Two Groups of Porcine TCRγδ⁺ Thymocytes Behave and Diverge Differently

Animals

Animals used in the study were as follows: 1) crossbred gilts bred in Nový Hrádek (3, 6, 7), and 2) large white/Landrace crossbred gilts. Fetuses were obtained by hysterectomy. Gestation age (day of gestation (DG))³ was calculated from the day of mating (gestation in swine is 114 days). All animal experiments were approved by the Ethical Committee of the Institute of Microbiology, Czech Academy of Science, according to guidelines in the Animal Protection Act.

Immunoreagents

The following mouse anti-pig mAbs, whose source and specificity were described earlier (3, 6, 7), were used as primary immunoreagents: anti-CD1 (76-7-4, IgG2a), anti-CD2 (MSA4, IgG2a or 1038H-5-37, IgM), anti-CD3ε (PPT3, IgG1 or PPT6, IgG2b), anti-TCRγδ (PPT17, IgG1 or PPT16, IgG2b), anti-CD4 (10.2H2, IgG2b), anti-CD8 (76-2-11, IgG2a), anti-CD8β (PPT23, IgG1), and anti-CD45RC (MIL5, IgG1). In some cases, mAbs were also labeled with biotin N-hydroxysuccinimide ester (3, 6).

Goat polyclonal Abs specific for mouse Ig subclasses (Southern Biotechnology Associates or Molecular Probes) labeled with FITC, PE, cyanine 5 (Cy5), or Alexa Fluor 350 were used as secondary immunoreagents. Biotinylated primary Abs were detected by a streptavidin-PE/Cy5 tandem conjugate (SpectralRed; Southern Biotechnology Associates).

Preparation of cell suspensions, cell cultures, staining, and flow cytometry (FCM)

Cell suspensions from thymus were prepared and cultured essentially as previously described (3, 6, 7, 8). Thymic stromal cultures were established using freshly isolated thymic suspensions. After 6 days of incubation, the nonadherent cells were removed and the monolayer was, after extensive washing, then used as feeder cells. Partial thymectomy was used for preparation of syngeneic thymic stromal cultures, followed by using thymic suspensions and γδ thymocytes from the same donor, whereas allogeneic cultures were prepared using thymic stromal cells from different fetal donors. Allogeneic cultures were used in most of the studies because origin of thymic stromal cells did not affect the patterns of γδ thymocyte behavior in cultures in examined parameters. Input stromal cultures were always tested for the absence of donor γδ thymocytes to preclude cross-contamination. Surface staining of cells for FCM analysis and sorting was also performed, as described previously (3, 6, 7, 8), by indirect subisotype staining. The DNA content of multicolor-stained cells for cell cycle studies was determined using the DNA intercalating probe 7-aminoactinomycin D (7-AAD) (3, 6). Apoptotic cells were also detected using annexin-V and propidium iodide, according to the manufacturer protocol (Roche Diagnostics). In some experiments, propidium iodide was omitted because its spectral overlaps with other dyes. Samples were measured and/or sorted on standard FACSCalibur, FACS-LSR-II, or FACSVantage flow cytometers and analyzed by PC-LYSYS software (BD Immunocytometry Systems). Damaged and dead cells were excluded from analysis using propidium iodide fluorescence. A doublet discrimination module was used in DNA content analysis allowing single cell events measurement.

DNA fragmentation assay

Gel electrophoresis DNA fragmentation assay was used for detection of apoptosis and/or necrosis. The pellets containing the same number of examined cells were resuspended in 400 μl of lysis buffer (0.2% Triton X-100, 10 mM Tris-HCl (pH 8.0), and 1 mM EDTA). Cell lysates were immediately centrifuged, and the supernatants containing small DNA fragments were separated immediately from the pellets. DNA fragments from supernatants were precipitated by isopropanol, collected by centrifugation, washed with 70% ethanol, air dried, resuspended in 20 μl of Tris-EDTA buffer (10 mM Tris-HCl (pH 8.0) and 1 mM EDTA), and mixed with loading buffer. Electrophoresis was performed on 1% agarose gels.

PCR and RT-PCR

Preparation of RNA and cDNA was performed, as described previously (8, 9). First-strand cDNA synthesis was performed using 2 μg of total RNA or total RNA prepared from the same amount of sorted cells and primed with 200 ng of random hexamer primer. Genes or gene segments of interest were amplified using previously described primer pairs (8, 10, 11). The only exceptions were primers for pTα (sense, ctgcagctgggtcctgcctc; antisense, agtctccgtggccgggtgca; designed to amplify all three spliced variants, pTα1, pTα2, and pTα3), TCRVα (sense, tggtayvkmcagtaycc; antisense, tctcagctggtacacagc; designed to amplify the most frequently encountered subgroups, Vα01, Vα02, Vα03, and Vα14 (12)), and TCRCα (sense, gctgtgtaccagctgaga; antisense, agtttaggttcatatctg). As controls for determining relative transcript expression and efficiency of amplification, portion of β-actin was amplified from cDNA (8). All PCR were performed using ∼200 ng of template DNA or 10% of cDNA preparations with components recommended by TaqDNA polymerase manufacturer (Invitrogen Life Technologies) in a T-Gradient thermal cycler (Biometra). Annealing temperatures were set to 55°C for amplification of TdT and RAG-1, 61°C for C_Hα, or 58°C for all other amplification. PCR products were analyzed in 1.5% agarose gels. In some cases, products were excised from the gel and purified using the Wizard Plus Miniprep DNA Purification System (WIZARD kit; Promega). Purified PCR products were used for cloning (see below) or for high-resolution CDR3-Vβ length analysis, as described previously (10), using a similar principle as for CDR3 length analysis of V_H genes (8).

Cloning, hybridization, and sequencing

Cloning was performed, as described previously (8, 9), using reamplified gene segments by Pfu-polymerase (Stratagene) and cloning into EcoRV-digested pBluescript-II SK phagemids by blunt-end ligation. The ligation mixture was used to transform DH5α-competent cells; the positive recombinant clones identified by blue/white selection were transferred to nylon membranes; and the membranes were hybridized with ³²P end-labeled gene-specific oligonucleotide probes. Positive clones were identified by autoradiography, and single-gene inserts were confirmed by XhoI/XbaI restriction digest after isolation of plasmid DNA. Positive recombinant clones of interest were sequenced (9).

Twelve subsets of γδ thymocytes may be distinguished in thymus

Our earlier work (6), based on up to four-color FCM, demonstrated that γδ thymocytes could be divided into 12 subsets according to their expression of CD1, CD2, CD4, CD8 isoforms, and CD45RC (Fig. 1⇓). In this study, we have directly confirmed these findings using six-color staining through use of FITC, PE, Cy5, Alexa Fluor 350, PE/Cy5, and propidium iodide (Fig. 2⇓). This analysis is based on the observation that CD8αβ expression is restricted to all CD2⁺CD4⁺ γδ thymocytes (6), so the expression pattern for CD8β⁺ is the same as for CD4⁺ γδ thymocytes. Fig. 2⇓ demonstrates that subsets 1–4 can be identified on dot plot B-IV, subsets 5 and 6 on dot plot A-V, subsets 7–9 on dot plot A-III, and subsets 10–12 on dot plot B-III. These findings were confirmed in all experiments regardless of age and breed of animals.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Separation of porcine γδ thymocytes into 12 principal subsets (subsets 1–12) according to their surface phenotype (6 ).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

FCM analysis of TCRγδ, CD2, CD8, CD1, and CD45RC (row A), and TCRγδ, CD8, CD8β, CD4, CD1, and CD45RC (row B) expression by porcine thymocytes isolated from fetuses at DG110. Only live (propidium iodide-negative) TCRγδ⁺ thymocytes were gated and analyzed for expression of CD2/CD8 (A-I) or CD8/CD8β (B-I). In additional analysis, the cells in dot plot A-I and B-I were further gated by three regions (R1–R3), and the γδ thymocytes in these regions were analyzed for expression of CD1/CD45RC (column III for R1, column IV for R2, and column V for R3). CD1/CD45RC expression for all live γδ thymocytes is also shown (column II). The analysis of CD4 expression is not shown because all CD8β⁺ γδ thymocytes are also CD4⁺, so the expression pattern for CD8β⁺ (B-IV) is the same as for CD4⁺ γδ thymocytes. These results were confirmed in all experiments regardless of age and breed of animals.

Only CD1⁺CD45RC⁻ γδ thymocytes have capacity to divide

Cell cycle analysis of freshly isolated γδ thymocytes based on simultaneous detection of surface phenotype and DNA staining using 7-AAD (Fig. 3⇓) showed that dividing γδ thymocytes all belonged to the CD1⁺CD45RC⁻ γδ subset (Fig. 3⇓A-II). There were no cycling γδ thymocytes that expressed CD45RC (Fig. 3⇓, A-III and A-V) and/or were negative for CD1 (Fig. 3⇓, A-IV and A-V). Analysis for CD2 and CD8 demonstrated that CD2⁻CD8⁻ γδ thymocytes were not cycling (Fig. 3⇓B-IV), whereas a substantial part of those that were CD2⁺CD8⁻ were actively dividing (Fig. 3⇓B-II). Because all CD8⁺ γδ T cells are also CD2⁺ (Fig. 3⇓B-I, region R2), CD2⁺CD8αα⁺ γδ thymocytes did not divide (Fig. 3⇓C-II), similarly to CD2⁻CD8⁻ γδ thymocytes. Interestingly, almost all CD2⁺CD8αβ⁺ γδ thymocytes were actively proliferating (Fig. 3⇓C-III). Combining these findings with previous results on phenotype of γδ thymocyte subsets (Fig. 1⇑), it appears that only three subsets of γδ thymocytes were proliferating, as follows: subsets 1, 3, and 7 (Fig. 1⇑). Because subsets 1 and 3 belong to the group of CD4⁺ γδ thymocytes, subset 7 is the only one belonging to the group of CD4⁻ γδ thymocytes.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

FCM analysis of CD1/CD45RC (row A), CD2/CD8 (row B), and CD8/CD8β (row C) expression by fetal TCRγδ⁺ thymocytes in relationship to cell proliferation. γδ thymocytes isolated from 90-day-old fetuses were cell surface stained with combination of anti-TCRγδ and appropriate mAbs (different rows) and fixed in 70% ethanol, and their DNA was visualized using 7-AAD. In each staining (row), single TCRγδ⁺ thymocytes were gated (data not shown) and analyzed for cell surface expression by individual dot plots (column I) on the base of which γδ thymocytes were further gated by three to four regions (R1–R4). The DNA content (7-AAD fluorescence) for single γδ thymocytes in individual regions for corresponding staining (row) is shown in column II (for R1), column III (for R2), column IV (for R3), and column V (for R4). Positions of cells in G₀-G₁, S, and M-G₂ cell cycle phase according to 7-AAD fluorescence are indicated on x-axis of each histogram. The similar results were obtained in all experiments independently of animal age and breed.

Apoptosis of the CD4⁺CD8αβ⁺ γδ thymocytes is negligible, whereas CD4⁻ γδ thymocytes die substantially

Cell cycle analysis showed that a substantial portion of CD4⁺ γδ thymocytes was dividing, whereas only one subset of CD4⁻ γδ thymocytes proliferated (Fig. 3⇑). In further analyses, we examined the extent of cell death among individual thymocyte population in short-term culture (Fig. 4⇓). The cell death is almost nondetectable in freshly isolated cells (Fig. 4⇓B, 0 h), but is pronounced with culture in a time-dependent manner (Fig. 4⇓B, 4–20 h). The majority of all dying thymocytes were found to be within the αβ T lineage cells, i.e., CD4⁺TCRγδ⁻ (Fig. 4⇓C) and CD4⁻TCRγδ⁻ (Fig. 4⇓E), and also within the group of CD4⁻ γδ thymocytes (Fig. 4⇓F). In contrast, CD4⁺ γδ thymocytes rarely died in culture (Fig. 4⇓D), and the vast majority of them were in S + G₂-M phase of the cell cycle. After 20 h of culture, only ∼4% of CD4⁺ γδ thymocytes were dying (Fig. 4⇓D) in comparison with 45% of CD4⁻ γδ thymocytes (Fig. 4⇓F). Despite facts that CD4⁺ γδ thymocytes were vigorously cycling and did not die, noteworthy was their stable frequency (Fig. 4⇓A, region R2) and even decreasing mitotic activity during culture without accumulation in other cell cycle phases (Fig. 4⇓D). DNA fragmentation analyses showed that thymocyte subsets succumb to apoptosis (gel strips in Fig. 4⇓, B–F) because FCM-sorted and cultured subsets of thymocytes gave the DNA ladder profile characteristic of apoptosis. No DNA smear typical of necrosis was detected. Moreover, because we had used fresh, sorted cells, these data indicate that γδ thymocytes die spontaneously and do not require coculture with other thymocyte subsets to produce this effect. The apoptotic nature of cell death for cultured thymocytes was also shown by staining with annexin-V and propidium iodide (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Analysis of γδ thymocytes and their subsets in relationship to cell death. Thymocytes isolated from 112-day-old fetuses were used fresh or were cultured for 4, 8, 12, or 20 h, stained with anti-TCRγδ and anti-CD4, and fixed in 70% ethanol, and their DNA was visualized using 7-AAD. Individual thymocyte populations were gated by R1–R4 regions (dot plot A), and DNA content of these subsets during culture was further analyzed (histograms in C–F) with respect to sub-G (dying cells), G₀-G₁ (quiescent/growing cells), and S plus G₂-M (cycling cells) phase of the cell cycle. Analysis of DNA content for all thymocytes is also shown (B). Contribution of individual thymocyte subset frequency to each quadrant (A) and phases of the cell cycle (B–F) during culture is indicated on the right of particular dot plot or histogram. Freshly isolated thymocytes in R1–R4 regions were also sorted by FCM as pure populations and thereafter cultured for 12 h, and the extent of apoptosis and/or necrosis after culture was determined by gel electrophoresis DNA fragmentation assay (gel strips are given on extreme right of each histogram). This analysis showed that, during short-term culture, all thymocytes die exclusively by apoptotic type of cell death. The apoptosis of individual thymocyte subsets was also examined by multicolor staining (surface labels PE, Cy5, and/or Alexa Fluor 350) that included the detection with annexin-V FITC and propidium iodide (G–I). Twelve principal γδ thymocyte subsets (numbered 1–12 on the x-axis in the same manner as in the Fig. 1⇑ and text) were analyzed. The proportion of individual γδ thymocyte subsets among all γδ thymocytes (G), the proportion of individual γδ thymocyte subsets among apoptotic γδ thymocytes (H), and the proportion of apoptotic cells among individual γδ thymocyte subset (I) are shown. Individual bars represent average values obtained from six animals tested in three independent experiments.

Following initial characterization of spontaneous cell death in the group of CD4⁺ and CD4⁻ γδ thymocytes (Fig. 4⇑, A–F), we then investigated apoptosis in all 12 principal γδ thymocyte subsets (Fig. 4⇑, G–I). Using multicolor FCM involving annexin-V FITC, the proportion of individual γδ thymocyte subsets among all γδ thymocytes was analyzed in each experiment (Fig. 4⇑G), followed by analysis of the proportion of individual γδ thymocyte subsets among apoptotic γδ thymocytes (Fig. 4⇑H). The majority of apoptotic γδ thymocytes were found within the subsets 5, 7, 8, and 11 (Fig. 4⇑H; for description of subsets, see Fig. 1⇑). These γδ thymocyte subsets are characterized as CD4⁻ and have the phenotype CD1^+/−CD45RC⁻ (less mature stages (6)), irrespective of their CD2/CD8 phenotype. Essentially no CD4⁺ γδ thymocytes or γδ thymocytes with the phenotype CD1⁻CD45RC⁺ (more mature stages (6)) were apoptotic (Fig. 4⇑H, subsets 1–4 and 6, 9, 10, and 12). When the number of apoptotic cells in each individual γδ thymocyte subsets from Fig. 4⇑H was normalized to the number of cells in that particular subset from Fig. 4⇑G, the highest proportion of apoptotic cells was found in subset 7 (Fig. 4⇑I), although there were also substantial numbers of apoptotic cells in subsets 5 and 8 (Fig. 4⇑I).

CD2⁺CD8⁻CD1⁺CD45RC⁻ γδ thymocytes are common precursors of CD4⁻ γδ thymocytes, giving rise to all TCRγδ⁺ subsets that may be found in the periphery

Cell cycle analysis (Fig. 3⇑) showed that only one subset of CD4⁻ γδ thymocytes had the capacity to divide (subset 7, Fig. 1⇑). This particular subset is also most sensitive to apoptosis (Fig. 4⇑I). Among the group of CD4⁺ γδ thymocytes, there are two proliferating subsets (subsets 1 and 3), but they have a very low frequency of apoptosis (Fig. 4⇑I). We therefore investigated individual γδ thymocyte subsets during prolonged culture (Fig. 5⇓). In agreement with previous findings (Fig. 4⇑G) and published results (6), the majority of freshly isolated γδ thymocytes represented subset 7, whereas other CD4⁻ γδ thymocytes (subsets 5–12) were minor at this time point (Fig. 5⇓A, day 0). Regarding CD4⁺ γδ thymocytes (subsets 1–4), the majority of them were located among subsets 1 and 3 (Fig. 5⇓A, day 0). With prolonged culture, the frequency of subset 7 gradually decreased to zero at day 14 of culture as the proportion of subsets 5, 6, 11, and 12 increased (Fig. 5⇓A). However, the frequency of subsets 5 and 11 reached their maximum at day 7 of culture, after which they gradually disappeared, whereas the proportions of subsets 6 and 12 persistently increased to become the only two subsets that remained after 20 days of culture (Fig. 5⇓A). The same overall pattern of γδ thymocyte behavior in culture shown in Fig. 5⇓ was independently confirmed in other experiments in which animals of different age and breed were tested. The only exception was in postnatal pigs, in which the developmental pattern of the culture was the same, but the frequencies of the resultant cells observed at day 20 in fetal animals were reached earlier on approximately day 12. Because above mentioned data have indicated that subset 7 is a common precursor of CD4⁻ γδ thymocytes, we have sorted this subset by FCM (Fig. 6⇓A) and cultured it in complete RPMI 1640 medium for up to 7 days. The obtained results from culture (Fig. 6⇓B) showed the similar pattern as shown in Fig. 5⇓A, with majority of cells in subsets 5, 6, 8, 11, and 12 and no CD4⁺ γδ thymocytes present.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

The frequencies of γδ thymocytes and their individual subsets during prolonged culture (0–20 days). The proportion of individual γδ thymocyte subsets (numbered 1–12 on the x-axis in the same manner as in the Fig. 1⇑ and text) among all γδ thymocytes (A), the proportion of γδ thymocytes among all thymocytes cultured either alone (in complete RPMI 1640 medium only) or on thymic stromal feeder monolayers (B), and the proportion of CD45RC⁺ cells among TCRαβ⁺ (detected as CD3ε^highTCRγδ⁻ cells) and TCRγδ⁺ thymocytes (C) are shown. Individual bars represent average values obtained from 18 animals tested in four independent experiments.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

The frequencies of individual subsets of γδ thymocytes arisen from FCM-sorted γδ thymocyte subset 7 (A) during culture in complete RPMI 1640 medium only (B) or in the presence of thymic stromal feeder monolayer cells (C). A, Shows sorting strategy when freshly isolated thymocytes (ORIGINAL) were stained for TCRγδ, CD1, and CD8, and gated for γδ thymocytes by region R1, and subset 7 (CD2⁺CD8⁻CD4⁻CD1^lowCD45RC⁻) was sorted from gated cells according to CD1/CD8 phenotype as region R2. Sorted cells (SORTED) were reanalyzed in the same manner before culture to check the purity. The proportion of individual γδ thymocyte subsets after culture (B and C) was determined by FCM analysis, as described in Fig. 2⇑. Individual bars in graphs B and C represent the proportion of individual γδ thymocyte subsets (numbered 1–12 on the x-axis in the same manner as in the Fig. 1⇑ and text) among all γδ thymocytes during different time points of culture (z-axis). Bars represent average values obtained in three independent experiments.

The culture experiments revealed that the incubation conditions of complete RPMI 1640 medium are permissive to γδ T cell differentiation and maturation (Fig. 5⇑, A and B, ▪). To additionally support this development, we have also incubated γδ thymocytes in the presence of thymic stromal feeder monolayers (Fig. 5⇑B, □). These results, however, indicate that thymic stromal feeder cells lowered expansion of γδ thymocytes after 7 days of culture. To investigate the effect of thymic stromal feeder monolayers, FCM-sorted subset 7 (Fig. 6⇑A) was cultured on these feeders (Fig. 6⇑C) in the similar manner as for simple RPMI 1640 medium (Fig. 6⇑B). The obtained results (Fig. 6⇑C) showed totally different pattern of development with significant accumulation of CD4⁺ γδ thymocytes, mainly of CD1^lowCD45RC⁻ phenotype.

We have also investigated surface expression of CD45RC on αβ and γδ thymocytes during culture because CD45RC is a maturation marker of the T cell lineage. Fig. 5⇑C shows the proportion of CD45RC⁺ cells among TCRαβ⁺ and TCRγδ⁺ thymocytes. Although a number of CD45RC⁺ αβ thymocytes remained constant during culture (Fig. 5⇑C, ▪), the proportion of CD45RC⁺ γδ thymocytes increased from almost zero to 90–95% in ∼15 days of culture (Fig. 5⇑C, □).

The CD4⁺CD8αβ⁺ γδ thymocytes contain transcript for productive rearranged TCRβ, whereas transcript for rearranged TCRδ declines in these cells

Phenotypic and cell cycle studies suggest that CD4⁺ γδ thymocytes possess unique features in comparison with other γδ thymocytes. They exclusively bear CD8αβ, are always CD1⁺, may coexpress CD45RC, have no counterpart in the periphery, are actively dividing, and although their number decreases during prolonged culture, they do not die. In further analysis, we examine the occurrence of lymphocyte-specific transcripts in FCM-sorted subsets of γδ thymocytes (Fig. 7⇓). Suspensions of all thymocytes were stained, and individual thymocyte subsets were sorted by FCM according to their CD4 and TCRγδ phenotype into four populations in the same manner as indicated in Fig. 4⇑A (regions R1–R4). Following FCM sorting, RT-PCR was performed (Fig. 7⇓). This analysis showed that CD4⁺TCRγδ⁻ thymocytes (Fig. 7⇓, first line) were composed of αβ T lineage cells (TCRα⁺ and TCRβ⁺), including less differentiated precursors (RAG-1⁺ and TdT⁺). We were unable to amplify transcripts typical for B cells (VDJ_H, constant portion of Ig L chain (LC)-κ, LC-λ) or γδ T cells (TCRδ). In contrast, CD4⁻TCRγδ⁺ thymocytes (Fig. 7⇓, third line) were composed of mature γδ T cells (TCRδ⁺) with no TCRα, TCRβ, RAG-1, TdT, VDJ_H, LC-κ, or LC-λ expression. CD4⁻TCRγδ⁻ thymocytes (Fig. 7⇓, fourth line) were composed of mixtures of cells with B cell (VDJ_H⁺, LC-κ⁺, LC-λ⁺) and αβ T cell (TCRα⁺, TCRβ⁺) phenotype, including less differentiated precursors (RAG-1⁺, TdT⁺). Most interestingly, CD4⁺TCRγδ⁺ thymocytes (Fig. 7⇓, second line) contained transcripts typical for γδ T cells (TCRδ⁺), but at the same time, they also contained transcripts for αβ T cells (TCRβ⁺) and transcripts for rearrangement-associated genes (RAG-1⁺, TdT⁺). Because the same number of sorted cells was used for analysis of each subset and CD4⁺TCRγδ⁺ thymocytes clearly bear TCRγδ on their surface, intensity of TCRβ and TCRδ bands indicates that CD4⁺TCRγδ⁺ thymocytes actively transcribe rearranged TCRβ locus, whereas TCRδ transcripts are in decline (Fig. 7⇓, compare intensity of TCRβ and TCRδ bands for CD4⁺TCRγδ⁺ thymocytes with other γδ thymocytes, i.e., CD4⁻TCRγδ⁺ subset). Interestingly, although CD4⁺TCRγδ⁺ thymocytes clearly bear a rearranged TCRβ, they were negative for TCRα (Fig. 7⇓, second line). However, when TCRβ transcript amplified from CD4⁺TCRγδ⁺-sorted cells (Fig. 7⇓, second line) was cloned, amplified in vivo, and sequenced, all of 20 obtained sequences were found to be productive (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Detection of transcripts for pre-TCRα (pTα), TCRα V region (TCRα), TCRβ V region (TCRβ), TCRδ V region (TCRδ), RAG-1, TdT, Ig H chain V region (VDJ_H), and LC-κ and LC-λ in the sorted thymocyte subsets. β-actin was used as a control for determining relative transcript transcription. Thymocytes isolated from 100-day-old fetuses were stained with anti-TCRγδ and anti-CD4, and individual CD4/TCRγδ thymocyte subsets were sorted by FCM in the same manner as indicated in Fig. 4⇑A. All sorted cells were reanalyzed to ensure quality and efficiency of the sort (>99%). The results are representative of five experiments using DG80, DG95, DG100, and DG112 fetuses, and 14-day-old piglets.

The CD4⁺CD8αβ⁺ γδ thymocytes alter their phenotype and differentiate along the αβ T cell lineage program

Because unique features of CD4⁺ γδ thymocytes resemble αβ T lineage cells in their development, we have sorted this subset by FCM (Fig. 8⇓, A and B), cultured it for up to 14 days, and inspect resultant cells from culture for presence of αβ T cells (Fig. 8⇓C). Because of the current unavailability of a mAb specific for TCRαβ, putative αβ T cells in this work were detected as CD3ε^highTCRγδ⁻ cells, as it was shown that this approach is sufficient for identification of αβ T cells (6, 7). The obtained results showed that at least a part of CD4⁺ TCRγδ⁺ thymocytes could revert their phenotype to become αβ T cells (Fig. 8⇓C; CD3ε⁺TCRγδ⁻). Reanalysis of resultant cells from culture that kept TCRγδ⁺ phenotype (Fig. 8⇓C; CD3ε⁺TCRγδ⁺) showed that they remain CD4⁺ (data not shown). The culture in complete RPMI 1640 medium (Fig. 8⇓) or in the presence of thymic stromal feeder monolayers (data not shown) did not result in any differences. To additionally prove the αβ T cell nature of resultant cells from the culture (Fig. 8⇓C), TCRα and TCRβ transcripts were amplified (data not shown). VDJ rearrangements of amplified TCRβ transcripts were further analyzed by high-resolution CDR3 length analysis (Fig. 8⇓D). Semipolyclonal patterns were a common feature of all samples, indicating a broad TCRβ repertoire resulting from different αβ T cell clones.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 8.

Analysis of FCM-sorted CD4⁺ γδ thymocytes after culture in complete RPMI 1640 medium. Note that cells cultured in the presence of thymic stromal feeder monolayers (data not shown) did not result in any differences. Freshly isolated thymocytes were stained for TCRγδ and CD4, gated for CD4⁺ γδ thymocytes, and sorted by FCM (A). Sorted cells were reanalyzed before culture to check the purity (B). The resultant cells after 14 days of culture in complete RPMI 1640 medium were stained for TCRγδ and CD3ε for analysis of the proportion of γδ (CD3ε⁺TCRγδ⁺) and αβ (CD3ε⁺TCRγδ⁻) T cells (C). The second part of resultant cells was used for RNA isolation, amplification of TCRβ transcripts, and analysis of VDJ rearrangements by high-resolution CDR3 length analysis (D). The results are representative of three independent experiments.