Sequential Cooperation of CD2 and CD48 in the Buildup of the Early TCR Signalosome

Cells

The human Jurkat IL-2-Luc cells, stably transfected with an IL-2 promoter luciferase reporter construct, were a gift of Dr. Thomas Baumruker (Novartis Institutes for BioMedical Research, Vienna, Austria). The Jurkat T cell line E6.1 and the B cell line Raji were purchased from the American Type Culture Collection. Human PBMCs were isolated from blood of healthy donors by standard density-gradient centrifugation using Lymphoprep (Nycomed). Cells were maintained in RPMI 1640 medium (Sigma-Aldrich) supplemented with 100 μg/ml penicillin, 100 μg/ml streptomycin, 2 mM l-glutamine (Invitrogen), and 10% heat inactivated FCS (PAA). For Jurkat IL-2-Luc cells, 1 mg/ml G418 was added additionally. HEK 293T cells were maintained in DMEM (Sigma-Aldrich) supplemented with 100 μg/ml penicillin, 100 μg/ml streptomycin, 2 mM l-glutamine (Invitrogen), and 10% heat inactivated FCS (PAA). All cells were grown at 37°C and 5% CO₂ in a humidified atmosphere.

Antibodies

The mAbs to CD3 (MEM-57; IgG2a and MEM-92; IgM), CD48 (MEM-102; IgG1), CD59 (MEM-43/5; IgG2b), CD2 (MEM-65; IgG1), and MHC class II (MEM-136; IgG1) were a kind gift of Dr. Václav Hořejší (Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, Czech Republic); the anti-TCR β-chain mAb C305 (IgM) was provided by Dr. Arthur Weiss (University of California, San Francisco, CA). The mAb OKT3 to CD3 was obtained from Ortho Pharmaceuticals. The mAb Leu28 to CD28 was purchased from Becton Dickinson (BD Biosciences). The CD3 mAb UCH-T1 to the CD3 ε-chain was from Santa Cruz Biotechnology, rabbit polyclonal Abs to Lck and LAT and the anti-phosphotyrosine mAb 4G10 (HRP conjugated) were from Upstate Biotechnology. The mAb to phosphorylated Tyr 505 on Lck (pY505) was purchased from Cell Signaling Technology and Ab to pLAT was purchased from Biosource. Goat anti-rabbit IgG and rabbit anti-mouse IgG, both HRP conjugated, were from Bio-Rad and Sigma-Aldrich, respectively.

Immunoprecipitation and Western blotting

Jurkat T cells (5 × 10⁶ to 1 × 10⁷/ml) were lysed for 25 min at 4°C in ice-cold lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM EDTA and protease inhibitors (5 μM aprotinin, 5 μM leupeptin, 5 μM pepstatin, 1 mM PMSF; all from Sigma-Aldrich) containing 1% Nonidet P-40 (Pierce) or 0.5% N-dodecyl-d-maltoside]. The insoluble material was removed by centrifugation at 13,000 rpm for 2 min at 4°C and the supernatant was distributed into the wells of a 96-well plate which were precoated with the respective mAbs (20 μg/ml in PBS) as described (14). After incubating the wells with the cell lysate (50 μl/well) over night at 4°C, the wells were washed with PBS, after which 1× SDS-PAGE loading buffer was added (7–10 μl/well). The immunoprecipitates were collected and analyzed by SDS-PAGE and Western blotting.

Solid phase signalosome precipitation (SPSP)

Jurkat T cells (7 × 10⁶/ml) were incubated in ice-cold RPMI 1640 medium with 5% FCS and 20 mM HEPES for 1 h at 4°C. Then, the cells were added into six-well plates (1 ml/well) coated with the CD3 mAb OKT3 (10 μg/ml) and shortly spun down. The six-well plates were incubated at 37°C for the indicated periods of time. After stimulation, the medium was carefully removed and the attached cells were lysed for 12 min at 4°C using ice-cold lysis buffer (see above) supplemented with 1 mM sodium orthovanadate and 50 mM NaF. Subsequently, the lysate was collected and the insoluble material removed by centrifugation at 13,000 rpm for 2 min at 4°C. Afterward, the six-well plates with the precipitated protein complexes were washed three times with ice-cold washing buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 0.1 mM sodium orthovanadate] containing 0.1% Tween 20 (Sigma-Aldrich). The immunoprecipitated protein complexes were harvested in 150 μl of 1× SDS-PAGE loading buffer. Finally, both the lysates and the immunoprecipitates were analyzed by SDS-PAGE and immunoblotting.

Analysis of protein tyrosine phosphorylation

Before stimulation, Jurkat T cells were incubated in RPMI 1640 medium supplemented with 1% FCS for 4 h at 37°C. Cells were stimulated for different durations at 37°C using CD3 mAb MEM-92 (10 μg/ml). The reactions were stopped by addition of ice-cold washing buffer (see above). After centrifugation (2 min, 850 × g, 4°C), cells were immediately lysed for 30 min in ice-cold lysis buffer (see above) supplemented with 1 mM sodium orthovanadate, 50 mM NaF. After centrifugation, lysates were analyzed by reducing SDS-PAGE conditions (10% gel) and immunoblotting using HRP-labeled anti-pTyr mAb 4G10 (Upstate Biotechnology).

Lipid-raft separation by sucrose-gradient centrifugation

Cell lysates were adjusted to 40% (w/v) sucrose by adding an equal volume of an 80% sucrose solution (TBS containing 80% w/v sucrose, 2 mM EDTA, and protease inhibitors). These preparations were placed on top of a 60% sucrose layer in a centrifuge tube (Sorvall Instruments-DuPont). On top of this, layers of 20%, 10% and 5% sucrose were placed. After ultracentrifugation (180,000 × g, 16 h, 4°C), 375 μl fractions were collected from the top. Aliquots of each fraction were diluted in a 4× gel loading SDS-buffer. Proteins were separated by SDS-PAGE and immunoblotted followed by probing the membranes with the respective mAbs.

Flow cytometry

Cells were washed with staining buffer (PBS/1% BSA/0.02% NaN₃) and incubated for 30 min with 4 μg/ml human Ig on ice to prevent nonspecific binding of the mAb to Fc receptors. Primary Ab (10 μg/ml) was added and the cells were incubated for 30 min on ice. Cells were washed with staining buffer and incubated with secondary Ab for 30 min on ice. After a final wash, cells were analyzed on an LSRII or FACSCalibur flow cytometer (BD Biosciences).

Coverslip preparation and confocal microscopy

For confocal microscopy, epoxide-bearing glass slides were prepared as described (26). The cells were washed twice in PBS containing 2% FCS (PBS-FCS) and then resuspended (2 × 10⁶ cells/ml) in HBSS containing 1 mM Ca²⁺ and 1 mM Mg²⁺. The cell suspension was gently placed on the CD3 mAb (MEM-57)-coated cover slips. Cells were stimulated at 37°C for various time intervals. The incubation was stopped by fixing the cells with 3.75% paraformaldehyde in PBS. After washing twice with PBS-FCS, the cells were blocked with 4 μg/ml human Ig in PBS for 20 min. Then, the cells were incubated for 30 min with directly labeled Alexa Fluor (AF) mAbs against CD3 (MEM-57/AF647), CD48 (MEM-102/AF555), or CD59 (MEM-43/5/AF555) at a final concentration of 10 μg/ml. Following staining, the cells were washed twice with PBS-FCS and analyzed on a confocal LSM 510 Zeiss microscope (Carl Zeiss AG) by making serial z stacks from bottom to top.

Knockdown of CD2 and CD48 expression by RNA interference

The following oligonucleotides were annealed and cloned via EcoRI/AgeI to the lentiviral short hairpin RNA (shRNA) expression vector pLKOpuro1 (provided by Dr. Sheila Stewart, Washington University School of Medicine, St. Louis, MO): shCD2 sense at position 341 (5′-CCGGTGACCGATGATCAGGATATCTTCAAGAGAGATATCCTGATCATCGGTCTTTTTG-3′) and shCD2 anti-sense at position 341 (5′-AATTCAAAAAGACCGATGATCAGGATATCTCTCTTGAAGATATCCTGATCATCGGTCA-3); shCD2 sense at position 864 (5′-CCGGTCCTCAGAATCCAGCAACTTTTCAAGAGAAAGTTGCTGGATTCTGA GGTTTTTG-3′) and shCD2 anti-sense at position 864 (5′-AATTCAAAAACCTCAGAATCCAGCAACTTTCTCTTGAAAAGTTGCTGGATTCTGAGGA-3′); shCD48 sense at position 884 (5′-CCGGTGCATGCTGCTGAATTATCATTCAAGAGATGATAATTCAGCAGCATGCTTTTTG-3′) and shCD48 anti-sense at position 884 (5′-AATTCAAAAAGCATGCTGCTGAATTATCATCTCTTGAATGATAATTCAGCAGCATGCA-3′); shCD48 sense at position 193 (5′-CCGGTGCCTGCCTGAGAACTACAATTCAAGAGATTGTAGTTCTCAGGCAGGCTTTTTG-3′) and shCD48 anti-sense at position 193 (5′-AATTCAAAAAGCCTGCCTGAGAACTACAATCTCTTGAATTGTAGTTCTCAGGCAGGCA-3′). Gene-specific shRNA-target sequences are indicated on the sense strand in italic. As control, we used the MISSION Non-Target pLKOpuro1 Control Vector (Sigma-Aldrich). Production of lentiviral supernatants was performed in 293T cells by cotransfection of the appropriate pLKOpuro1 vector with the packaging plasmids psPAX2 and pMD2.G (Addgene plasmids 10703 and 12259; constructed by Dr. Didier Trono, Ecole Polytechnique Federal de Lausanne; obtained via Addgene). Forty-eight hours after transfection, viral supernatants were harvested, filtered, and used freshly for the transduction of cells. The transduction was done overnight in the presence of 5 μg/ml polybrene. Transduced cells were selected with puromycin (1 μg/ml).

For shRNA-mediated gene silencing in human peripheral blood T cells, freshly isolated PBMCs were stimulated with plate-bound CD3 mAb OKT-3 (5 μg/ml) and soluble CD28 mAb Leu28 (2 μg/ml) for 24 h and infected with freshly prepared virus, which was concentrated by ultracentrifugation from the supernatant of the producer cells. Twenty-four hours later, a second round of infection was performed. Transduced T cells were selected by stimulation for further 3 days under puromycin (1 μg/ml). Then, the T cells were washed and rested for 5 days. For the cytokine assay, the T cells were restimulated with plate-bound CD3 mAb OKT-3 and soluble CD28 mAb Leu28 as indicated.

Luciferase assay

Jurkat IL-2-Luc cells were stimulated as indicated at 37°C. Luciferase assays were performed using the luciferase reporter gene assay kit (Roche Diagnostics) according to the manufacturer’s instructions. Luciferase activity was measured in the Berthold Lumat LB 9501 device (Berthold Technologies GmbH) and normalized for protein content with the Bio-Rad protein assay (Bio-Rad). Each luciferase assay experiment was performed in triplicates and repeated at least three times. The bars represent triplicates with indicated SD. Statistical significance was evaluated using a two-tailed, paired Student’s t test.

Measurement of secreted IL-2

Samples were analyzed using the Luminex xMAP suspension array technology. Thirty microliters of culture supernatants were used undiluted. Standard curves were generated using rIL-2 (R&D Systems). All incubation steps were performed at room temperature and in the dark to protect the beads from light. To avoid inconsistencies, all samples from an individual experiment were measured in the same run. Control samples were included in all runs. Detection limits were 30 pg/ml for IL-2. The experiments were performed at least two times in at least triplicates, and the data were expressed as mean values with SD. Statistical significance was evaluated using a two-tailed, paired Student’s t test.

Calcium flux measurement

Cells were stained with 5.5 μM Fura Red AM-ester and 2.6 μM Fluo-4 AM-ester (Molecular Probes) in RPMI 1640 medium for 45 min at 37°C. After washing twice with medium, cells were again incubated for 30 min at 37°C. Fluo-4/Fura-red loaded cells were then analyzed by flow cytometry using a LSRII flow cytometer (BD Biosciences). Calcium mobilization was monitored within the first three minutes after TCR cross-linking with the anti-TCR mAb C305 by analyzing the fluorescence emission ratio of Fura Red and Fluo-4 as previously described (27).

Immune synapse assay

Raji B cells transduced with either control shRNA or CD48 specific shRNA were labeled with CellTracker Orange (chloromethyl-tetramethylrhodamine methyl ester; Molecular Probes) and pulsed with 5 μg/ml staphylococcal enterotoxin E (SEE; Toxin Technology) in HBSS at 37°C for 20 min. After washing, the Raji cells were incubated with shRNA vector-transduced Jurkat E6.1 T cells (shCtr, shCD2, or shCD48) at a ratio of 1:1 at 37°C for 20 min. The reaction was stopped by adding ice-cold HBSS. Cells were plated on poly-l-lysine-coated slides (Marienfeld) and allowed to settle for 15 min on ice. For staining of CD3ε and LAT, cells were fixed with 4% formaldehyde in PBS for 15 min at room temperature, permeabilized with 0.1% Triton X-100 in PBS for 15 min at room temperature (except for staining with CD3ε), and treated with the mouse anti-human CD3 mAb UCH-T1 and the rabbit anti-human polyclonal LAT Ab followed by the appropriate AF488-labeled goat-anti-mouse or goat-anti-rabbit Abs (Molecular Probes) for 30 min at room temperature. Using a ×40 magnification on an Aristoplan fluorescence microscope (Leica Microsystems), two individuals determined independently the percentage of cells showing CD3ε and LAT relocalization to the IS by counting at least 100 conjugates per blinded sample.

CD2 is necessary for recruitment of CD48 to the TCR/CD3 complex

We have previously demonstrated that CD48 but not CD59 gets immobilized in the center of a CD3 mAb-induced artificial immunological synapse together with the TCR/CD3 complex (14). In the present study, we asked whether the differential behavior of these two lipid raft markers was dependent on interaction with CD2, which is a central molecule in TCR signaling microclusters (22). To study this, we performed lentiviral shRNA-mediated gene knockdown of CD2 in the human T leukemia cell Jurkat IL-2-Luc, stably transfected with an IL-2 promoter luciferase reporter construct. We obtained a quantitative knockdown of almost 100% of CD2 expression by the shRNA targeting position 341; the staining of CD3, CD48, and CD59 remained unaffected (Fig. 1⇓A). A similar effect but with weaker down-regulation of CD2 was obtained with an shRNA targeting position 864 (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Recruitment of CD48 to the TCR/CD3 complex requires expression of CD2. A, Lentiviral shRNA-mediated gene knockdown of CD2 expression in Jurkat IL-2-Luc cells. Staining of control shRNA transduced cells (shCtr) is shown in filled gray histograms, CD2 knockdown cells (shCD2) are in black. The dashed line represents staining of the isotype matched control mAbs. B, Confocal imaging of a semiartificial IS formed by control and CD2 silenced Jurkat IL-2-Luc cells on a CD3 mAb (MEM-57) coated glass surface. Jurkat cells were incubated on the stimulatory surface for the indicated times at 37°C. Afterward, cells were fixed and stained with AF-labeled mAbs to CD3 (MEM-57; AF647), CD48 (MEM-102; AF555), and CD59 (MEM-43/5; AF555). The analysis was performed using an LSM 510 Meta laser scanning microscope system from Zeiss. Individual cells were scored for central or peripheral distribution of CD48 and CD59 in the semiartificial IS. The table summarizes 34 cells from two independent experiments. C, Analysis of TCR/CD3-complex associated molecules by standard immunoprecipitation in resting Jurkat IL-2-Luc cells (left) and by SPSP (right) in control and CD2-silenced Jurkat IL-2-Luc cells. The SPSP method makes use of CD3 mAb (OKT3) coated surfaces for both T cell stimulation and precipitation of CD3-associated signaling complexes. Cells were allowed to settle on the stimulatory surface of a six-well plate for the indicated times and then were lysed. The supernatant containing nonprecipitated material was removed and the CD3-associated complexes were harvested by the addition of SDS-PAGE sample buffer to the wells. Both the precipitated and the nonprecipitated materials were analyzed under reducing conditions using a 10% SDS-PAGE gel followed by immunoblotting.

First, we subjected these cells to confocal microscopy analysis. We allowed Jurkat T cells to settle and spread on CD3 mAb-coated glass slides. The cells were fixed after different time points followed by staining with specific mAbs. In accord with our previous study (14), in Jurkat cells transduced with the control shRNA, after 20 min of stimulation we found CD48 in the centre of the spreading zone colocalized with CD3. In the CD2-silenced cells reorganization and colocalization of CD48 with CD3 did not occur. CD59 was mostly restricted to peripheral regions of the artificial immunological synapse in the control as well as the CD2 silenced cells (Fig. 1⇑B).

As the next step, we analyzed the role of CD2 for CD48 recruitment to the TCR/CD3 complex at the biochemical level. We did not observe an interaction of CD3 with CD2, CD48, or CD59 in resting Jurkat cells when using standard immunoprecipitation (Fig. 1⇑C, left). We next analyzed molecules associating with the TCR/CD3 complex upon stimulation. To preserve signaling associates we used SPSP described earlier by us (14). This method allows T cell stimulation with a surface-immobilized Ab and isolation of molecules associated with the ensuing semiartificial immunological synapse. In brief, to synchronize cell spreading, the cells were shortly centrifuged (at 4°C) onto tissue culture plates coated with a CD3 specific mAb (OKT3). After different time periods of stimulation at 37°C, the cells were lysed with 1% Nonidet P-40 as a detergent, and both the precipitated and nonprecipitated material was analyzed by SDS-PAGE and Western blotting. Using mAbs against other T cell surface markers such as MHC class I we confirmed the specificity of the assay (14) (data not shown). A similar approach using magnetic beads coated with TCR mAb and mechanical cell disruption has been also successfully used for isolation of TCR-associated membrane patches (28).

When we subjected shRNA expressing control cells to SPSP, CD48 readily coprecipitated with CD3 after 10 min of incubation (Fig. 1⇑C, right). The association of CD48 was transient because we could not detect CD48 molecules in the CD3 precipitates of these cells after 60 min of stimulation. At this time point, only CD2 stayed in complex with CD3. CD59 did not associate at any time with CD3 confirming our data from single molecule microscopy (14). In contrast, in the CD2 knockdown cells the CD3 precipitates were completely devoid of CD48 (Fig. 1⇑C). CD2 is thus crucial for recruitment of CD48 to the TCR/CD3 complex upon T cell activation.

CD48 is dispensable for recruitment of CD2 but necessary for association of LAT to the TCR complex

Next, we were interested whether the CD2 ligand CD48 might influence the recruitment of CD2 and TCR signalosome components to the TCR complex. To answer this question, we subjected the Jurkat IL-2-Luc cells to shRNA-mediated gene knockdown of CD48. With an shRNA targeting position 884, again we obtained a sufficient knockdown efficiency of >90% (Fig. 2⇓A). An shRNA targeting position 193 reduced also significantly CD48 expression but the effect was weaker as found with position 884 (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

CD2 and CD48 are key mediators of LAT recruitment to the TCR/CD3 complex. A, Lentiviral shRNA-mediated gene knockdown of CD48 expression in Jurkat IL-2-Luc cells. Staining of control shRNA transduced cells (shCtr) is shown in filled gray histograms, CD48 knockdown cells (shCD48) are in black. The dashed line represents staining of the isotype matched control mAbs. B, SPSP of control and CD48 silenced Jurkat IL-2-Luc cells, stimulated and precipitated on CD3 mAb (OKT3) surfaces for the indicated times. The precipitated as well as the nonprecipitated material was subjected to SDS-PAGE and immunoblotted with the indicated Abs. C, Sample material obtained from SPSP with CD2 silenced cells was subjected to specific immunoblotting using CD3ε, Lck, and LAT Abs.

Using the CD48 knockdown cells, we analyzed the influence of CD48 on association and reorganization of CD2, CD59, LAT, and Lck with the TCR/CD3. After 10 min of stimulation on the CD3 mAb-coated surface, we found quantitative association of CD3, CD2, CD48, LAT, and Lck in control cells (Fig. 2⇑B). In the CD48 silenced cells, CD2 coprecipitated with CD3, while Lck recruitment was reduced and that of LAT completely lost. When we used instead of 1% Nonidet P-40, 0.5% N-dodecyl-D-maltoside as a detergent, we detected no interaction of CD3 with either CD48 or CD2 both in control and silenced cells (data not shown). As solubilization of lipids from membrane compartments by N-dodecyl-D-maltoside is significantly enhanced compared with Nonidet P-40 (29), the differential results indicate a role for protein-lipid interactions, i.e., lipid rafts, in the recruitment of these molecules. We also tested the recruitment of Lck and LAT to the TCR/CD3 complex of CD2-silenced cells and found a complete loss of LAT recruitment. In contrast to CD48 silenced cells, CD2 silencing also led to a defect in Lck association to the TCR/CD3 complex (Fig. 2⇑C).

Because CD2 was needed for association of CD48 with the TCR/CD3 complex, we assumed that the CD2-CD48 interaction might be important for recruiting the TCR to lipid rafts. If this were true, we would expect reduced distribution of the CD3/TCR to the lipid raft containing low-density fractions in a sucrose gradient. Therefore, we stimulated control and CD2-silenced Jurkat cells in solution with a soluble CD3 IgM mAb (MEM-92). Then, we subjected the cell lysates to ultracentrifugation on a sucrose gradient. CD3 stimulation led to redistribution of CD3 to lipid raft fractions of the sucrose gradient, and indeed, CD2 silencing led to a significant decrease of CD3 in lipid raft fractions (Fig. 3⇓A). A similar result was obtained with CD48 silenced cells (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Lipid raft partitioning of the TCR, LAT phosphorylation, and calcium mobilization upon T cell activation depend on CD2 and CD48. A, Jurkat control and CD2 silenced cells were stimulated with the CD3 mAb MEM-92 in solution (10 μg/ml). At the indicated time points, cells were lysed and the lipid raft partitioning of CD3 was analyzed by sucrose gradient ultracentrifugation and immunoblotting as described in Materials and Methods. B, LAT phosphorylation is dependent on CD2 expression. Immunoblot analysis of control and CD2 silenced Jurkat IL-2-Luc cells stimulated for the indicated times with the CD3 mAb MEM-92 in solution (10 μg/ml). Cells were lysed, subjected to SDS-PAGE and immunoblotted with the indicated Abs. C, Reduced calcium flux upon TCR cross-linking in CD2 and CD48 silenced Jurkat cells. Jurkat cells were stained with Fluo-4 and Fura-red. Calcium transients in response to the anti-TCR mAb C305 and the calcium ionophore ionomycin were measured by flow cytometry.

The observed defects of LAT and Lck recruitment and the aberrant raft distribution of CD3 in CD2 or CD48 silenced cells should affect tyrosine phosphorylation and calcium mobilization upon TCR engagement. To assess the influence of CD2 on proximal TCR signaling, we stimulated the CD2-silenced Jurkat cells with CD3 mAb MEM-92 and analyzed the total cell lysates by Western blotting. We found a strongly diminished phosphorylation of LAT at all time points in CD2-silenced cells compared with the control cells. We did not detect any difference in phosphorylation of the negative regulatory Tyr 505 of Lck when comparing CD2 silenced with control Jurkat cells (Fig. 3⇑B). Next, we analyzed the calcium mobilization of control, CD2- or CD48-silenced Jurkat cells upon TCR cross-linking with the anti-TCR mAb C305 and found a significant reduction of the calcium flux in both silenced cells (Fig. 3⇑C).

To get hold of the TCR-proximal signalosome dependent on CD2 and CD48, we again applied the SPSP method and analyzed the pool of phosphorylated proteins coprecipitated with CD3 (Fig. 4⇓). Anti-phosphotyrosine blots showed an overall reduction in phosphoprotein bands associated with TCR/CD3 in both CD2 and CD48 silenced Jurkat cells, especially at early time points of stimulation (Fig. 4⇓, A and B). Interestingly, we did not detect any difference in the phosphoprotein patterns of control and silenced cells in the nonprecipitated material. This indicates that signal transduction still occurs in the absence of CD2 and CD48 but the lack of formation of a stable signalosome at the TCR impairs channeling the signals into the required downstream signaling pathways. These data are in accord with depletion studies of cholesterol that destroyed lipid rafts resulting in uncontrolled T cell activation by transient tyrosine phosphorylation of multiple proteins (30).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Both CD2 and CD48 are essential for a stable associate of tyrosine phosphorylated signaling proteins in the TCR signalosome. A, SPSP of control and CD2 silenced Jurkat IL-2-Luc cells, stimulated, and precipitated on CD3 mAb (OKT3) surfaces for the indicated times. The precipitated as well as the nonprecipitated material was subjected to SDS-PAGE and immunoblotted with the phosphotyrosine specific mAb 4G10. B, CD48 silenced cells were analyzed as in A.

Next, we tested whether CD2 or CD48 silencing resulted in a defect of LAT reorganization to the IS. To test this, we induced a T/B cell synapse by stimulating the Jurkat T cells with Raji B cells pulsed with SEE. As verified by flow cytometry, Raji B-cells were negative for CD2 but expressed CD48 (Fig. 5⇓A). Therefore, to exclude a potential costimulatory effect of CD48 by trans interaction, we silenced the CD48 expression on Raji B cells using the CD48 shRNA constructs. Similar to Jurkat cells, the shRNA construct targeting position 884 had the strongest down-regulatory effect. Other markers such as MHC class II were not affected (Fig. 5⇓A). Fixed B/T cell conjugates were stained for CD3 and LAT (Fig. 5⇓B). Indeed, we found decreased recruitment of LAT to the contact plane between Jurkat T cells silenced for either CD2 or CD48 and SEE pulsed Raji B cells. This microscopic observation is in accord with the biochemical signalosome precipitation data shown in Fig. 2⇑, B and C.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Impaired recruitment of LAT to the immune synapse of CD2 or CD48 silenced Jurkat cells. A, Expression analysis of CD2, CD48, and MHC class II on control shRNA (shCtr, filled gray histograms) and shCD48 (black lines) transduced Raji B cells. The dashed line represents staining of the isotype matched control mAbs. B, CellTracker Orange labeled Raji B cells were pulsed with or without SEE and mixed with Jurkat T cells. Then, the B cell/T cell conjugates were fixed and stained with either a CD3 mAb or an Ab against LAT. C, shCtr- or CD48-silenced Raji B cells were pulsed with SEE and incubated with either shCtr-, shCD2-, or shCD48-silenced Jurkat T cells. The B cell/T cell conjugates were analyzed for redistribution of LAT to the B cell/T cell interface. Two individuals analyzing at least 100 conjugates counted the number of conjugates with redistributed LAT from two independent blinded samples.

Then, we analyzed the influence of CD2 and CD48 silencing on the IL-2 expression of T cells in a functional assay. In agreement with earlier data (12, 31), CD2- and CD48-silenced Jurkat T cells showed strongly decreased IL-2 promoter activity (Fig. 6⇓A) and IL-2 levels in the culture supernatant when stimulated with Raji B-cells SEE (Fig. 6⇓B). We found the same or an even stronger inhibition of IL-2 promoter activity when CD48 was silenced in the Raji cells (Fig. 6⇓A). Furthermore, we found decreased IL-2 promoter activity in CD2 and CD48 silenced cells when stimulated via plate-bound OKT3 against CD3, with or without soluble CD28 Abs (Fig. 6⇓A).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

cis-interaction of CD2 and CD48 is critical for T cell IL-2-expression. A, Control, CD2 or CD48 silenced Jurkat IL-2-Luc cells were stimulated in different ways or left unstimulated. For stimulation, the cells were either cocultured for 8 h at a 1:1 ratio with SEE pulsed Raji B cells as APCs, or stimulated for 16 h with plate-bound CD3 mAb OKT3 (5 μg/ml), with or without soluble CD28 mAb Leu28 (3 μg/ml). The CD2-negative Raji B cells were either transduced with control shRNA or CD48 specific shRNA to silence CD48 on the APC. After stimulation, the cells were lysed and luciferase activity was measured. One representative experiment of three is shown. In this experiment, for silencing of CD2 and CD48 the shRNA constructs targeting positions 341 and 864, respectively, were used. Similar results were obtained when using the alternative constructs targeting positions 884 and 193, respectively. B, ELISA measurement of IL-2 secretion of control, CD2-, or CD48-silenced Jurkat IL-2-Luc cells upon stimulation with SEE-pulsed Raji B cells.

Finally, to exclude the possibility that the functions of CD2 and CD48 in organizing the TCR signalosome in Jurkat T cells are peculiar for and restricted to this cell line, we silenced CD2 or CD48 in primary human peripheral blood T cells. To down-regulate the target molecules in these cells, we performed a primary stimulation via CD3 and CD28 in the presence of control, CD2, or CD48 shRNA containing lentiviruses over a period of 6 days. After a resting period of 5 days, we found a significant reduction of surface expression of both CD2 (35% down-regulation) and CD48 (50% down-regulation) (Fig. 7⇓A). Then, we restimulated these cells via CD3 plus CD28 and measured the IL-2 secretion. In agreement with the results obtained with Jurkat T cells, CD2 silencing resulted in >90% and CD48 silencing in ∼65% inhibition of IL-2 secretion (Fig. 7⇓B). Taken together, our data are pointing to the engagement of CD2 in lateral interactions of the TCR/CD3 complex with other T cell membrane molecules, in particular CD48, for signal transduction.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Silencing of CD2 or CD48 in human peripheral blood T cells impairs TCR signaling for IL-2 expression. Human peripheral blood T lymphocytes silenced for CD2 or CD48 were generated as described in Materials and Methods. A, Surface expression analysis of CD2 and CD48 on control shRNA, shCD2-, and shCD48-treated T cells blasts. The black lines represent the staining with the specific CD2 and CD48 mAbs; the dashed lines represent staining of the isotype matched control mAbs. B, For the analysis of IL-2 secretion, the cells were stimulated for 24 h with the indicated concentrations of plate-bound CD3 mAb OKT3 plus soluble CD28 mAb Leu28 (2 μg/ml). After 24 h, the culture supernatants were harvested and secreted IL-2 quantified by the Luminex assay.