Article Figures & Data
Figures
- FIGURE 1.
The p.Arg240His expresses well and is not affected by folding problems. A, Expression of C4BP variants after transient transfection. HEK293 cells were transiently transfected with C4BP variants and an empty vector using lipofectin. C4BP level was measured by ELISA in cell lysates and the conditioned media collected during 48-h incubation. Results of three independent tranfections are shown as means with bars indicating SD. Statistical analysis was performed using Student’s t test. ∗, p < 0.05. B, SDS/PAGE analysis of recombinant wt C4BP and the p.Arg240His mutant which were expressed in eucaryotic cells and purified by affinity chromatography. The proteins were separated by 10% SDS/PAGE under reducing conditions and stained with Coomassie. m.w. markers are shown to the right. C, Circular dichroism analysis of wt C4BP and the p.Arg240His mutant. Approximately 120 μg of each mutant were analyzed in the far UV-region (185–250 nm), and every presented spectrum is the average of eight measurements. In all figures the p.Arg240His mutant is simplified as R240H.
- FIGURE 2.
The p.Arg240His polymorphism does not affect binding and degradation of C4b. A, Competition assay: increasing concentrations of fluid phase wt C4BP or the p.Arg240His mutant competed with trace amounts of 125I-labeled C4BP for binding of immobilized C4b. The 100% binding was estimated in the absence of fluid phase competitor. Results of two independent experiments performed in triplicates are shown. B, C4b-degradation assay: C4BP variants (6–50 nM) were incubated with 250 nM C4b 200 nM FI and trace amounts of 125I-labeled C4b for 1.5 h at 37°C. Immediately afterward, a sample buffer with reducing agent was added, samples were heated at 95°C, and the proteins separated by SDS/PAGE electrophoresis (7.5–10% gradient gel). The gel was dried and subjected to autoradiography. As a control, FI was omitted in the incubation mixture. C, Results of densitometric analysis (the C4d fragment) of three independent C4b-degradation assays presented as means ± SD. Statistical analysis was performed using Student’s t test; ns-Not significant.
- FIGURE 3.
The p.Arg240His mutant of C4BP serves poorly as cofactor in degradation of C3b in a solution. A, Competition assay: increasing concentrations of fluid phase wt C4BP or the p.Arg240His mutant competed with trace amounts of 125I-labeled C4BP for binding of immobilized C3b. The 100% binding was estimated in the absence of fluid phase competitor. Results of two independent experiments performed in triplicates are shown. B, C3b-degradation assay was performed as in Fig. 2B except that 750 mM C3b was used instead of C4b. C, Results of densitometric analysis of three independent C3b-degradation assays (43 kDa fragment of iC3b).
- FIGURE 4.
The p.Arg240His mutant of C4BP serves poorly as cofactor in degradation of C3b in a solution. A, Cofactor activity of C4BP variants toward C3b deposited on a surface. Sheep erythrocytes were coated with C3b and incubated with C4BP and FI for 1 h, upon which generated C3b and iC3b were assessed by flow cytometry using specific Abs. The experiments were performed on three independent occasions in duplicates. B, Hemolytic assay measuring cofactor activity of C4BP variants toward C3b deposited on a surface. Sheep erythrocytes were coated with C3b by sequential incubation with amboceptor, C1, C4, C2, and C3. EAC3b were incubated with 70 nM C4BP and 80 nM FI at 37°C. At indicated time intervals, aliquots were removed, centrifuged, and incubated with Factor B, D, and properdin to form the C3bBb convertases. Lytic sites were developed by adding guinea-pig serum for 1 h, the samples were centrifuged, and the amount of lysis was determined spectrophotometrically. The experiment was performed on three independent occasions in duplicates. C–E statistical analysis was performed using Student’s t test. Ns-Not significant; ∗, p < 0.05, ∗∗, p < 0.01, ∗∗∗, p < 0.001; bars indicate SD.
Tables
Exon Primers 5′–3’ (Mg) mM Temp (°C) C4BPA 1 (F) CAGTGCTGCTTTATTTCTGCTG 1.5 51.2 (R) TCTGCTGAAAACACCTCCAA 2 (F) CACTCCAGGCTGTCATTTCC 2.0 62.7 (R) TTGATGAAGCTGGGTCTCTG 3 (F) TAAGATGCTGTGTCCCAAGG 1.5 51.2 (R) TCTGAGACAACTTTCCAAAGATAGG 4 (F) TGTGTTTCTGGAAGCAGAGGTG 2.0 58.9 (R) ATCCTTTGCTTGAGGACGGGA 5 (F) TGGGAAATGATATCCAAGAACA 1.5 54.2 (R) GGCTTACACTTGACAACTGAGGT 6 (F) TCCCTGTGCATCTTTACAGGTAT 3.0 58.9 (R) TCAGGTGGCCAAATAAATGA 7 (F) AACTGGATTAGCAGTGGCAG 1.5 58.9 (R) CAGTACGGGGTACCTTTAG 8 (F) TGATACATCAGGCCTTGCAG 1.5 58.9 (R) GTCCCCTTCTGGCACTAACA 9 (F) TCTTCATATAAGTTTAATCC 1.5 50 (R) ATTCCAAGAATCATGCAAG 10 (F) TACATGTATTCTGCAATGTGCTAC 2.0 64.7 (R) GCTCTCAGGACACGTCCAC 11 (F) CCGAGACTGTTATCATGTCCTTC 2.0 64.7 (R) ATGCCACCATTTTTAGGGG 12A (F) CTTGTTTTCCCAGCCTCAAC 1.5 62.7 (R) CATGAGCCACACAGAGGATG 12B (F) GAAAATGGCCCTGGAGGTAT 1.5 58.9 (R) TGGCCCAAACAGTAAAACAA C4BPB 1 (F) GACTGGTCAACTGGATTTGCATTC 1.5 58.0 (R) AGCTCCTATTGAGTGACGAGCAT 2 (F) GCAAAAAGACATGAGAATGGG 1.5 58.0 (R) GGATGTGAAGGAGTAAAACAGG 3 (F) TGGCCTTTGCTGTGTTG 1.5 55.0 (R) CAGGGATGTGGCAAATGTC 4 (F) AACAGCTGCAATTAGGGGTG 1.0 55.0 (R) CCAAAACAATGCTGCCAAG 5 (F) CCAGTCTCCATTACCCAATTC 1.0 58.0 (R) AGCATATGCCAGGAGTGATG 6 (F) TTACTTAAGCTAGCCTGGTTCTGAGC 1.5 60 (R) ACATGGTGCATTATACAACTG 1.5 Patient ID Sex Age at Presentation Renal Function CFH, MCP, CFI, C3, and FB Mutations CFHR1 and CFHR3 Copy Number C3 (g/L) C4 (g/L) FH (g/L) FI (mg/L) C4BP (mg/L) 1 M 8 Recovered MCP p.Ser206Pro CFH, CFI, FB, C3 - nil 1 1.40 0.24 0.68 70 235 ± 27 2 M 16 Recovered MCP p.Ser206Pro CFH, CFI, FB, C3 - nil 1 0.98 0.31 n/a n/a 64 ± 9 265 ± 47 3 F 6 Recovered CFH– p.Gln950His MCP, CFI, FB, C3 - nil 1 0.82 0.19 0.49 61 202 ± 42 4 M 8 Recovered Nil 2 1.31 0.41 0.70 n/a n/a 5 F 23 Recovered Nil 2 1.65 0.28 0.58 47 286 ± 40 6 F 61 Recovered Nil 1 1.12 0.18 0.70 66 213 ± 29 a Samples were taken for analysis upon first arrival to the hospital. C4BP concentration was measured using ELISA (42 ), C3 and C4 by rate nephelometry (Beckman Array 360), and FH and FI by radioimmunodiffusion (Binding Site). Patient 2 had low C4BP level at first analysis upon arrival to hospital but subsequent sample revealed normal level of C4BP. Normal range of concentrations: C3 0.68–1.80 g/L, C4 0.18–0.60 g/L, FH 0.35–0.59 g/L, FI 38–58 (mg/L), and C4BP 114–345 (mg/L). CFH (6 ), MCP (6 ), CFI (9 ), C3 (11 ), and FB (10 ) genes were sequenced as described previously. n/a: Not available.
In this issue
