engulf bacteria or particles. Arp2/3 complexes are driving forces to bring together actin monomers to form a new nucleus for actin polymerization and are localized in the lamellipodia at branch points between actin filaments (35, 36). PIP2 has been suggested to regulate actin remodeling during phagocytosis, probably through its regulation of cytoskeletal proteins such as Wiskott-Aldrich syndrome protein (45). Uptake of B. burgdorferi has been associated with formation of F-actin-rich structures, driven by activation of Wiskott-Aldrich syndrome protein and Arp2/3 complex, which are recruited to the engulfment structures (46). Thus, we wanted to examine if a loss of MyD88 or inhibition of PI3K signaling pathway would have any impact on the localization and distribution of Arp2/3 complexes at the sites of B. burgdorferi entry into the cells. We show that both MyD88−/− BMDMs and WT BMDMs treated with a PI3K inhibitor failed to recruit Arp3 to sites of B. burgdorferi, suggesting a potential role of MyD88/PI3K for initiating actin polymerization (Fig. 7⇑).

Interestingly, although we initiated our studies of poly(I:C) complementation of MyD88 deficiency because of the observation that E. coli uptake is not affected by MyD88 deficiency and the hypothesis that E. coli LPS could activate TRIF through TLR4, bypassing the requirement for MyD88, uptake of E. coli does not appear to be inhibited by the addition of a PI3K inhibitor (O. S. Shin, unpublished data) and thus likely does not require either MyD88 or TRIF. Other investigators have also found that E. coli uptake, and that of other small extracellular bacteria such as Brucella and Salmonella, does not require PI3K (7, 47, 48). One possibility for the differences in requirement for PI3K activation by different bacteria may be differences in the mechanisms of phagocytosis due to the size of the organisms.

Some investigators have reported that B. burgdorferi is primarily taken up through coiling phagocytosis rather than conventional phagocytosis (46, 49). Coiling phagocytosis is a process whereby a single pseudopod extends and engulfs the spirochete. It has been suggested that processing of B. burgdorferi internalized by coiling phagocytosis differs from conventional phagocytosis in that degradation occurs through a nonlysosomal mechanism (50). This consistent with the lack of a role for p38 MAPK in killing of B. burgdorferi, as nonlysosomal-mediated killing may not utilize p38 MAPK to control phagosome acidification and maturation. However, the phenomenon of coiling phagocytosis remains somewhat controversial, and more recent studies have suggested that B. burgdorferi can be internalized through either coiling or conventional phagocytosis and that, regardless of the mechanism of internalization, all of the degraded particles are localized within lysosomes (50).

In summary, we have shown that MyD88-mediated phagocytosis of B. burgdorferi can be initiated by TRIF and is dependent on activation of PI3K. We have demonstrated that inhibition/loss of either MyD88 or PI3K results in a failure to appropriately recruit Arp2/3 complexes to the bacteria/cell membrane interface to initiate phagocytosis. Furthermore, activation of MyD88 increases the activity of PI3K. Thus, the MyD88/PI3K pathway is an essential mechanism that controls uptake and phagocytosis of B. burgdorferi. The role of PI3K in MyD88-mediated phagocytosis of B. burgdorferi differs from prior reports demonstrating an important role for p38 in MyD88-mediated phagocytosis of other organisms and suggests that different pathways mediate this process depending on the infecting organism (8). Taken together, the identification of MyD88/PI3K as a key pathway for phagocytosis of B. burgdorferi provides new insights into the complex TLR signaling pathways that govern the phagocytic response, which may not only have important implications in mechanisms of host defense against B. burgdorferi but also in infections caused by and other bacterial pathogens.

Acknowledgments

We thank Dr. Ralph Isberg, Dr. Jenifer Coburn, Dr. Alexander Poltorak, Dr. Philip Tsichlis, Dr. Tanja Petnicki-Ocwieja, Dr. Andrew Heilpern, Meghan Marre, and Deb Bhattacharya for their helpful discussions in preparing this manuscript. We also thank Alex Stone for help with genotyping MyD88−/− mice.

Disclosures

The authors have no financial conflicts of interest.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 This work was supported by R01AI050043 from the National Institute of Allergy and Infectious Diseases.

  • ↵2 Address correspondence and reprint requests to Dr. Linden T. Hu, Tufts Medical Center, 750 Washington Street, Boston, MA 02111. E-mail address: lhu{at}tuftsmedicalcenter.org

  • ↵3 Abbreviations used in this paper: BMDM, bone marrow-derived macrophage; Arp2/3 complexes, actin-related protein 2/3 complexes; DN, dominant negative; MOI, multiplicity of infection; PKC, protein kinase C; qRT-PCR, quantitative RT-PCR; TRAF, TNFR-associated factor; TRIF, Toll/IL-1R domain-containing adaptor-inducing IFN-β; WT, wild type.

  • Received March 11, 2009.
  • Accepted April 29, 2009.
  • Copyright © 2009 by The American Association of Immunologists, Inc.

References

  1. ↵
    Underhill, D. M., A. Ozinsky. 2002. Phagocytosis of microbes: complexity in action. Annu. Rev. Immunol. 20: 825-852.
    OpenUrlCrossRefPubMed
  2. ↵
    Kawai, T., S. Akira. 2007. Signaling to NF-κB by Toll-like receptors. Trends Mol. Med. 13: 460-469.
    OpenUrlCrossRefPubMed
  3. ↵
    Takeda, K., S. Akira. 2005. Toll-like receptors in innate immunity. Int. Immunol. 17: 1-14.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Shin, O. S., R. R. Isberg, S. Akira, S. Uematsu, A. K. Behera, L. T. Hu. 2008. Distinct roles for MyD88 and Toll-like receptors 2, 5, and 9 in phagocytosis of Borrelia burgdorferi and cytokine induction. Infect. Immun. 76: 2341-2351.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Doyle, S. E., R. M. O'Connell, G. A. Miranda, S. A. Vaidya, E. K. Chow, P. T. Liu, S. Suzuki, N. Suzuki, R. L. Modlin, W. C. Yeh, et al 2004. Toll-like receptors induce a phagocytic gene program through p38. J. Exp. Med. 199: 81-90.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Maganto-Garcia, E., C. Punzon, C. Terhorst, M. Fresno. 2008. Rab5 activation by Toll-like receptor 2 is required for Trypanosoma cruzi internalization and replication in macrophages. Traffic 9: 1299-1315.
    OpenUrlCrossRefPubMed
  7. ↵
    Kong, L., B. X. Ge. 2008. MyD88-independent activation of a novel actin-Cdc42/Rac pathway is required for Toll-like receptor-stimulated phagocytosis. Cell Res. 18: 745-755.
    OpenUrlCrossRefPubMed
  8. ↵
    Blander, J. M., R. Medzhitov. 2004. Regulation of phagosome maturation by signals from toll-like receptors. Science 304: 1014-1018.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Laroux, F. S., X. Romero, L. Wetzler, P. Engel, C. Terhorst. 2005. Cutting edge: MyD88 controls phagocyte NADPH oxidase function and killing of Gram-negative bacteria. J. Immunol. 175: 5596-5600.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Yates, R. M., D. G. Russell. 2005. Phagosome maturation proceeds independently of stimulation of Toll-like receptors 2 and 4. Immunity 23: 409-417.
    OpenUrlCrossRefPubMed
  11. ↵
    Leadbetter, E. A., I. R. Rifkin, A. M. Hohlbaum, B. C. Beaudette, M. J. Shlomchik, A. Marshak-Rothstein. 2002. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416: 603-607.
    OpenUrlCrossRefPubMed
  12. ↵
    Swanson, M. S., R. R. Isberg. 1995. Association of Legionella pneumophila with the macrophage endoplasmic reticulum. Infect. Immun. 63: 3609-3620.
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Hu, L. T., G. Perides, R. Noring, M. S. Klempner. 1995. Binding of human plasminogen to Borrelia burgdorferi. Infect. Immun. 63: 3491-3496.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Behera, A. K., C. M. Thorpe, J. M. Kidder, W. Smith, E. Hildebrand, L. T. Hu. 2004. Borrelia burgdorferi-induced expression of matrix metalloproteinases from human chondrocytes requires mitogen-activated protein kinase and Janus kinase/signal transducer and activator of transcription signaling pathways. Infect. Immun. 72: 2864-2871.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Shin, O. S., A. K. Behera, R. T. Bronson, L. T. Hu. 2007. Role of novel protein kinase C isoforms in Lyme arthritis. Cell. Microbiol. 9: 1987-1996.
    OpenUrlCrossRefPubMed
  16. ↵
    Arbibe, L., J. P. Mira, N. Teusch, L. Kline, M. Guha, N. Mackman, P. J. Godowski, R. J. Ulevitch, U. G. Knaus. 2000. Toll-like receptor 2-mediated NF-κB activation requires a Rac1-dependent pathway. Nat. Immunol. 1: 533-540.
    OpenUrlCrossRefPubMed
  17. ↵
    Fitzgerald, K. A., E. M. Palsson-McDermott, A. G. Bowie, C. A. Jefferies, A. S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M. T. Harte, et al 2001. Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction. Nature 413: 78-83.
    OpenUrlCrossRefPubMed
  18. ↵
    Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis. 1999. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol. 163: 2382-2386.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Corradin, S. B., Y. Buchmuller-Rouiller, J. Mauel. 1991. Phagocytosis enhances murine macrophage activation by interferon-γ and tumor necrosis factor-α. Eur. J. Immunol. 21: 2553-2558.
    OpenUrlCrossRefPubMed
  20. ↵
    Wang, E., J. Michl, L. M. Pfeffer, S. C. Silverstein, I. Tamm. 1984. Interferon suppresses pinocytosis but stimulates phagocytosis in mouse peritoneal macrophages: related changes in cytoskeletal organization. J. Cell Biol. 98: 1328-1341.
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Takeda, K., S. Akira. 2004. TLR signaling pathways. Semin. Immunol. 16: 3-9.
    OpenUrlCrossRefPubMed
  22. ↵
    Behera, A. K., E. Hildebrand, R. T. Bronson, G. Perides, S. Uematsu, S. Akira, L. T. Hu. 2006. MyD88 deficiency results in tissue-specific changes in cytokine induction and inflammation in interleukin-18-independent mice infected with Borrelia burgdorferi. Infect. Immun. 74: 1462-1470.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Miller, L. S., R. M. O'Connell, M. A. Gutierrez, E. M. Pietras, A. Shahangian, C. E. Gross, A. Thirumala, A. L. Cheung, G. Cheng, R. L. Modlin. 2006. MyD88 mediates neutrophil recruitment initiated by IL-1R but not TLR2 activation in immunity against Staphylococcus aureus. Immunity 24: 79-91.
    OpenUrlCrossRefPubMed
  24. ↵
    Anguita, J., S. W. Barthold, R. Persinski, M. N. Hedrick, C. A. Huy, R. J. Davis, R. A. Flavell, E. Fikrig. 2002. Murine Lyme arthritis development mediated by p38 mitogen-activated protein kinase activity. J. Immunol. 168: 6352-6357.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Izadi, H., A. T. Motameni, T. C. Bates, E. R. Olivera, V. Villar-Suarez, I. Joshi, R. Garg, B. A. Osborne, R. J. Davis, M. Rincon, J. Anguita. 2007. c-Jun N-terminal kinase 1 is required for Toll-like receptor 1 gene expression in macrophages. Infect. Immun. 75: 5027-5034.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Brown, C. R., V. A. Blaho, K. L. Fritsche, C. M. Loiacono. 2006. Stat1 deficiency exacerbates carditis but not arthritis during experimental Lyme borreliosis. J. Interferon Cytokine Res. 26: 390-399.
    OpenUrlCrossRefPubMed
  27. ↵
    Cox, D., C. C. Tseng, G. Bjekic, S. Greenberg. 1999. A requirement for phosphatidylinositol 3-kinase in pseudopod extension. J. Biol. Chem. 274: 1240-1247.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Araki, N., M. T. Johnson, J. A. Swanson. 1996. A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages. J. Cell Biol. 135: 1249-1260.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Gold, E. S., D. M. Underhill, N. S. Morrissette, J. Guo, M. A. McNiven, A. Aderem. 1999. Dynamin 2 is required for phagocytosis in macrophages. J. Exp. Med. 190: 1849-1856.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Martin, M., K. Rehani, R. S. Jope, S. M. Michalek. 2005. Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat. Immunol. 6: 777-784.
    OpenUrlCrossRefPubMed
  31. ↵
    Laird, M. H., S. H. Rhee, D. J. Perkins, A. E. Medvedev, W. Piao, M. J. Fenton, and S. N. Vogel. 2009. TLR4/MyD88/PI3K interactions regulate TLR4 signaling. J. Leukocyte Biol. In press.
  32. ↵
    Wrann, C. D., N. A. Tabriz, T. Barkhausen, A. Klos, M. van Griensven, H. C. Pape, D. O. Kendoff, R. Guo, P. A. Ward, C. Krettek, N. C. Riedemann. 2007. The phosphatidylinositol 3-kinase signaling pathway exerts protective effects during sepsis by controlling C5a-mediated activation of innate immune functions. J. Immunol. 178: 5940-5948.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    DeMali, K. A., K. Burridge. 2003. Coupling membrane protrusion and cell adhesion. J. Cell Sci. 116: 2389-2397.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    Bosse, T., J. Ehinger, A. Czuchra, S. Benesch, A. Steffen, X. Wu, K. Schloen, H. H. Niemann, G. Scita, T. E. Stradal, C. Brakebusch, K. Rottner. 2007. Cdc42 and phosphoinositide 3-kinase drive Rac-mediated actin polymerization downstream of c-Met in distinct and common pathways. Mol. Cell. Biol. 27: 6615-6628.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    DeMali, K. A., C. A. Barlow, K. Burridge. 2002. Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J. Cell Biol. 159: 881-891.
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Goley, E. D., M. D. Welch. 2006. The ARP2/3 complex: an actin nucleator comes of age. Nat. Rev. Mol. Cell Biol. 7: 713-726.
    OpenUrlCrossRefPubMed
  37. ↵
    Egile, C., T. P. Loisel, V. Laurent, R. Li, D. Pantaloni, P. J. Sansonetti, M. F. Carlier. 1999. Activation of the CDC42 effector N-WASP by the Shigella flexneri IcsA protein promotes actin nucleation by Arp2/3 complex and bacterial actin-based motility. J. Cell Biol. 146: 1319-1332.
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Alrutz, M. A., A. Srivastava, K. W. Wong, C. D'Souza-Schorey, M. Tang, L. E. Ch'Ng, S. B. Snapper, R. R. Isberg. 2001. Efficient uptake of Yersinia pseudotuberculosis via integrin receptors involves a Rac1-Arp 2/3 pathway that bypasses N-WASP function. Mol. Microbiol. 42: 689-703.
    OpenUrlCrossRefPubMed
  39. ↵
    Portnoy, D. A., R. D. Schreiber, P. Connelly, L. G. Tilney. 1989. Gamma interferon limits access of Listeria monocytogenes to the macrophage cytoplasm. J. Exp. Med. 170: 2141-2146.
    OpenUrlAbstract/FREE Full Text
  40. ↵
    Tachado, S. D., M. M. Samrakandi, J. D. Cirillo. 2008. Non-opsonic phagocytosis of Legionella pneumophila by macrophages is mediated by phosphatidylinositol 3-kinase. PLoS ONE 3: e3324
    OpenUrlCrossRefPubMed
  41. ↵
    Braun, L., H. Ohayon, P. Cossart. 1998. The InIB protein of Listeria monocytogenes is sufficient to promote entry into mammalian cells. Mol. Microbiol. 27: 1077-1087.
    OpenUrlCrossRefPubMed
  42. ↵
    Forney, J. R., D. B. DeWald, S. Yang, C. A. Speer, M. C. Healey. 1999. A role for host phosphoinositide 3-kinase and cytoskeletal remodeling during Cryptosporidium parvum infection. Infect. Immun. 67: 844-852.
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Coombes, B. K., J. B. Mahony. 2002. Identification of MEK- and phosphoinositide 3-kinase-dependent signalling as essential events during Chlamydia pneumoniae invasion of HEp2 cells. Cell. Microbiol. 4: 447-460.
    OpenUrlCrossRefPubMed
  44. ↵
    Wang, K. Z., N. Wara-Aswapati, J. A. Boch, Y. Yoshida, C. D. Hu, D. L. Galson, P. E. Auron. 2006. TRAF6 activation of PI3-kinase-dependent cytoskeletal changes is cooperative with Ras and is mediated by an interaction with cytoplasmic Src. J. Cell Sci. 119: 1579-1591.
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Coppolino, M. G., R. Dierckman, J. Loijens, R. F. Collins, M. Pouladi, J. Jongstra-Bilen, A. D. Schreiber, W. S. Trimble, R. Anderson, S. Grinstein. 2002. Inhibition of phosphatidylinositol-4-phosphate 5-kinase Iα impairs localized actin remodeling and suppresses phagocytosis. J. Biol. Chem. 277: 43849-43857.
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Linder, S., C. Heimerl, V. Fingerle, M. Aepfelbacher, B. Wilske. 2001. Coiling phagocytosis of Borrelia burgdorferi by primary human macrophages is controlled by CDC42Hs and Rac1 and involves recruitment of Wiskott-Aldrich syndrome protein and Arp2/3 complex. Infect. Immun. 69: 1739-1746.
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Forsberg, M., R. Blomgran, M. Lerm, E. Sarndahl, S. M. Sebti, A. Hamilton, O. Stendahl, L. Zheng. 2003. Differential effects of invasion by and phagocytosis of Salmonella typhimurium on apoptosis in human macrophages: potential role of Rho-GTPases and Akt. J. Leukocyte Biol. 74: 620-629.
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Kim, S., M. Watarai, S. Makino, T. Shirahata. 2002. Membrane sorting during swimming internalization of Brucella is required for phagosome trafficking decisions. Microb. Pathog. 33: 225-237.
    OpenUrlCrossRefPubMed
  49. ↵
    Rittig, M. G., A. Krause, T. Haupl, U. E. Schaible, M. Modolell, M. D. Kramer, E. Lutjen-Drecoll, M. M. Simon, G. R. Burmester. 1992. Coiling phagocytosis is the preferential phagocytic mechanism for Borrelia burgdorferi. Infect. Immun. 60: 4205-4212.
    OpenUrlAbstract/FREE Full Text
  50. ↵
    Montgomery, R. R., S. E. Malawista. 1996. Entry of Borrelia burgdorferi into macrophages is end-on and leads to degradation in lysosomes. Infect. Immun. 64: 2867-2872.
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top

In this issue

The Journal of Immunology: 183 (1)
The Journal of Immunology
Vol. 183, Issue 1
1 Jul 2009
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Advertising (PDF)
  • Back Matter (PDF)
  • Editorial Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word about The Journal of Immunology.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Downstream Signals for MyD88-Mediated Phagocytosis of Borrelia burgdorferi Can Be Initiated by TRIF and Are Dependent on PI3K
(Your Name) has forwarded a page to you from The Journal of Immunology
(Your Name) thought you would like to see this page from the The Journal of Immunology web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Downstream Signals for MyD88-Mediated Phagocytosis of Borrelia burgdorferi Can Be Initiated by TRIF and Are Dependent on PI3K
Ok S. Shin, Lloyd S. Miller, Robert L. Modlin, Shizuo Akira, Satoshi Uematsu, Linden T. Hu
The Journal of Immunology July 1, 2009, 183 (1) 491-498; DOI: 10.4049/jimmunol.0900724

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Downstream Signals for MyD88-Mediated Phagocytosis of Borrelia burgdorferi Can Be Initiated by TRIF and Are Dependent on PI3K
Ok S. Shin, Lloyd S. Miller, Robert L. Modlin, Shizuo Akira, Satoshi Uematsu, Linden T. Hu
The Journal of Immunology July 1, 2009, 183 (1) 491-498; DOI: 10.4049/jimmunol.0900724
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Disclosures
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

More in this TOC Section

  • Early Self-Regulatory Mechanisms Control the Magnitude of CD8+ T Cell Responses Against Liver Stages of Murine Malaria
  • Sublethal Hyperoxia Impairs Pulmonary Innate Immunity
  • Dependence of IL-4, IL-13, and Nematode-Induced Alterations in Murine Small Intestinal Smooth Muscle Contractility on Stat6 and Enteric Nerves
Show more HOST DEFENSE

Similar Articles

Navigate

  • Home
  • Current Issue
  • Next in The JI
  • Archive
  • Brief Reviews
  • Pillars of Immunology
  • Translating Immunology

For Authors

  • Submit a Manuscript
  • Instructions for Authors
  • About the Journal
  • Journal Policies
  • Editors

General Information

  • Advertisers
  • Subscribers
  • Rights and Permissions
  • Accessibility Statement
  • FAR 889
  • Privacy Policy
  • Disclaimer

Journal Services

  • Email Alerts
  • RSS Feeds
  • ImmunoCasts
  • Twitter

Copyright © 2022 by The American Association of Immunologists, Inc.

Print ISSN 0022-1767        Online ISSN 1550-6606