Anti-CD25 Antibody-Mediated Depletion of Effector T Cell Populations Enhances Susceptibility of Mice to Acute but Not Chronic Toxoplasma gondii Infection

Mice

C57BL/6J, Thy1.1 C57BL/6 (B6), and bicistronic IFN-γ reporter (Yeti) male mice (25) were used between 6 and 12 wk of age. Mice were bred in the Trudeau Institute Animal Breeding Facility or obtained from The Jackson Laboratory or Taconic Farms. All experiments were reviewed and approved by the Trudeau Institute Institutional Animal Care and Use Committee. The Trudeau Institute is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care.

Parasites and infections

ME49 cysts were obtained from brains of chronically infected B6 mice. Infections were initiated by peroral administration of 10 cysts in 0.1 ml of diluted brain suspension as previously described (26). Sham-infected mice received similarly diluted brain suspension containing no cysts. Weight loss was monitored as a sign of morbidity and is expressed as the percentage of baseline starting weight. Mice were monitored daily for survival.

Ab treatments

Mice were given i.p. injections of 1 mg of anti-CD25 (clone PC61) or a control rat IgG (clone HRPN) obtained from BioXcell (previously BioExpress). Abs were administered 5–7 days before infection or during infection on days stated in the experiment. PC61 administration promoted long-lasting depletion/neutralization of CD25 expression (longer than 2 wk) in naive mice, consistent with previously published reports (27). Endotoxin levels of clones PC61 and HRPN were below 1 EU/mg.

Flow cytometry

Single cell suspensions were prepared from spleens, liver, blood, and mesenteric lymph nodes. Brains were gently mashed using a Teflon pestle, cell populations separated on a Percoll gradient, and lymphocytes recovered for analysis. Cells were counted using a hemacytometer. The surface Ag phenotype was determined by flow cytometry using the following fluorochrome-conjugated Abs: anti-CD4 (clone GK1.5), anti-CD25 (clone PC61 or clone 7D4), or anti-CD44 (clone IM7). Cells were preincubated with Fc block (clone 2.4G2) before staining. All Abs were obtained from BD Biosciences. Foxp3 staining was performed using anti-Foxp3 (FJK-16s) Ab according to the manufacturer’s instructions (eBioscience). It is important to note that fluorochrome-labeled 7D4 was used for flow cytometric detection of CD25 expression in all experiments in which PC61 was administered in vivo to deplete CD25-expressing cells; PC61 does not inhibit 7D4 detection of cell surface CD25 (27).

Isolation of CD4⁺CD25⁻ and CD4⁺CD25^high T cells

CD4⁺ T cells were purified from the spleens and brains of C57BL/6 mice using anti-CD4 MidiMacs beads according to the manufacturer’s instructions (Miltenyi Biotec). Following separation, CD4⁺ cells were stained with anti-CD4 (GK1.5) and anti-CD25 (PC61) and sorted into CD4⁺CD25⁻ and CD4⁺CD25^high populations using a FACSVantage cell sorter. The sorted cell populations were routinely >99% pure.

In vitro restimulation experiments

CD4⁺CD25^high and CD4⁺CD25⁻ cells, obtained as described, were cultured individually or at a ratio of 1:1. Cells were either stimulated with naive APCs and anti-CD3 Ab (1 μg/ml) or with T. gondii-pulsed APC (without anti-CD3 Ab costimulation). APCs were prepared by gamma irradiation (3000 rad) of spleen cells obtained from naive B6 mice. Separately, T. gondii primed APC were prepared to measure parasite-specific T cell responses. RH strain tachyzoites, maintained through continuous in vitro culture in fibroblast monolayers, were irradiated at 15,000 rad and added to APC generated from naive mice as indicated. Irradiated tachyzoites and APC were cultured for 12 h at 5% CO₂ and 37°C before being washed and added at required cell concentration to wells including purified CD4⁺ cells. The cells were then incubated at 5% CO₂ and 37°C for 60 h. Supernatants were then harvested to assay cytokine production and proliferation was determined by pulsing cells with 0.2 μCu/well [³H]thymidine (Amersham Biosciences) for an extra 12 h. [³H]Thymidine incorporation and proliferation was measured using a beta counter.

ELISA and real-time PCR

Serum IFN-γ levels were measured by ELISA as previously described (18). Tachyzoites were quantified by a real-time PCR-based method (28) based on the expression of the tachyzoite-limited Sag1 gene (29). RNA was isolated from tissues, cDNA prepared, amplified, and quantitated using the following primer to probe sets: T. gondii Sag1 (forward) TTTCCGAAGGCAGTGAGACG, (reverse) GGATCCGATGCCATAGCG, probe TTGCCGCGCCCACACTGATG; IFN-γ (forward) CATTGAAAGCCTAGAAAGTCTGAATAAC, (reverse) TGGCTCTGCAGGATTTTCATG, probe TCACCATCCTTTTGCCAGTTCCTCCAG; IL-10 (forward) GAAGACCCTCAGGATGCGG, (reverse) ACCTGCTCCACTGCCTTGCT, probe TGAGGCGCTGTCATCGATTTCTCCC; Foxp3 (forward) CCCAGGAAAGACAGCAACCTT, (reverse) TTCTCACAACCAGGCCACTTG, probe ATCCTACCCACTGCTGGCAAATGGAGTC; and GAPDH (forward) CTCGTCCCGTAGACAAAATGG, (reverse) AATCTCCACTTTGCCACTGCA, probe CGGATTTGGCCGTATTGGGCG. Values were normalized to GAPDH expression. IFN-γ message levels in brain are shown as fold change (log₁₀) relative to control mAb-treated infected mice. Tachyzoite numbers were calculated relative to a standard curve generated by inoculating known numbers of tachyzoites into uninfected liver samples.

Histological exam

On day 8 postinfection, livers and ileums from anti-CD25 Ab-treated mice and control Ab-treated mice were removed and processed for H&E staining. Liver and ileal lesions were semiquantitatively scored based on our previous scoring systems (28, 30) as follows: liver damage 1, degeneration and necrosis of individual hepatocytes occasionally seen; 2, clusters or small aggregates of hepatocyte degeneration and necrosis; 3, medium to large aggregates of hepatocyte necrosis; 4, large areas of hepatocyte necrosis with loss of normal liver anatomic architecture; intensity of the inflammatory response: 1, small inflammatory infiltrates with a few inflammatory cells; 2, medium-sized inflammatory infiltrates with a small to moderate number of inflammatory cells; 3, large inflammatory infiltrates with a moderate to large number of inflammatory cells; 4, extensive infiltration with a large number of inflammatory cells. The ileal lesions were scored for the degeneration and necrosis of villous epithelial cells, transmural inflammation, and lamina propria and crypt inflammation and an integer score between 0 (unremarkable) and 4 (severe) was assigned.

Statistics

Unless otherwise noted, group means were compared by Student’s t test. Intergroup survivals were compared by log-rank test. All statistical analyses were performed using GraphPad Prism software.

Anti-CD25 Ab increases susceptibility of mice to late acute T. gondii infection

The administration of anti-CD25 Ab (clone PC61) significantly increased the susceptibility of mice to acute oral T. gondii infection (Fig. 1⇓). The majority of C57BL/6 mice treated with PC61 succumbed to infection by day 20 of infection, and this correlated with a biphasic modulation of weight loss (Fig. 1⇓, A and B). PC61 pretreated mice exhibited reduced weight loss during early acute T. gondii infection, with significant differences compared with control Ab treated mice on days 6–8 of infection (p < 0.01). However, in contrast to control Ab-treated mice that survived acute infection and recovered weight, PC61-treated mice were unable to resolve the acute infection and exhibited significantly elevated weight loss during mid to late acute infection on days 15–18 (p < 0.05) (Fig. 1⇓A). These data are consistent with previous studies in which the depletion of proinflammatory CD4⁺ T cells ameliorated weight loss and pathology during early acute infection but caused enhanced weight loss during late acute infection (31). Surviving PC61 pretreated mice also harbored significantly increased brain cyst numbers compared with control mice on day 30 postinfection (p < 0.033) (Fig. 1⇓C).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Anti-CD25 Ab administration significantly modulates the outcome of acute T. gondii infection. Groups of five B6 males were given 1 mg of control mAb (clone HRPN) or anti-CD25 (clone PC61) 5 or 7 days before oral infection with 10 ME49 cysts. A, Changes in body weight were monitored and are presented as a percentage change relative to starting weight. Data show mean ± SD. ∗, p < 0.05 for significant difference. B, Compiled survival data from three experiments comparing anti-CD25-treated with control T. gondii-infected B6 male mice. Survivals differed significantly (p < 0.01) by log-rank test. C, Brain cysts of three anti-CD25-treated B6 male mice, and five controls 28 days after mice were sham-infected or infected with 10 ME49 cysts. Horizontal bar denotes median values. D, On day 8 postinfection, livers and ileums were removed and stained with H & E for histological examination of tissue pathology with arrows marking areas of inflammation or necrosis (also marked by an asterisk). E and F, On day 8 postinfection, livers (E) and ileums (F) were removed for real-time PCR (Taqman) quantification of tissue parasite burdens. Results shown are mean ± SD of the group (n = 5) and are representative of two independent experiments. ∗∗, p < 0.01.

Anti-CD25 Abs modulate development of immune-mediated pathology and significantly impair parasite control during acute T. gondii infection

As anti-CD25 Ab administration elevated mortality, modulated weight loss, and increased brain cyst numbers, we next examined whether anti-CD25 Ab administration impeded tachyzoite control or limited acute stage immunopathology. In agreement with this hypothesis, we observed significantly reduced liver pathology in anti-CD25 Ab-treated mice compared with control Ab-treated mice on day 8 of infection, with ameliorated inflammatory cell infiltration (predominantly mononuclear cells and neutrophils) throughout the parenchymal and portal areas and significantly reduced levels of hepatic coagulation necrosis (Fig. 1⇑D and Table I⇓). In addition, moderately severe perivasculitis, vasculitis, and fibrinous thrombosis was observed in medium to large blood vessels of control Ab-treated mice, which was relatively absent in anti-CD25 Ab-treated mice (Fig. 1⇑D). Nevertheless, parasite control in the liver was relatively unaffected by anti-CD25 Ab treatment, as comparable tachyzoite numbers were observed in control Ab- and PC61-treated mice on day 8 postinfection (Fig. 1⇑E), indicating that parasite control in the liver during early acute T. gondii infection is CD25-independent. In contrast, significantly elevated pathology was observed in the ileum of anti-CD25 Ab-treated mice compared with control Ab-treated mice on day 8 postinfection; extensive infiltration of a moderate number of mononuclear cells was observed in the lamina propria of anti-CD25 Ab-treated mice, which was absent in control Ab-treated mice (Fig. 1⇑D and Table I⇓). Elevated pathology was directly correlated with increased parasite burdens in the ileum of anti-CD25 Ab-treated mice on day 8 postinfection (Fig. 1⇑F), suggesting that the failure of parasite control, rather than partial depletion or inactivation of natural Tregs following anti-CD25 Ab administration, was responsible for the increased pathology evident in the ileum. Combined, these data highlight the pathological role of CD25-expressing effector cells in mediating hepatic pathology during early acute T. gondii infection and demonstrate the importance of CD25-expressing effector cells for control of T. gondii parasites in the ileum during the acute stage of infection.

CD25 is transiently up-regulated on CD4 T cells during acute T. gondii infection

To examine the kinetics of CD25 expression during T. gondii infection, to establish when it is up-regulated and on which cells, we determined the expression level of CD25 on CD4⁺ and CD8⁺ splenic lymphocytes on various days during acute T. gondii infection. Fig. 2⇓A shows the marked increase between days 4 and 12 of infection in both the absolute number of total splenic CD4⁺ T cells and the number of splenic CD4⁺ T cells expressing high levels of CD25. A similar transient up-regulation of CD25 on splenic CD8⁺ T cells was also observed between days 4 and 12 of infection, before absolute numbers of splenic CD8⁺ T cells and CD8+CD25^high T cells returned to baseline preinfection levels (results not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Transient up-regulation of CD25 on effector T cells during acute T. gondii infection. A, Total number of splenic CD4⁺ T cell and CD4⁺CD25^high T cells was calculated on selected days following oral T. gondii infection. CD25 detection was performed using the clone PC61 anti-CD25 Ab. Error bar shows mean ± SD. Number above bar for CD4⁺CD25^high cells indicates the percentage of that population within the total CD4⁺ T cell population. B, Cell sorted Thy1.1⁺CD4⁺CD25⁻ cells were adoptively transferred into Thy1.2⁺ B6 mice before oral T. gondii infection. The frequency of adoptively transferred donor cells expressing CD25 in the spleen was determined on selected days postinfection. C and D, In a separate experiment, groups of five B6 males were infected as in A, and spleens harvested on day 8 to analyze the percentage of CD4⁺CD25^high cells that coexpressed Foxp3. The number of CD4⁺CD25^high cells and CD4⁺Foxp3⁺ cells (C) and representative dot plots (D) gating on CD4⁺ T cells showing CD25 expression vs Foxp3 expression in naive and T. gondii-infected mice. Mean + SD is indicated for CD4⁺ populations. ∗, p < 0.01.

The expansion of CD4⁺ T cells expressing CD25 during acute T. gondii infection could potentially have been due to either the proliferation of CD4⁺CD25^high Tregs (present in naive mice) or due to the up-regulation of CD25 on activated precursor CD25⁻ naive CD4⁺ T cells. Thus, to investigate the ability of CD4⁺CD25⁻ T cells to up-regulate CD25 during acute T. gondii infection we purified and adoptively transferred Thy1.1⁺CD4⁺CD25⁻ cells into congenic Thy1.2⁺ mice before oral T. gondii infection. Importantly, significant up-regulation of CD25 expression was observed on the CD4⁺CD25⁻ donor T cell population (Fig. 2⇑B). Moreover, the kinetics (and magnitude) of CD25 up-regulation on the donor CD4⁺ T cells mirrored the up-regulation of CD25 in the total CD4⁺ T cell population in wild-type mice (Fig. 2⇑A), indicating that CD4⁺CD25⁻ cells are the primary precursor cells of the CD4⁺CD25^high cells generated during acute T. gondii infection.

Although there were significantly more CD4⁺CD25^high spleen cells in infected mice than in sham-infected mice on day 8 postinfection, there was no significant difference in the number of total CD4⁺Foxp3⁺ cells, or the number of CD4⁺Foxp3⁺ cells expressing CD25 (Fig. 2⇑C), suggesting that the majority of CD4⁺CD25^high T cells were not Tregs, as shown from day 8 of infection (Fig. 2⇑D). Moreover, a significant number of CD4⁺Foxp3⁺ cells were found within the CD25^low subset of CD4⁺ cells, revealing the presence of Foxp3⁺CD25⁻ Tregs during T. gondii infection and in naive uninfected mice (Fig. 2⇑C).

CD4⁺CD25^high T cells are primarily effector T cells during acute T. gondii infection

It is well established that CD4⁺CD25^high T cells derived from naive mice express high levels of Foxp3 and exhibit potent regulatory capabilities. In contrast, extremely strong systemic proinflammatory immune responses develop during T. gondii infection and the majority of CD4⁺CD25^high cells do not express Foxp3 (Fig. 2⇑), indicating that these cells may exert effector rather than regulatory functions. To address this likelihood, we purified CD4⁺CD25⁻ and CD4⁺CD25^high cells from uninfected mice and mice acutely infected with T. gondii and assessed the ability of these cells to respond to mitogenic (anti-CD3) and T. gondii Ag-specific stimulation. As expected, CD4⁺CD25^high cells derived from uninfected mice closely matched the functional characteristics of natural Tregs; they failed to produce IFN-γ or proliferate following mitogenic stimulation and suppressed proliferation and IFN-γ production by CD4⁺CD25⁻ cells (p < 0.05) (Fig. 3⇓, A and B). Conversely, CD4⁺CD25^high cells derived from acutely infected mice failed to suppress CD4⁺CD25⁻ cell responses, produced significant quantities of IFN-γ and proliferated rapidly following mitogenic and T. gondii antigenic challenge (Fig. 3⇓, C–F). Importantly, CD4⁺CD25^high T cells derived from acutely infected mice produced more IFN-γ and proliferated more rapidly than infection-derived CD4⁺CD25⁻ cells following specific T. gondii stimulation (Fig. 3⇓, E and F), suggesting that during acute T. gondii infection, the majority of parasite-specific effector CD4⁺ T cells are found within the CD4⁺CD25^high T cell population.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

CD4⁺ T cells that up-regulate CD25 expression during acute T. gondii infection are Th1 effector cells that produce high levels of IFN-γ. CD4⁺CD25⁻ and CD4⁺CD25^high splenic T cells were sort purified from naive mice (A and B) or T. gondii-infected mice (B–F) (day 10 of infection). CD25 detection was performed using the PC61 clone anti-CD25 Ab. CD4⁺CD25⁻ and CD4⁺CD25^high cells were cultured with naive APC and anti-CD3 Ab (A–D) or T. gondii-pulsed APC (E and F). A, C, and E, IFN-γ production was assayed in supernatant by ELISA. B, D, and F, Proliferation was determined by [³H]thymidine incorporation. Results shown are the mean ± SD of the group (n = 3) and are representative of two independent experiments. #, p < 0.05 for significant difference between CD4⁺CD25⁻ and CD4⁺CD25^high cultures. ∗, p < 0.05 for significant difference between CD4⁺CD25⁻ and CD4⁺CD25⁻ and CD4⁺CD25^high cocultures.

Reduced numbers of effector T cells and suppressed IFN-γ production in anti-CD25 Ab-treated T. gondii-infected mice

Numerous studies have shown that anti-CD25 Ab (clone PC61) treatment leaves mice essentially devoid of cells expressing CD25 for an extended period (27, 32), an observation we confirm in this study during T. gondii infection (Fig. 4⇓); CD25 expressing splenic CD4⁺ T cells were almost completely undetectable following anti-CD25 Ab administration (detection day 9 postinfection with Ab injected i.p. 4 days before infection) (Fig. 4⇓A). These results were largely reproduced when examining mesenteric lymph node cells (data not shown). Importantly, and consistent with previous reports (27, 32), PC61 administration failed to induce complete depletion of Foxp3⁺ Tregs, instead promoting a maximal 40% reduction in Foxp3-expressing cell numbers (Fig. 4⇓, B and C). As we have demonstrated that during acute stage T. gondii infection the overwhelming majority of CD4CD25^high cells display effector rather than regulatory characteristics, these results directly indicate that anti-CD25 Abs primarily deplete effector T cells during T. gondii infection. In agreement, anti-CD25 Abs principally targeted activated T cell populations, as shown by the significant decrease in the number of CD4⁺ T cells expressing high levels of the activation marker CD44 following PC61 administration (28.9 ± 11.6 × 10⁶ in control mAb-treated vs 13.3 ± 4.5 × 10⁶ in anti-CD25-treated) (Fig. 4⇓A).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Anti-CD25 administration depletes activated CD25⁺ T cells and significantly reduces IFN-γ production. Groups of five B6 males were administered 1 mg of anti-CD25 (clone PC61) or control mAb (clone HRPN) i.p. 5 days before oral infection with 10 ME49 cysts. A, The number of splenic-activated CD4⁺ T cells were calculated on day 9 postinfection by measuring CD25 and CD44 expression. CD25 detection was performed using the 7D4 clone anti-CD25 Ab. B, Representative dot plots showing Foxp3 expression on splenic CD4⁺ T cells on day 8 postinfection. C, The number of splenic CD4⁺Foxp3⁺ cells on day 8 postinfection in control Ab- and anti-CD25 Ab-treated mice. D–F, The level of IFN-γ and IL-10 in PC61- and HRPN-treated mice was determined on day 9 postinfection in plasma (D) by ELISA and in liver (E and F) by real-time PCR (Taqman). Results shown are mean ± SD of the group (n = 5) and are representative of two independent experiments. ∗, p < 0.05; ∗∗, p < 0.01.

Consequently, to examine whether the depressed effector T cell responses observed during T. gondii infection following anti-CD25 Ab administration correlated with a functional defect in proinflammatory immune responses, we next determined the levels of the prototypic type I cytokine IFN-γ in T. gondii-infected mice treated with anti-CD25 Abs. Our results show that PC61 administration reduced systemic plasma IFN-γ levels (detected on day 8 postinfection) compared with control Ab-treated infected mice (Fig. 4⇑D). Although the reduction in IFN-γ production failed to reach statistical significance in any individual experiments, a reproducible reduction in IFN-γ production was observed in four separate experiments, with the percentage of reductions relative to controls of 11, 20, 27, and 52%. Furthermore, the reduced serum IFN-γ levels were paralleled by significantly reduced levels of IFN-γ mRNA in the liver of anti-CD25 Ab-treated mice on day 8 postinfection (Fig. 4⇑E).

CD4⁺ T cells, specifically Th1 cells that express T-bet and coproduce IFN-γ, have also been shown to be the primary source of host-protective IL-10 during T. gondii infection (33). Importantly, however, the expression level of IL-10 mRNA in the liver was comparable in anti-CD25 Ab- and control-treated mice (Fig. 4⇑F), indicating that the regulatory IL-10 response was largely intact in anti-CD25 Ab-treated mice. Combined, these data definitively demonstrate that in vivo administration of anti-CD25 Abs can negatively effect proinflammatory immune responses during an inflammatory disorder, and that CD25 expression is up-regulated on T. gondii-specific activated effector T cells, which are required for effective proinflammatory type 1 responses.

Anti-CD25 Ab administration suppresses IFN-γ production by CD4⁺ T cells

To examine the T cell populations affected by anti-CD25 Ab administration leading to impaired IFN-γ expression, we used IFN-γ bicistronic reporter mice (YETI) (25), enabling the detection and quantification of cell-specific IFN-γ production directly ex vivo, negating the requirement for subsequent restimulation in vitro. Importantly, yellow fluorescent protein (yFP) expression in YETI mice not only marks cells actively producing IFN-γ, but also marks cells that have expressed IFN-γ, providing an accurate representation of both current and historical cellular function (25). As expected, the majority of CD4⁺ T cells in naive mice were found to be yFP-negative (25), indicating that few CD4⁺ T cells were polarized type 1 effector/memory cells (Fig. 5⇓A). The CD4⁺ yFP-positive cells found in liver, spleen, blood, and mesenteric lymph nodes in naive mice displayed heterogeneity in CD25 expression, suggesting the existence of a number of different populations of IFN-γ-producing CD4⁺ T cells at various stages of cellular activation. All yFP-positive cells irrespective of CD25 expression or tissue/organ location were, however, uniformly CD44^high (results not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Anti CD25 Ab administration suppresses IFN-γ production by CD4⁺ T cells. Groups of three bicistronic IFN-γ-enhanced yFP (IFN-γ-yFP) reporter male mice (Yeti) were given 1 mg of anti-CD25 (clone PC61) or control mAb (clone HRPN) i.p. 5 days before oral infection with brain homogenate containing 10 ME49 cysts or sham uninfected brain homogenate. A, Representative dot plots showing yFP expression relative to CD25 expression (using 7D4 to detect) on CD4⁺ T cells from spleen, mesenteric lymph, liver, and blood on day 8 postinfection. B, Relative frequency of CD4⁺ T cells expressing yFP in anti-CD25 Ab-treated and control Ab-treated T. gondii-infected and sham-infected mice on day 8 postinfection. Results shown are mean ± SD of the group (n = 3) and are representative of two independent experiments. ∗, p < 0.05.

In agreement with Fig. 2⇑, up-regulation of CD25 on CD4⁺ T cells was observed on day 8 postinfection in all tissues examined and this response correlated with significant up-regulation of yFP expression; importantly in all the tissues examined the majority of yFP-expressing CD4⁺ T cells coexpressed CD25 (Fig. 5⇑A). Thus, virtually all CD4⁺CD25^high cells derived from liver and blood were yFP-positive, marking CD4CD25^high cells as predominantly effector rather than Tregs in these tissues during acute T. gondii infection. In contrast, a number of CD4⁺CD25^high cells derived from spleen and mesenteric lymph nodes of T. gondii-infected mice did not coexpress yFP, suggesting that these cells are either Tregs or activated T cells that have failed to produce IFN-γ (Fig. 5⇑A). Irrespective of this finding, our results in Fig. 3⇑ clearly show that splenic CD4⁺CD25^high T cells predominantly exert effector rather than regulatory functionality during acute stage T. gondii infection.

In support of our hypothesis that anti-CD25 Ab administration directly suppresses proinflammatory protective immune responses during acute T. gondii infection, we observed significantly reduced frequency of yFP-positive CD4⁺ T cells in the liver, mesenteric lymph node, blood, and spleen of T. gondii-infected mice treated with anti-CD25 Abs as compared with control Ab-treated infected mice (Fig. 5⇑B). Similarly, significantly reduced frequency of yFP-positive CD8⁺ T cells were observed in the liver of T. gondii-infected mice treated with anti-CD25 Abs as compared with control Ab-treated infected mice (results not shown). In contrast anti-CD25 Ab administration did not significantly reduce yFP expression by CD8⁺ T cells in the spleen, mesenteric lymph node, or blood, suggesting that effector CD8⁺ T cells are less affected by anti-CD25 Ab than CD4⁺ T cells (results not shown).

Heterogeneous expression of yFP by CD4⁺ T cells occurs during T. gondii infection, as shown in infected, isotype control group (Fig. 5⇑) and as published in Mayer et al. (34). Importantly, the expression level of yFP is directly correlated to the capacity to produce IFN-γ following in vitro restimulation, with cells expressing highest levels of yFP capable of producing most IFN-γ protein (34). Interestingly, the highest level of yFP expression was routinely observed in CD4⁺ T cells expressing highest levels of CD25 (Fig. 5⇑A), marking these potent IFN-γ-producing cells as principal targets of anti-CD25 Abs. Thus, anti-CD25 Ab administration significantly reduced the yFP^high CD4⁺ T cell subsets in the liver and blood. A reduction in the frequency of yFP^high CD4⁺ T cells was also observed in the mesenteric lymph node and spleen, but the reduction failed to reach statistical significance (results not shown). Combined, these results demonstrate that anti-CD25 Abs can directly target effector IFN-γ-producing CD4⁺ T cells during acute T. gondii infection leading to systemic reductions in IFN-γ production and impaired protective T cell immunity.

Anti-CD25 Ab administration does not impair resistance to chronic stage T. gondii infection

It is well established that anti-parasitic CD4⁺ T cells and CD8⁺ T cells are required for the control of parasite reactivation in the brain and prevention of Toxoplasma encephalitis during chronic T. gondii infection (22). However, the activation status of these CD4⁺ and CD8⁺ T cells is relatively unknown. Consequently it is unclear whether protective CD4⁺ and CD8⁺ T cells in the spleen or brain express CD25 during chronic infection, and whether these cells may also be affected by anti-CD25 Ab administration. Additionally, it has previously been shown that natural Tregs that coexpress Foxp3 and CD25 can suppress protective immunity during a number of infections, including Leishmania major infection, enabling parasite persistence and the establishment of chronic infections (35, 36). Thus, CD25-expressing CD4⁺ T cells may also play an important regulatory role during chronic T. gondii infection, lowering proinflammatory responses, moderating immune-mediated pathology but impairing parasite control. As a result, anti-CD25 Ab administration during chronic T. gondii infection could potentially augment anti-parasitic immune responses and enhance parasite control. In support of this hypothesis, Foxp3 mRNA levels in the brain were increased during chronic infection compared with uninfected control levels (results not shown). Moreover, we have shown that CD25 up-regulation on effector T cells is transient during T. gondii infection and occurs primarily during the acute phase of infection, suggesting that CD4⁺CD25^high cells are functionally disparate during acute and chronic stages of T. gondii infection (Fig. 2⇑). In agreement with a regulatory rather than effector role of CD25-expressing cells during chronic infection, CD4⁺CD25^high cells isolated from both brain and spleen during chronic infection failed to produce significant quantities of IFN-γ following T. gondii antigenic restimulation (as compared with CD4⁺CD25⁻ cells) and splenic CD4⁺CD25^high cells moderately suppressed IFN-γ production by CD4⁺CD25⁻ cells (Fig. 6⇓, A and B).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Anti-CD25 Ab administration does not affect control of chronic T. gondii infection. A and B, CD4⁺CD25⁻ and CD4⁺CD25^high T cells were sort purified from spleen (A) or brain (B) of mice chronically infected with T. gondii (day 50 postinfection). CD4⁺CD25⁻ and CD4⁺CD25^high cells were cultured with T. gondii-pulsed APC for 60 h and IFN-γ production was assayed in supernatant by ELISA. Results shown are the mean ± SD of the group (n = 3) and are representative of two independent experiments. #, p < 0.05 for significant difference between CD4⁺CD25⁻ and CD4⁺CD25^high cultures. ∗, p < 0.05 for significant difference between CD4⁺CD25⁻ and CD4⁺CD25⁻ and CD4⁺CD25^high cocultures. C–F, The 1 mg of anti-CD25 Ab (clone PC61) or control Ab was administered to mice chronically infected with T. gondii (day 56 postinfection). C, At 5 days postantibody administration, the number of total brain CD4⁺ T cells, CD4CD25^high (using 7D4 to detect), and CD4⁺Foxp3⁺ cells were enumerated to determine the effectiveness of anti-CD25 Ab-mediated depletion. ∗, p < 0.05 for significant difference between control Ab- and anti-CD25 Ab-treated groups. Weight loss (D) and survival (E) were followed following Ab administration. Weight values are expressed as the percentage weight relative to preantibody administration (day 56 weights). ∗, p < 0.05 for significant difference between control Ab- and anti-CD25 Ab-treated groups. F, The effect of anti-CD25 Ab administration on brain parasite control and immune responses were determined 30 days postantibody administration by quantifying parasite (tachyzoite) and IFN-γ levels by real-time PCR. Results are shown as fold change relative to control Ab-treated mice. None of the differences were statistically significant in this or a replicate experiment.

To directly determine the relative importance of CD25-expressing natural Tregs during chronic T. gondii infection, we administered anti-CD25 Abs to chronically infected mice (day 56 postinfection) and determined whether Ab administration significantly modulated disease control. Anti-CD25 Ab administration effectively neutralized CD25 expression in the spleen (results not shown) and brain (Fig. 6⇑C) 5 and 10 days postadministration (days 5 and 10 postadministration were examined in separate experiments with results from day 5 postadministration shown). However, Foxp3 levels were not significantly reduced in anti-CD25 Ab-treated mice (Fig. 6⇑C). Importantly, it has previously been shown that Foxp3⁺ cells that survive anti-CD25 Ab treatment are functionally inactive (32), indicating that anti-CD25 Ab administration should still ablate Treg functionality during chronic T. gondii infection even if all Foxp3⁺ T cells are not eliminated. Nonetheless, Ab administration did not significantly alter the level of weight loss (relative to preantibody administration baseline levels) or mortality over a 30-day period posttreatment (Fig. 6⇑, D and E) and this correlated with unaltered parasite control (measuring invasive tachyzoite forms of parasite) and IFN-γ production in the brain of anti-CD25 Ab-treated mice compared with control treated groups (Fig. 6⇑F). Combined these results demonstrate that CD25-expressing natural Tregs do not suppress anti-parasitic immune responses during chronic T. gondii infection and are not required to limit excessive inflammation. In support of this conclusion, the frequency of CD4⁺Foxp3⁺ cells in the brain (of total CD4⁺ T cells) was not elevated in chronically infected mice compared with naive mice. Thus, the increase in brain Foxp3 mRNA expression during chronic infection is due to the increase in total CD4⁺ T cells that migrate to and reside in brains of chronically infected mice, rather than specific localization and migration of Tregs to the site of infection, as is observed during L. major infection (35).