Corticosteroid Inhibition of Growth-Related Oncogene Protein-α via Mitogen-Activated Kinase Phosphatase-1 in Airway Smooth Muscle Cells

Reagents

All tissue culture reagents and chemicals were obtained from Sigma-Aldrich, unless otherwise stated. Protease inhibitor mixture was obtained from Roche Diagnostic. Cell culture plasticware was purchased from Falcon Labware (BD Biosciences). Human rIL-1β and rTNF-α, as well as the matched Ab pairs for GRO-α ELISA were purchased from R&D Systems. The Abs for Western blotting (JNK; phospho-JNK) were purchased from New England Biolabs, whereas the MKP-1 Ab was purchase from Santa Cruz Biotechnology.

Isolation of human ASMC

Human ASMC were dissected out from lobar or main bronchus obtained from patients undergoing lung resection for carcinoma of the bronchus, as previously described (2, 12). Cells were maintained in DMEM containing 10% FCS supplemented with sodium pyruvate (1 mM), l-glutamine (2 mM), nonessential amino acids (1/100), penicillin (100 U/ml⁻¹), streptomycin (100 μg/ml⁻¹), and amphotericin B (1.5 μg/ml⁻¹) in a humidified atmosphere at 37°C in air/CO₂ (95:5% v/v). Confluent cells were passaged with 0.25% trypsin and 1 mM EDTA. Human ASMC at passages 3–7 from 12 different donors were used in the studies described below. ASMC were characterized by positive immunostaining with an anti-calponin, anti-smooth muscle α-actin, and anti-myosin H chain Abs (all at 1/400; Sigma-Aldrich).

Measurement of GRO-α

Human ASMC were serum deprived for 24 h using serum-free medium (SFM), which consists of DMEM supplemented with sodium pyruvate (1 mM), l-glutamine (2 mM), nonessential amino acids (1/100), penicillin (100 U/ml)/streptomycin (10,000 μg/ml⁻¹), amphotericin B (1.5 μg/ml⁻¹), BSA (0.1%), and ascorbic acid (100 μM). Cells were stimulated in duplicate for 24 h in fresh SFM containing cytokines, IL-1β (0.01 ng/ml⁻¹), or TNF-α (1 ng/ml⁻¹). After 24 h, the supernatants were collected and stored at −20°C. GRO-α levels were measured by using dual set ELISA kit (R&D Systems), according to the manufacturer’s instructions. The samples were diluted until the cytokine level was within the linear range of the standard curve. The detection threshold was 31.25 pg/ml⁻¹.

RNA preparation and real-time PCR

Cells were plated at a seeding density of 1 × 10⁴ cells/cm⁻² in six-well plates. The 24-h serum-deprived cells were stimulated in duplicate with IL-1β (0.1 ng/ml⁻¹) or TNF-α (1 ng/ml⁻¹) either alone or in the presence of dexamethasone (10⁻⁸–10⁻⁵ M) for either 1 or 24 h. Cells were harvested and total RNA was isolated using the Qiagen RNase easy extraction kit (RNeasy Mini; Qiagen), according to the manufacturer’s instructions. First-strand cDNA was synthesized in a volume of 60 μl containing 0.25 μg of total RNA. For the real-time PCR, 0.5 μl of the RT-PCR first strand cDNA and 0.5 μM primers were used in total 20-μl reaction containing 10 μl of Universal SYBR Green Master Mix (Qiagen) using a Rotor-Gene 3000TM Four-Channel Multiplexing System (Corbett Research).

The primers used were as follows: GRO-α, ATGGCCCGCGCTGCTCTCTCC (forward) and GTTGGATTTGTCACTGTTCAG (reverse); GAPDH, GAAGATGGTGATGGGATTTC (forward) and GAAGGTGAAGGTCGGAGT (reverse); MKP-1, GTACATCAAGTCCATCTGAC (forward) and GGTTCTTCTAGGAGTAGACA (reverse); and 18S, TGAAGAACGAAAGTGGGAGGT (forward) and GGACATCTAAGGGCATCACAG (reverse).

A standard was generated for the internal control and the test primer using a serial dilution of a sample as a template. The conditions of the reaction were as follows: denature at 95°C for 15 min, followed by denaturing step (20 s at 94°C) and annealing step (60°C for 20 s) for 45 cycles. GAPDH or 18S expression was performed in a parallel tube, and all reactions were undertaken in duplicate. Target mRNA was normalized to GAPDH mRNA, expressed relative to control, which was given a value of 1 for each donor.

Effect of dexamethasone on GRO-α expression

ASMC were serum deprived for 24 h. The cells were preincubated for 1 h with dexamethasone (10⁻⁸–10⁻⁵ M) or diluents alone in fresh SFM before addition of IL-1β (0.1 ng/ml⁻¹) or TNF-α (1 ng/ml⁻¹). The supernatants were collected after 24-h incubation at 37°C in a CO₂ incubator and stored at −20°C. RNA was extracted from the remaining cells, as described earlier. Colorimetric dyes, MTT, and crystal violet were used to measure the viability of cells.

Western blot of phosphorylated JNK, ERK, p38 MAPK, and MKP-1

Serum-deprived cells at a seeding density of 1 × 10⁴ cells/cm² in SFM for 24 h were preincubated for 1 h with either 1 μM dexamethasone or the diluent alone in fresh SFM before addition of either IL-1β (0.1 ng/ml⁻¹) or TNF-α (1 ng/ml⁻¹). The cells were collected after incubation at 37°C in a CO₂ incubator. The cells were rinsed with ice-cold PBS and lysed in radioimmunoprecipitation assay buffer (PBS containing 0.5% sodium deoxycholate, 0.1% SDS, 1% Igepal, 200 μM Na₃VO₄, and protease inhibitor mixture (1 tablet/10 ml buffer)). Cells were scraped off the wells and followed by centrifugation (10,000 × g, 4°C, 4 min). Protein concentrations were determined using a protein assay reagent kit (Pierce).

Total protein extracts heated at 90°C for 5 min were separated by SDS-PAGE (10 μg per lane) using 4–12% polyacrylamide precast gel (NOVEX; Invitrogen Life Technologies), transferred to membranes, and blotted with anti-MKP-1 Ab (Santa Cruz Biotechnology) or anti-phosphorylated threonine and tyrosine residues of JNK, p42/44 ERK, or p38-MAPK (all 1/1,000), according to the manufacturer’s instruction (New England Biolabs). After washing with PBS/T, the membrane was incubated with HRP-conjugated secondary Ab (goat anti-rabbit IgG 1/2,000) for 1 h at room temperature. Membranes were thoroughly washed with PBS/T and visualized by ECL (LumiGLO; Kirkegaard & Perry Laboratories). The membranes were reprobed with anti-JNK Ab. To confirm the equal protein loading, a mouse anti-GAPDH mAb (1/20,000; clone 6G5; Biogenesis) was also applied.

Band intensities on autoradiographs were quantified using software from Ultraviolet Products. Densitometric data for the phosphorylated band were normalized for equal loading by dividing the phosphorylated value to total nonphosphorylated band or GAPDH, and then normalized to control cells, which were set to 1.0.

Small interfering RNAs (siRNAs) against MKP-1 and MKP-1 overexpression vector

MKP-1 was inhibited by using RNA interference technology. Human ASMC were transiently transfected with MKP-1-specific siRNA, a SMART pool consisting of four siRNAs designed by Dharmacon. As a control for the siRNA, a scrambled sequence that was not complementary to any known genes was also transfected.

Cells were also transfected with pFlagCMV2 alone or containing MKP-1 overexpression vector obtained as a gift from A. Clark (Kennedy Institute of Rheumatology Division, Imperial College, London, U.K.) (13).

The Amaxa’s Nucleofector electroporation method was used to transfect the siRNA into ASMC, using the manufacturer’s protocol. We used cotransfection of pmaxGFP (Amaxa), encoding the GFP with a siRNA directed against maxGFP. We monitored the success of gene silencing as a decrease of green fluorescence compared with control sample using fluorescence microscopy. We also transfected the cells with RNA-induced silencing complex-free CY3-labeled siRNA and used confocal microscopy to monitor transfection. Semiconfluent ASMC transfected with MKP-1 siRNA were starved for an additional 24 h, followed by treatment with IL-1β. After 1 h, MKP-1 mRNA was measured using real-time RT-PCR, and after 30 min, 1 h, or 24 h, MKP-1 and phospho-JNK were measured by Western blot analysis. Supernatants were collected after 24 h to measure GRO-α release by ELISA.

Immunocytochemistry

Immunostaining was performed to detect the nuclear translocation of glucocorticoid receptor (GR) induced by dexamethasone and IL-1β in human ASMC cultures on chamber slides. Cells were fixed and permeabilized, and nonspecific binding was blocked, followed by incubation with control or the primary anti-GR Ab (1/100; Santa Cruz Biotechnology) overnight at 4°C. After washing, Rhodamine Red-X-conjugated donkey anti-rabbit IgG 1/200 (Jackson ImmunoResearch Laboratories) was applied at room temperature, followed by thorough washing, then staining with 4′,6′-diamidino-2-phenylindole (300 nM). Staining was visualized using confocal microscopy.

Measurements of NF-κB- and GR-binding activities

We determined the effect of dexamethasone on NF-κB- and GR DNA-binding activities in ASMC using an ELISA-based assay (TransAM Transcription Factor Assay kit; Active Motif). Briefly, ASMC were pretreated with dexamethasone (10⁻⁶ M) or medium only for 1 h, followed by adding IL-1β (0.1 ng/ml⁻¹) or medium for additional 1 h. Nuclear extracts were used to determine the binding activity of p65, a component of NF-κB, or the binding activity of GR, according to the manufacturer’s instructions.

Chromatin immunoprecipitation (ChIP) assay

We applied ChIP assay to determine the status of the GR binding site at the promoter region of the MKP-1 gene in response to IL-1β in the presence of dexamethasone. The ChIP assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin. As described before (5), ASMC exposed to dexamethasone (10⁻⁶ M) or DMEM alone for 1 h before adding IL-1β (0.1 ng/ml⁻¹) were collected, and protein-DNA complexes were cross-linked with 1% formaldehyde. Following lysis and sonication, supernatants were collected, and one-tenth of the total lysate was used for total genomic DNA as input DNA control. From the rest of the supernatant, the soluble chromatin solution was immunoprecipitated by using anti-GR or p65 Ab (Santa Cruz Biotechnology). Protein-bound immunoprecipitated DNA fragments were purified with phenol/chloroform and the pellet was resuspended in nuclease-free water. Quantitative PCR was performed with DNA sample from both sample and input (Rotor-Gene 3000TM Four-Channel Multiplexing System; Corbett Research) with a QuantiTect SYBR Green PCR Kit (Qiagen) to quantify the immunoprecipitated DNA. The PCR primers corresponding to sequences within the NF-κB binding site on the GRO-α promoter reagent were: forward (5′-CGT CGC CTT CCT TCC GGA CTC G-3′) and reverse (5′-GCT CTC CGA GAT CCG CGA ACCC-3′). The putative GRE binding site on MKP-1 promoter reagent was used to design the PCR primers for GRE: forward (5′-TT GCT TTC GGC CTA TAA CG-3′) and reverse (5′-TGA GCT TCT CCA TCC CTT TC). Cycling parameters were 95°C for 15 min to activate HotStarTaq DNA polymerase, followed by annealing and extension at 45 cycles of 94°C for 15 s, 60°C for 25 s, and 72°C for 25 s. The samples were normalized with each corresponding input. Data were expressed relative to the untreated control, which was given a value of 1 for each donor.

Data analysis

Data are presented as mean ± SEM. Data were compared using one-way ANOVA, followed by Newman-Keuls test post hoc to determine statistical differences after multiple comparisons. A p value of <0.05 was considered significant.

Effect of dexamethasone on GRO-α expression and release

Dexamethasone (10⁻⁸–10⁻⁵ M) partly inhibited IL-1β (0.1 ng/ml⁻¹)- or TNF-α (1 ng/ml⁻¹)-induced GRO-α mRNA expression, with a maximal inhibition of 50 and 60% at 10 μM, respectively (p ≤ 0.01) (Fig. 1⇓, A and B). Dexamethasone also partly attenuated GRO-α protein release stimulated by IL-1β (p ≤ 0.001; n = 5) and by TNF-α (p ≤ 0.05; n = 3) (Fig. 1⇓, C and D). Neither IL-1β, TNF-α, dexamethasone, nor the combination had any effect on cell viability.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Inhibition of IL-1β- or TNF-α-induced GRO-α mRNA (A and B, respectively) and release (C and D) by dexamethasone (Dex). Data are expressed as a percentage of the control response to either IL-1β or TNF-α and as mean ± SEM of four to five donors. mRNA expression is expressed as a ratio of GAPDH with the baseline expressed as 1. ∗, p ≤ 0.05; ∗∗, p ≤ 0.01; and ∗∗∗, p ≤ 0.001 compared with IL-1β or TNF-α alone.

Effect of dexamethasone on GR nuclear translocation and NF-κB DNA binding

To investigate the effect of dexamethasone on GR nuclear translocation, we performed immunostaining of ASMC with an anti-GR Ab. Dexamethasone increased GR nuclear translocation in untreated cells as measured by immunostaining, whereas IL-1β or TNF-α alone had no effect; there was no further effect with the combination of IL-1β or TNF-α with dexamethasone (Fig. 2⇓A). These observations were confirmed by the measurement of GR-binding activity, which was increased by dexamethasone, but not IL-1β or TNF-α (data not shown). We investigated the effect of dexamethasone on p65 DNA-binding activity and on p65 binding to the GRO-α promoter by ChIP assay. Dexamethasone (10⁻⁶ M) alone had no effect on either total NF-κB activity or p65 binding on GRO-α promoter. IL-1β or TNF-α alone increased p65 activity, and this effect was further enhanced by 20–30%, respectively, in the presence of dexamethasone (Fig. 2⇓, B and C). IL-1β, but not dexamethasone, increased p65 binding on GRO-α promoter (Fig. 2⇓D).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

A, Immunostaining of ASMC with an anti-GR Ab showing increased GR nuclear translocation after dexamethasone (10⁻⁶ M). ASMC were pretreated with dexamethasone for 1 h, followed by further treatment with either IL-1β (0.1 ng/ml⁻¹), TNF-α (1 ng/ml⁻¹), or dexamethasone only for additional 1 h. Neither IL-1β nor TNF-α altered the effect of dexamethasone on GR nuclear translocation. The negative control showed no specific immunostaining. B and C, Effect of dexamethasone and IL-1β or TNF-α on p65 DNA-binding activity. IL-1β and TNF-α alone induced a significant increase in p65 binding, whereas dexamethasone did not. Data are expressed as a percentage of the response induced by either IL-1β or TNF-α. D, ChIP assay demonstrating the binding of p65 to chromatin in response to IL-1β and dexamethasone, or both together. IL-1β induced a significant increase in binding, whereas dexamethasone did not. E, Effects of histone deacetylase inhibitor, TSA, on dexamethasone inhibition of GRO-α release induced by IL-1β. TSA (100 ng/ml) partially reversed the inhibitory effect of dexamethasone on GRO-α release induced by IL-1β. Data are mean ± SEM from three different donors. #, p ≤ 0.05 compared with the absence of TSA.

Effect of trichostatin A (TSA) on dexamethasone-induced GRO-α inhibition

To determine the role of chromatin remodeling in dexamethasone’s inhibition of IL-1β-induced GRO-α release, we studied the effect of the inhibitor of histone deacetylase, TSA. TSA (100 ng/ml) caused a significant reversal of dexamethasone’s effect. To determine whether TSA could interfere with MKP-1 expression, we examined the effect of TSA (100 ng/ml) on dexamethasone and IL-1β-induced MKP-1 mRNA expression measured by real-time PCR. We found that TSA had no significant effect (data not shown).

Effect of dexamethasone on MAPK phosphorylation

To investigate whether dexamethasone acted through MAPK pathway to inhibit GRO-α release, we studied its effect on JNK, ERK, and p38 MAPK phosphorylation. Human ASMC stimulated with IL-1β or TNF-α for 30 min enhanced the phosphorylation of JNK; pretreatment with dexamethasone (10⁻⁶ M) for 1 h significantly inhibited IL-1β- or TNF-α-induced JNK phosphorylation (Fig. 3⇓, A–C). Although IL-1β also caused activation of p42/44 ERK and p38 MAPK, there was no significant effect of dexamethasone on these effects (Fig. 3⇓, D–G).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Inhibition by dexamethasone of IL-1β (0.1 ng/ml⁻¹)- and TNF-α (1 ng/ml⁻¹)-induced JNK phosphorylation. Representative Western blot showing phosphorylated JNK (p-JNK) and total JNK after either IL-1β (A) or TNF-α (B) in two different donors (1 and 2). The mean-fold changes in phosphorylated JNK derived from densitometric quantification of autoradiographs are shown in C. D and F, Representative Western blots for phosphorylated and total p38 and ERK, respectively. E and G, Mean-fold changes in phosphorylated p38 by IL-1β and dexamethasone, and in phosphorylated p44 and p42 ERK after IL-1β and after IL-1β plus dexamethasone. The data were normalized for equal loading using GAPDH, then expressed as relative to IL-1β, which was set to 1. Data shown as mean ± SEM from five different donors. ∗, p ≤ 0.05; ∗∗∗, p ≤ 0.01 compared with IL-1β or TNF-α alone.

Effect of dexamethasone on MKP-1 expression

MKP-1 mRNA was increased following treatment with dexamethasone (10⁻⁶ M) alone with a maximal effect at 2 h. TNF-α (1 ng/ml⁻¹) and IL-1β (0.1 ng/ml⁻¹) also increased MKP-1 mRNA expression with a maximum effect at 1 h. Dexamethasone (10⁻⁶ M) enhanced MKP-1 induced by IL-1β or TNF-α (Fig. 4⇓, A and B). Dexamethasone or IL-1β alone significantly increased MKP-1 protein expression transiently at 1 h, as measured by Western blotting. There was a greater increase in expression with dexamethasone and IL-1β added together (p ≤ 0.001; n = 4; Fig. 4⇓, C and D), with maximal induction at 1 h, and persisting with less abundance at 24 h.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Enhancement of IL-1β- or TNF-α-induced MKP-1 mRNA expression by dexamethasone (Dex) (A and B, respectively). Data shown as mean ± SEM of the normalized data to GAPDH and expressed as relative to unstimulated control (medium only) for each time point separately, which was set to 1. Maximum MKP-1 induction was observed at 1 h with IL-1β (0.1 ng/ml⁻¹) and dexamethasone (Dex; 10⁻⁶ M) compared with medium only (∗∗∗, p ≤ 0.001; n = 5) or compared with cells treated with either IL-1β or Dex alone (∗∗, p ≤ 0.01; n = 5). C, A representative time course of MKP-1 protein expression, and phosphorylated and total JNK, p38, and ERK on Western blots after either medium only or dexamethasone or IL-1β alone or IL-1β with dexamethasone (10⁻⁶ M). Dexamethasone and IL-1β caused sustained increase in expression of MKP-1 for up to 4 h. D, Time course of mean MKP-1 expression from four donors. Data shown as mean ± SEM of fold-change over control. There was a sustained increased expression of MKP-1 with IL-1β and dexamethasone up to 4 h. ∗, p ≤ 0.05; ∗∗, p ≤ 0.01; ∗∗∗, p ≤ 0.001; #, p < 0.05; ##, p < 0.01; ###, p < 0.001 vs control (without IL-1β or Dex) at each time point.

Effect of MKP-1 siRNA on dexamethasone suppression

We first determined whether we could transfect siRNA into ASMC by using Cy3-conjugated siRNA with pmaxGFP and by detecting the presence of Cy3 within the cytoplasm by confocal microscopy. GFP plasmid and Cy3-labeled siRNA fluorescence were detected in the majority of the cells at 24 h after electroporation (data not shown). Cells transfected with MKP-1 SMART pool siRNA and treated with IL-1β showed a significant reduction of MKP-1 expression (p ≤ 0.001; n = 3) compared with cells exposed to scrambled siRNA. Similarly, MKP-1-siRNA-transfected cells treated with IL-1β and dexamethasone (10⁻⁶ M) showed a significant reduction in dexamethasone-induced MKP-1 mRNA and protein expression when compared with cells treated with scrambled control (p ≤ 0.001; n = 3; Fig. 5⇓, A and B). The inhibition of MKP-1 was observed at 30 min, 1 h, and 24 h (Fig. 5⇓C).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

A, The effect of MKP-1 down-regulation with MKP-1 siRNA transfection on MKP-1 mRNA expression. Data normalized to 18S shown as mean ± SEM and expressed as relative to control, which are IL-1β- and dexamethasone-treated cells in the presence of scrambled siRNA, set to 1. MKP-1 siRNA significantly inhibited MKP-1 induced by IL-1β and dexamethasone (∗∗∗, p ≤ 0.001; ###, p < 0.001 compared with cells not exposed to dexamethasone or IL-1β; n = 3). B, A representative Western blot for phosphorylated and total JNK, p38, and ERK (left panel) and mean densitometric graph (right panel) following treatments with IL-1β or IL-1β with dexamethasone in cells at 30 min and 1 h following transfection with MKP-1 siRNA or scrambled siRNA. MKP-1 protein expression was significantly reduced in MKP-1 siRNA-treated cells, even following IL-1β and dexamethasone exposure. +++, p ≤ 0.001 compared with scrambled control; ∗∗, p < 0.01; ∗∗∗, p ≤ 0.001. Data shown as mean ± SEM from three donors. C, Time course of representative Western blots of MKP-1, p-JNK, total JNK, and GAPDH expression in three donors (1, 2, and 3) (left panel) and of mean MKP-1 densitometric measurements (right panel) in cells transfected with scrambled or MKP-1 siRNA, followed by treatment with IL-1β and dexamethasone. The reduction in MKP-1 expression was present at 30 min and lasted for 24 h. ∗, p ≤ 0.05; ∗∗, p < 0.01; ∗∗∗, p ≤ 0.001.

ASMC transfected with MKP-1 siRNA showed an increase in p-JNK expression compared with those exposed to scrambled siRNA in cells stimulated with IL-1β or the combination of IL-1β and dexamethasone (Fig. 6⇓A). This effect was observed at 30 min and 1 h, but not at 24 h (Fig. 6⇓B). This indicates that the inhibition of MKP-1 reversed dexamethasone’s inhibitory effect on JNK activation induced by IL-1β. In contrast, transfection with MKP-1 siRNA had no effect on phospho-ERK and phospho-p38 expression induced by IL-1β, dexamethasone, or both (Fig. 6⇓, C and D).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Effect of MKP-1 siRNA on phosphorylated JNK expression measured by Western blotting at 30 min (A), and time course of this effect (B). There was a significant increase in p-JNK expression at 30 min and 1 h, but not at 24 h following MKP-1 siRNA transfection. C and D, The expression of phospho-p38 and phospho-ERK in cells transfected with scrambled or MKP-1 siRNA. E, The effect of siRNA transfection on GRO-α release. Dexamethasone significantly inhibited GRO-α release induced by IL-1β in cells exposed to scrambled siRNA, but did not in cells transfected with MKP-1 siRNA. In addition, IL-1β caused a greater release of GRO-α in cells exposed to MKP-1 siRNA compared with those exposed to scrambled siRNA. Data shown as mean ± SEM of three donors. ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p ≤ 0.001; #, p < 0.05; ##, p < 0.01; ###, p < 0.001; +++, p < 0.001 compared with cells not exposed to IL-1β and dexamethasone.

Supernatants from cells transfected with SMART pool MKP-1 siRNA and exposed to IL-1β and dexamethasone were assayed for GRO-α. ASMC treated with MKP-1 siRNA showed significantly increased GRO-α release in the presence of IL-1β or the combination of IL-1β and dexamethasone (Fig. 6⇑E). However, in these cells, dexamethasone did not significantly inhibit the release of GRO-α induced by IL-1β, in contrast to the inhibition observed in the cells treated with scrambled siRNA.

Effect of MKP-1 overexpression

Transfection with the vector pCMV-Flag-MKP-1 increased MKP-1 mRNA and protein expression in dexamethasone (10⁻⁶ M)- and IL-1β (0.1 ng/ml⁻¹)-treated cells compared with those transfected with empty vector (Fig. 7⇓, A and B). There was a greater induction of MKP-1 protein in MKP-1-overexpressing cells induced by IL-1β and dexamethasone compared with those transfected with empty vector (Fig. 7⇓B). MKP-1-transfected cells caused significantly less release of GRO-α when exposed to either IL-1β or the combination of IL-1β and dexamethasone (Fig. 7⇓C). However, dexamethasone significantly inhibited IL-1β-induced GRO-α release in both MKP-1-transfected and nontransfected cells (Fig. 7⇓C).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Baseline MKP-1 mRNA expression following transfection with either an overexpression vector CMV-pFlag-MKP-1 or an empty vector (A). Data shown as mean ± SEM from two donors. B, Representative Western blot for MKP-1, phosphorylated JNK, p-ERK protein expression in one donor. C, The effect of MKP-1 overexpression vector on the release of GRO-α. There was a significant reduction in IL-1β- and in IL-1β with dexamethasone-induced GRO-α release in cells overexpressing MKP-1. Dexamethasone still inhibited IL-1β-induced GRO-α. Data shown as mean ± SEM of three donors. ∗∗, p ≤ 0.01; ∗∗∗, p ≤ 0.001 compared with effect of empty vector; ##, p ≤ 0.01; ###, p ≤ 0.001.

Effect of dexamethasone on GR binding to MKP-1 promoter

Normalized samples with total input DNA control amplification (input DNA) showed a marked enrichment of the MKP-1 promoter DNA after dexamethasone treatment, which was further increased following both dexamethasone and IL-1β (p ≤ 0.001 compared with dexamethasone alone; n = 3; Fig. 8⇓).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 8.

ChIP assay to demonstrate the binding of GR to the MKP-1 promoter. Immunoprecipitated samples with an anti-GR Ab were amplified. ChIP assay shows an increase in GR binding to the MKP-1 promoter reagent in cells treated with dexamethasone alone (∗∗, p < 0.01, compared with cells not exposed to dexamethasone or IL-1β) or with dexamethasone and IL-1β (∗∗∗, p < 0.001). ###, p < 0.001. NA, Represents results from samples in which no Ab has been added. A, The mean data ± SEM of three donors. B, Representative cycle-product profile as fluorescence from one experimental run of immunoprecipitated (IP) samples.