Deficiency of P-Selectin or P-Selectin Glycoprotein Ligand-1 Leads to Accelerated Development of Glomerulonephritis and Increased Expression of CC Chemokine Ligand 2 in Lupus-Prone Mice

Xiaodong He, Trenton R. Schoeb, Angela Panoskaltsis-Mortari, Kurt R. Zinn, Robert A. Kesterson, Junxuan Zhang, Sharon Samuel, M. John Hicks, Michael J. Hickey and Daniel C. Bullard
J Immunol December 15, 2006, 177 (12) 8748-8756; DOI: https://doi.org/10.4049/jimmunol.177.12.8748

Abstract

The selectins and their ligands mediate leukocyte rolling on endothelial cells, the initial step in the emigration cascade leading to leukocyte infiltration of tissue. These adhesion molecules have been shown to be key promoters of acute leukocyte emigration events; however, their roles in the development of long-term inflammatory responses, including those that occur during chronic inflammatory diseases such as systemic lupus erythematosus, are unclear. To assess participation of P-selectin in such disorders, we studied the progression of systemic lupus erythematosus-like disease in P-selectin-deficient and control MRL/MpJ-Faslpr (Faslpr) mice. Surprisingly, we found that P-selectin deficiency resulted in significantly earlier mortality, characterized by a more rapid development of glomerulonephritis and dermatitis. Expression of CCL2 (MCP-1) was increased in the kidneys of P-selectin mutant mice and in supernatants of LPS-stimulated primary renal endothelial cell cultures from these mice. A closely similar phenotype, including elevated renal expression of CCL2, was also observed in Faslpr mice deficient in the major P-selectin ligand, P-selectin glycoprotein ligand-1. These results indicate that P-selectin and P-selectin glycoprotein ligand-1 are not required for leukocyte infiltration and the development of autoimmune disease in Faslpr mice, but rather expression of these adhesion molecules is important for modulating the progression of glomerulonephritis, possibly through down-regulation of endothelial CCL2 expression.

In systemic lupus erythematosus (SLE),3 loss of immunologic tolerance and autoantibody formation can lead to various immune complex (IC)-mediated inflammatory lesions (reviewed in Ref. 1). Glomerulonephritis is the most salient manifestation, but vasculitis and other pathologic vascular processes also occur (2, 3, 4). The pathogenesis of abnormal inflammation in SLE is not entirely clear, but one basic pathway is that IC deposition activates complement, endothelial cells, leukocytes, and other cells such as mesangial cells, leading to leukocyte infiltration and tissue damage (5, 6, 7). Leukocyte and endothelial cell adhesion proteins, along with chemokines and other activating molecules, are thought to play important roles in promoting leukocyte recruitment (8, 9). Several studies have shown that β2 integrin/ICAM-1 interactions are essential in this process, with loss or inhibition of these adhesion proteins leading to reduced leukocyte recruitment and decreased disease severity in lupus models (10, 11, 12, 13). However, the contribution of other adhesion molecules in the development of inflammatory lesions in SLE remains to be determined.

The selectin family of adhesion molecules (P-, E-, and L-selectin) mediate leukocyte rolling, the first step in the emigration of leukocytes from the vasculature into tissue during an inflammatory response (reviewed in Ref. 14). These proteins share a common structure, including an N-terminal calcium-dependent lectin-binding domain, and are expressed on endothelial cells (P- and E-selectin), platelets (P-selectin), or leukocytes (L-selectin). Selectin expression can be increased in tissues of SLE patients (15, 16, 17, 18, 19, 20), but little information is available regarding the functions of selectins in this disease. Furthermore, studies in animal models of IC-mediated inflammation related to SLE have often produced conflicting results. For example, several investigations in short-term models of glomerulonephritis have shown that selectin blockade can significantly inhibit acute leukocyte recruitment and tissue damage (21, 22, 23, 24, 25), whereas in the long-term antiglomerular basement membrane model, P-selectin-deficient mice had increased mortality and more severe glomerulonephritis (26).

Studies in SLE mouse models have shown limited vascular expression of P-selectin and E-selectin in mice at different stages of disease development, which may indicate a minor role for these adhesion molecules (27). However, it is clear from our previous work that these molecules are expressed at sufficient levels to support leukocyte rolling events in the dermal and cerebral microvasculatures in lupus-prone MRL/MpJ-Faslpr (Faslpr) mice, suggesting that these adhesion molecules may be functional in promoting inflammatory disease in this mouse model and SLE (28, 29). In the present study, we analyzed Faslpr mice deficient in P-selectin or its major ligand P-selectin glycoprotein ligand-1 (PSGL-1) to determine the roles of these adhesion molecules in IC-mediated SLE-like vascular inflammation. Unexpectedly, we found that loss of expression of P-selectin or PSGL-1 was not protective, but led to accelerated forms of glomerulonephritis and dermatitis. The rapid progression of glomerulonephritis in these adhesion molecule mutant mice was also associated with increased expression of the chemokine CCL2 in both kidney tissue and in purified renal endothelial cells. These findings suggest that P-selectin and PSGL-1 play key roles in regulating the development of glomerulonephritis in this model, possibly through inhibition of CCL2 expression.

Materials and Methods

Mice

P-selectin−/− Faslpr−/− double homozygous mice (P-sel/Faslpr) were generated as previously described (29). PSGL-1 mutant mice were a gift from Drs. B. C. Furie and B. Furie, Harvard Medical School, Boston, MA (30). The PSGL-1 mutation was backcrossed for eight generations onto the MRL/MpJ-Faslpr strain (The Jackson Laboratory), followed by intercrossing to generate PSGL-1−/− Faslpr−/− double homozygotes (PSGL-1/Faslpr). Inbred Faslpr−/− mice were used as controls for all the experiments. Animal housing, care, and all experimental manipulation were conducted according to the Guide for the Care and Use of Laboratory Animals and with approval of the institutional animal care and use committee.

Histopathology and assessment of dermatitis

Detailed pathologic studies were performed on a minimum of five Faslpr, P-sel/Faslpr, and PSGL-1/Faslpr gender- and age-matched mice at 16 and 20 wk of age. Necropsies were also performed on additional Faslpr and P-sel/Faslpr mice that died between 21 and 37 wk of age. Tissues were fixed in 70% ethanol/10% formalin, routinely processed and embedded in paraffin, sectioned at 5 μm, and stained with H&E or periodic acid-Schiff and hematoxylin. For ultrastructural examination, kidney specimens were fixed in glutaraldehyde, embedded in plastic, and analyzed by transmission electron microscopy.

Kidney lesions were evaluated by subjective scoring, without the pathologist’s knowledge of the genotype of the mice, as previously described (12). Specific changes evaluated were glomerular cellularity, necrosis, crescent and synechia formation, neutrophil accumulation, capillary basement membrane thickening and reduplication, mesangial sclerosis, capsular and periglomerular fibrosis, tubular changes, interstitial inflammatory cell accumulation, and interstitial fibrosis. Each was scored 0, 1, 2, or 3 for normal, mild, or severe, respectively. At least 6, and up to 15, glomeruli and adjacent tubules and interstitium were evaluated from both H&E- and periodic acid-Schiff and hematoxylin-stained sections from each mouse, and equal numbers of glomeruli from superficial, middle, and deep cortex were examined. Only glomeruli sectioned through the approximate center of the tuft and including the base of the tuft were included. Overall lesion scores for each mouse were calculated as the mean of summed individual scores for each glomerulus, with scores for necrosis and crescent formation each weighted by a factor of 2. Clinical signs of cutaneous inflammation were assessed weekly by visual inspection of the mice.

Immunohistochemical staining

For the detection of monocytes and macrophages, kidneys were embedded in OCT, snap-frozen in liquid nitrogen, sectioned at 6 μm, fixed in ice-cold acetone, and air dried. After rehydration, the sections were blocked with 10% goat serum, incubated with rat anti-mouse CD68 (Vector Laboratories), and then incubated with HRP-conjugated goat anti-rat IgG (H+L) Ab (Southern Biotechnology Associates). To detect T cells, sections were deparaffinized in xylene and rehydrated in PBS, followed by microwave Ag retrieval. Sections were then blocked as described above, incubated with polyclonal rabbit anti-mouse CD3 (DakoCytomation), washed, and incubated with biotin-conjugated goat anti-rabbit IgG (H+L) (Southern Biotechnology Associates) and with peroxidase ABC (Vector Laboratories). Both frozen and paraffin sections were developed with diaminobenzidine (Vector Laboratories) and counterstained with hematoxylin. Immunostained cells were counted in 6–15 glomeruli (equal numbers from superficial, middle, and deep cortex) for each mouse. Only cells within the glomerular tuft were counted and stained cells external to the capsule were excluded.

Kidney function assay

We measured renal function using radioactive 99mTc-mercaptoacetyltriglycine (MAG3). Normal functioning kidneys rapidly remove MAG3 from the blood via the proximal tubules with immediate excretion in the bladder (31). Dynamic renal studies (10 s/frame for 900 s) were conducted every 2 wk using an Anger 420/550 Mobile Radioisotope Gamma camera (Technicare) equipped with a parallel-hole collimator. Three intact mice were imaged simultaneously by orienting them around a center enflurane anesthesia delivery point on the collimator, and injecting the mice sequentially over ∼180 s. The mice were dosed with 99mTc-MAG3 (Birmingham Central Pharmacy) at ∼1.0 mCi (37 MBq) per mouse via the tail vein 30 min after 0.5 ml of i.p. saline to insure adequate hydration. Syringes were measured before and after injection with a dose calibrator (Atomlab 100; Biodex Medical Systems). The percentage of injected dose (%ID) in each kidney was calculated for each time point after MAG3 injection using standard region of interest analyses with background correction. The following parameters were calculated for each mouse at each imaging session: peak kidney uptake as %ID, time to peak, and %ID in each kidney 15 min after initial uptake of MAG3. The peak to 15-min ratio was then determined for each kidney. The mean peak to 15-minue-ratio was then calculated for each genotype at each time point.

Cytokine analysis

Kidney extracts were prepared by homogenizing kidney tissue in 2 ml of proteinase inhibitors in PBS (Boehringer Mannheim). Total kidney extract protein was determined by the Lowry method using a total protein determination kit (Sigma-Aldrich). Cytokines from kidney extracts or from cultured endothelial cell supernatants were analyzed by ELISA or multiplex assay using mouse-specific kits and beadsets (R&D Systems). Levels were then interpolated from standard curves of the relevant recombinant mouse proteins (R&D Systems). Endothelial cell supernatant cytokines were presented as picograms per milliliter of supernatant. Kidney cytokines were normalized to total protein and presented as picograms of cytokine per milligram of total protein.

Real-time RT-PCR

Kidney total RNA was prepared using the SV Total RNA Isolation System (Promega). cDNA was synthesized using SuperScript III kit (Invitrogen Life Technologies). Multiplex real-time RT-PCR was conducted using LUX-labeled oligonucleotide primers for CCL2 and β-actin (Invitrogen Life Technologies) analyzed on a Chromo4 Instrument (MJ Research) for each gene of interest. For CCL2 amplification, the primers used were GACTCGATTAAGGCATCACAGTCCGAG and TTCCACAACCACCTCAAGCACT. The threshold cycle corresponding to exponential growth of PCR product during the log-linear phase for both CCL2 (FAM labeled) and the internal reference gene β-actin (6-carboxy-4′,5′-dichloro-2′,7-dimethoxyfluorescein-labeled) were calculated and analyzed for each sample in triplicate using the ΔΔ threshold cycle comparative method to determine relative expression levels. Amplification efficiencies and assay validations were determined from control standard curves for both the gene of interest and the reference RNA generated for each 96-well assay.

Endothelial cell culture and purification

Kidney endothelial cells were isolated from newborn mice. Three-day-old mice were sacrificed and the kidneys were removed aseptically and placed in 10% FBS HBSS. Under a dissection microscope, vessels and connective tissue around the kidneys were teased off and the kidneys were minced into small pieces. Pieces of tissues were then moved to a gelatin-coated 6-well-cell culture plate containing DMEM with 10% FBS, 5 mM HEPES buffer, 1 mM sodium pyruvate, nonessential amino acids, 100 μg/ml endothelial mitogen (Biomedical Technologies), 10 μg/ml heparin, and 1 μg/ml hydrocortisone (Sigma-Aldrich). Each well contained 10–20 pieces of tissue. The plate was then placed in a 5% CO2, 37°C incubator and cultured for 10–20 days. Initially, fibroblasts grew out of the tissues in single layers. Proliferating endothelial cells were then observed to grow in masses on the top of fibroblasts or on the coating gelatin. Endothelial cells were then separated from the fibroblasts by physical dislocation using repeated pipetting. The cell supernatants were then collected, centrifuged down, and the cells were then resuspended in fresh medium and seeded on gelatin-coated plates.

Endothelial cell purity was determined by uptake of 1,1′-dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanine percholate (DiI)-conjugated acetylated low-density lipoprotein (DiI-Ac-LDL) and positive staining with Von Willebrand factor (vWF) Ab (32, 33). For the assessment of DiI-Ac-LDL uptake, endothelial cells were cultured on gelatin-coated glass slides coated overnight in fresh medium. The cells were then incubated for 4 h with 10 μg/ml DiI-Ac-LDL (Biomedical Technologies) at 37°C, washed with PBS, and mounted with fluorescence mounting medium (Vector Laboratories). For vWF staining, endothelial cells were also cultured on slides overnight, air dried, fixed with 5% acetic acid in ethyl alcohol, and incubated with primary rabbit anti-human vWF Ab, a biotinylated-goat anti-rabbit IgG (Vector Laboratories), and streptavidin HRP (Southern Biotechnology Associates), respectively. Only endothelial cell cultures that showed >95% purity were used for additional experiments. The slides were then developed with diaminobenzidine (Vector Laboratories) and counterstained with hematoxylin.

Endothelial cell stimulation with LPS and CCL2-releasing assay

Purified endothelial cells were suspended at 0.5 × 106 cells/ml in medium and added to 24-well plates precoated with gelatin at 1 ml/well. After overnight incubation, and with the cells attached to the bottom of the plate, the supernatant was removed and 1 ml of fresh medium containing 10 μg/ml LPS (Sigma-Aldrich) was added per well. The plate was then incubated at 37°C and 22 μl/well supernatant was collected hourly for CCL2 analysis.

Statistics

Survival data were determined by Kaplan-Meier curves and analyzed by the log-rank test. Overall lesion scores were compared by ANOVA with Tukey’s test for mean comparisons. Scores for individual lesion components were analyzed with the Kruskal-Wallis test with supplemental comparisons by ANOVA of ranks and the Z test. The Student t test was used for all other comparisons.

Results

Survival analyses and comparative histopathology

MRL/MpJ-Faslpr mice show accelerated mortality compared with MRL/MpJ and other inbred mouse strains due to complications from glomerulonephritis and vasculitis (34, 35, 36). To determine the long-term effects of P-selectin deficiency on the development of these inflammatory processes, we performed survival analyses on a large cohort of P-sel/Faslpr and control Faslpr mice. Surprisingly, we found that P-selectin mutant mice showed an overall decreased survival compared with controls (median ± SEM for P-sel/Faslpr = 20.50 ± 0.47 vs Faslpr = 26.14 ± 0.79, p < 0.0001; Fig. 1⇓A). To determine whether this phenotype was associated with the accelerated development of inflammatory disease, we evaluated and compared both dermatitis and glomerulonephritis in both strains of mice. We found that P-selectin-deficient mice also showed a more rapid onset of cutaneous inflammation compared with controls (Fig. 1⇓B). Comparative histopathology of kidney sections taken during the initial phases of glomerulonephritis (16 wk) did not reveal any significant differences between P-selectin-deficient and control mice (Fig. 1⇓C). However, P-sel/Faslpr mice did show significantly higher lesion scores than controls at 20 wk of age. At this time point, lesions in P-selectin mutant mice were characterized by intense neutrophil infiltration of the glomerular tuft, proliferation of mesangial and endothelial cells, increased amounts of mesangial proteinic material, and mild multifocal tubular atrophy and interstitial mixed inflammatory cell accumulation (Fig. 2⇓). There also were more severely affected glomeruli with necrosis of large portions of the tuft, fibrin deposition, proliferation of the lining epithelium of Bowman’s capsule with fusion with the tuft (synechia), capsular fibrosis, and pericapsular lymphocyte accumulation. In contrast, most glomeruli of Faslpr mice had only mild neutrophil infiltration and hypercellularity. The remaining glomeruli that were more severely affected had moderate to intense neutrophil infiltration and hypercellularity similar to the less severely affected glomeruli of P-sel/Faslpr mice, but tuft necrosis, capsular proliferation, and fibrosis were less common and less severe.

FIGURE 1.
FIGURE 1.

Accelerated autoimmune disease in P-sel/Faslpr mice. A, Survival times for P-sel/Faslpr (n = 138) and Faslpr (n = 167) mice. P-selectin mutant mice showed significantly shorter lifespans. B, P-sel/Faslpr (n = 69) and Faslpr (n = 55) mice were visibly assessed weekly for signs of dermatitis until the time of death, or up to 40 wk of age. A significantly higher incidence of skin disease was found in the P-selectin mutant mice compared with controls (p < 0.0001). C, Kidney sections were evaluated at 16 and 20 wk of age, and at the time of death in Faslpr and P-sel/Faslpr mice. Renal histology scores were significantly higher in P-sel/Faslpr mice at the age of 20 wk compared with controls (∗, p < 0.02; n = 5–6/group).

FIGURE 2.
FIGURE 2.

Renal histopathology. A and B, Glomerulonephritis in a 20-wk-old P-sel/Faslpr mouse. A, Intense neutrophil infiltration, slight multifocal protein deposition, and adjacent mild tubular atrophy and mixed inflammatory cell accumulation. B, Severely affected glomerulus, with necrosis of a large portion of the tuft, fibrin deposition, proliferation of the lining epithelium of Bowman’s capsule, synechia, capsular fibrosis, and pericapsular lymphocyte accumulation. C and D, Glomerulonephritis in a 20-wk-old Faslpr mouse. C, Mild neutrophil accumulation and hypercellularity. D, Moderately intense neutrophil accumulation and mild hypercellularity.

Comparison of glomerular ultrastructure between P-sel/Faslpr and Faslpr mice at 20 wk of age revealed considerable differences. Glomeruli from Faslpr mice had a mild increase in mesangial cells and matrix (Fig. 3⇓, A and B), and there were occasional small paramesangial deposits and small well-defined intramembranous deposits. The foot processes were only focally effaced with the majority being thin and delicate. In contrast, P-sel/Faslpr glomeruli had markedly expanded mesangium, primarily due to mesangial matrix increase and large electron dense deposits (Fig. 3⇓, C and D). The degree of cellularity in the mesangium was moderately increased. The foot processes were diffusely effaced and fused, and both subepithelial and subendothelial electron dense deposits were readily identified.

FIGURE 3.
FIGURE 3.

Electron microscopy of the kidney. A and B, Representative electron micrographs from a Faslpr mouse showing a mild increase in mesangial matrix and cells. The visceral epithelial cells (podocytes) are more prominent, but lack vacuolization. Small well-defined electron dense deposits are present in the mesangium and within the glomerular basement membranes (arrows). A, Original magnification, ×750. B, Original magnification, ×4000. C and D, Glomeruli from P-sel/Faslpr mice demonstrate a marked increase in mesangial cells and matrix. Large confluent electron dense deposits are readily identified within the mesangium. Both subepithelial and subendothelial electron deposits are present within the capillary loops (D, arrows). The foot processes are diffusely effaced and fused. The visceral epithelial cells are prominent and vacuolated (C, original magnification, ×750; D, Original magnification, ×4000).

Renal lesions at the time of death were severe in both P-sel/Faslpr and Faslpr mice, and the mean scores were not significantly different (Figs. 1⇑C and 2⇑). These findings suggest that loss of P-selectin expression does not alter the initiation of glomerulonephritis, but results in a more rapid progression to end-stage renal disease via an unknown mechanism. Examination of other organs in P-sel/Faslpr at these various time points did not reveal any other types of inflammatory lesions, other than vasculitis, which is typical of Faslpr mice. Furthermore, P-selectin-deficient mice did not have evidence of infection or complications of vasculitis such as hemorrhage or thrombosis, suggesting that these factors did not significantly contribute to the accelerated mortality.

To determine whether the accelerated renal disease in P-selectin-deficient mice correlated with altered leukocyte recruitment, we assessed the overall numbers of intraglomerular T cells, monocyte/macrophages, and neutrophils in kidney sections. At 20 wk of age, when P-selectin mutant mice showed higher renal lesion scores than control mice, mean numbers of CD3+ and CD68+ cells were not significantly different between genotypes as determined by immunohistochemistry (data not shown). In contrast, neutrophil accumulation was severe in P-sel/Faslpr mice at 20 wk, whereas it was mild to moderate in Faslpr mice at this time point (data not shown).

Real-time assessment of renal function

To further examine the development of glomerulonephritis in P-selectin deficient mice, we conducted renal function studies using 99mTc-mercaptoacetyltriglycine (MAG3), an established radioactive tracer for this purpose (31). Starting at 18 wk of age, P-selectin mutant and control mice were dosed every 2 wk with MAG3 and simultaneously imaged with a dynamic gamma camera. At 18 wk, we did not observe any significant differences between the different genotypes in the uptake and clearance of MAG3 from the kidneys, as determined by comparing the mean peak to 15-min ratios (see Materials and Methods and Table I⇓). Fig. 4⇓A shows a representative imaging profile for a P-sel/Faslpr mouse at 18 wk of age. At subsequent time points, both P-selectin deficient and control mice showed progressive declines in renal function (data not shown). However, by 26 wk, all of the P-sel/Faslpr mice had died compared with only two Faslpr controls. A significant defect in clearance of MAG3 from the kidneys was observed in all mice before death, and no significant differences were observed in the mean peak to 15-min ratios between genotypes (Fig. 4⇓B and Table I⇓). These results, combined with our histological analyses, strongly suggest that one of the major mechanisms for the accelerated lethality in P-selectin-deficient mice involves a rapid progression to end-stage renal disease.

FIGURE 4.
FIGURE 4.

Renal function measurements. The %ID of MAG3 in each kidney was measured every 10 s over at least 20 min to assess uptake and clearance (see Materials and Methods). Two representative experiments are shown. A, P-sel/Faslpr mouse imaged at 18 wk of age. Solid line, right kidney; hatched line, left kidney. In this mouse, MAG3 was rapidly cleared from the blood and excreted from the kidney suggesting little functional damage to the kidneys had occurred up to the time point. B, Same mouse imaged shortly before death. Note the %ID of MAG3 in each kidney was slow to accumulate and was not excreted into the bladder, suggesting significant impairment of renal function.

View this table:
Table I.

Renal imaging studies

Cytokine and chemokine analyses

Cytokines and chemokines play important roles in the development of renal inflammatory diseases including glomerulonephritis in Faslpr mice (9). To investigate whether the accelerated renal disease in P-selectin mutant mice correlated with altered expression of different inflammatory mediators, we analyzed the overall levels of IFN-γ, CCL2, CCL3, CCL4, MIP-2, KC, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, and IL-13 in kidney tissue collected at 20 wk of age by ELISA. In these analyses, we found significantly higher levels of CCL2 in the kidneys of P-sel/Faslpr mice compared with controls (Table II⇓). No significant differences in the levels of the other cytokines/chemokines were observed. We next examined CCL2 levels in kidneys collected at earlier ages to determine whether P-selectin mutant mice showed elevated expression of this chemokine in renal tissue during the initiation phases of glomerulonephritis. However, significant differences in CCL2 expression were only observed between groups at 20 wk of age, and not at 12 and 16 wk (Fig. 5⇓A). Finally, we used quantitative real-time RT-PCR analysis to determine whether CCL2 transcription was also increased in the kidneys of P-sel/Faslpr mice. We found that P-selectin-deficient mice showed significantly higher levels of CCL2 mRNA transcripts compared with controls at 20 wk of age (Fig. 5⇓B).

FIGURE 5.
FIGURE 5.

Increased CCL2 expression in kidneys and primary renal endothelial cells from P-sel/Faslpr mice. A, Kidney extracts were isolated from P-sel/Faslpr and sex- and age-matched Faslpr mice at the 12, 16, and 20 wk of age (n = 5–7 for 12 and 16 wk, n = 15 for 20 wk). CCL2 levels were determined as described in Materials and Methods (∗, p < 0.03). B, Normalized levels of CCL2 mRNA transcripts. Total kidney RNA was isolated from P-sel/Faslpr and Faslpr mice at 20 wk of age and CCL2 transcript levels were measured by reverse transcriptase real-time PCR and normalized to β-actin expression in each sample (n = 8/group; ∗, p = 0.007). C, Significant induction of CCL2 from Faslpr renal endothelial cells following stimulation with 10 μg/ml LPS. D, P-sel/Faslpr renal endothelial cells show significantly increased production of CCL2 compared with Faslpr controls following LPS stimulation (∗, p < 0.05).

View this table:
Table II.

Kidney cytokine analysisa

Previous studies have strongly implicated CCL2 as a key proinflammatory molecule in the development of many different forms of glomerulonephritis (37, 38, 39, 40, 41, 42). In addition, loss or inhibition of this chemokine in Faslpr mice significantly inhibits the progression of renal disease and protects from early lethality (43, 44). Based on these previous observations, one possible interpretation of our findings is that loss of P-selectin expression in renal endothelial cells leads to increased production of CCL2 over time, which ultimately results in an accelerated progression of glomerulonephritis. Alternatively, the differences in CCL2 expression may simply be indicative of a more advanced form of renal disease in the kidneys collected from P-selectin mutant mice at 20-wk of age, and similar levels of this chemokine may be observed in older Faslpr mice at similar stages of glomerulonephritis. To determine whether CCL2 expression is somehow regulated by P-selectin during glomerulonephritis, we measured production of this chemokine in LPS-stimulated primary renal endothelial cell cultures purified from P-selectin mutant and control mice by ELISA. Endothelial cell cultures were derived from newborn mice using the procedures outlined in Materials and Methods and Fig. 6⇓ shows representative photomicrographs of these cultures, including DiI-Ac-LDL and anti-vWF Ab staining patterns. Following stimulation with LPS, we observed a significant induction of CCL2 expression in control cultures (Fig. 5⇑C). However, even greater levels of CCL2 were detected in the supernatants of P-selectin-deficient endothelial cells treated with LPS (Fig. 5⇑D), with significant increases observed at 4–8 h poststimulation compared with control cultures. These data strongly suggest that P-selectin expression down-regulates CCL2 production in activated endothelial cells, independent of engagement of this adhesion molecule by one of its ligands.

FIGURE 6.
FIGURE 6.

Kidney endothelial cell cultures from Faslpr mice. A, Phase contrast microscopy showing a kidney explant culture containing proliferating endothelial cells from a Faslpr mouse growing on top of fibroblasts (×20). B, Purified kidney endothelial cells grown on gelatin-coated plates (phase contrast, ×40). C, Fluorescent micrograph of purified endothelial cells stained with DiI-Ac-LDL (×100). D, Endothelial cells stained with anti-vWF Ab (×100).

Analysis of PSGL-1/Faslpr mice

Leukocyte-expressed PSGL-1 serves as the major rolling receptor for P-selectin (45). To test whether loss of PSGL-1 expression would result in a similar phenotype to that observed in the P-selectin mutants, we generated and analyzed PSGL-1/Faslpr mice. We found that PSGL-1-deficient mice also showed early lethality (median ± SEM for PSGL-1/Faslpr mice = 21.40 ± 0.86 vs Faslpr mice = 26.40 ± 0.86, p < 0.0001; Fig. 7⇓A), accelerated onset of cutaneous skin inflammation (Fig. 7⇓B), and significantly increased glomerular lesion scores at 20 wk of age compared with controls (Fig. 7⇓C). In addition, examination of renal CCL2 expression revealed significant increases in PSGL-1-deficient kidneys collected from mice at 20 wk of age compared with control mice (Fig. 7⇓D). However, in contrast to our analyses of P-selectin mutant mice, significant increases in the levels of this chemokine were also detected at 16 wk of age in kidneys of PSGL-1/Faslpr mice. Finally, PSGL-1 mutants, like P-sel/Faslpr mice, showed a significant increase in CCL2 mRNA levels in the kidneys compared with Faslpr mice at 20 wk of age, as assessed by real-time RT-PCR (data not shown).

FIGURE 7.
FIGURE 7.

PSGL-1/Faslpr mice present with a similar phenotype to that observed in P-selectin mutant mice. A, Survival times for PSGL-1/Faslpr (n = 111) and Faslpr (n = 93) mice. PSGL-1 mutant mice showed significantly shorter lifespans. B, PSGL-1/Faslpr (n = 51) and Faslpr (n = 55) mice were visibly assessed weekly for signs of dermatitis for a period of 30 wk. Some mice died during this period, therefore the number decreased at later times. A significantly higher incidence of skin disease was found in the PSGL-1 mutant mice compared with controls (p < 0.001). C, Renal lesion scores for 20-wk-old PSGL-1/Faslpr mice were significantly higher than those for Faslpr mice (∗, p < 0.05, n = 6–11). D, Significantly higher levels of CCL2 were found in the kidneys of PSGL-1/Faslpr mice compared with controls at both 16 and 20 wk of age (n = 5–7/genotype for each time point; ∗, p < 0.03).

Discussion

These studies demonstrate that P-selectin and PSGL-1 play key roles in regulating the progression of inflammatory disease in Faslpr mice. Our analyses of P-selectin and PSGL-1 mutant mice showed that loss of expression of these adhesion molecules was not protective in this model, but resulted in the accelerated development of both dermatitis and renal disease leading to earlier lethality. Similar phenotypes have been reported in P-selectin, E-selectin, and E/P-selectin double knockout mice in other chronic disease models, such as collagen-induced arthritis and antiglomerular basement membrane-induced glomerulonephritis (26, 46, 47), where loss of selectin expression resulted in a more severe or accelerated form of inflammation. However, the mechanisms responsible for these altered inflammatory responses were not specifically defined, and it is not clear whether common pathways may be similarly altered in P-selectin and PSGL-1 mutant Faslpr mice.

The current investigations strongly suggest that one of the functions of these adhesion molecules is to limit the intensity or severity of the inflammatory response, especially in the kidney following IC deposition. Our data indicate that one of the major mechanisms by which P-selectin and PSGL-1 control the progression of chronic renal inflammation is through reducing expression of CCL2. This chemokine has been shown to be an important chemoattractant for monocytes and T cells, is involved in the regulation of Th1/Th2 lymphocyte differentiation, and can restrict Th1 cell responses (48, 49, 50, 51, 52). An expanding body of evidence strongly suggests that CCL2 promotes the development of glomerulonephritis in many different human diseases, including SLE, and is a key mediator of renal inflammation in different models of glomerulonephritis, including Faslpr mice (37, 38, 39, 40, 41, 42, 53). In this model, loss or inhibition of CCL2 significantly inhibited the progression to end-stage renal disease and resulted in longer life spans compared with controls (43, 44).

CCL2 is produced by multiple cell types in the kidney, but is coexpressed with P-selectin in renal endothelial cells and PSGL-1 in infiltrating leukocytes such as macrophages and lymphocytes (41, 54). To test for a possible relationship between P-selectin and CCL2 expression in endothelial cells, we first established primary endothelial cultures from P-sel/Faslpr and Faslpr mice. We then examined and compared CCL2 induction in response to LPS stimulation, without the presence of leukocytes or anti-P-selectin Abs, and found that P-selectin-deficient endothelial cells consistently produced significantly higher levels of secreted CCL2 compared with controls. This novel observation suggests that one of the P-selectin-dependent mechanisms for down-regulating CCL2 in vivo occurs independently of the engagement of this receptor, and simply requires the expression of this adhesion molecule in endothelial cells. Although we do not yet understand the cellular pathways responsible for suppression of CCL2 in this system, it may occur through signaling events following translocation of P-selectin to the endothelial cell membrane (55, 56, 57).

PSGL-1/Faslpr mice also showed a similar accelerated glomerulonephritis phenotype characterized by higher CCL2 levels, despite the presence of a normal P-selectin gene. One possible explanation for this observation is that engagement of P-selectin by PSGL-1 during leukocyte rolling events also leads to reduced endothelial CCL2 expression through activating P-selectin-dependent intracellular signaling pathways (57). It is interesting to note that we observed significantly higher levels of CCL2 in kidney tissue collected from 16- and 20-wk-old PSGL-1/Faslpr mice compared with controls, while CCL2 expression was only increased in 20-wk-old samples taken from P-sel/Faslpr mice. PSGL-1 also interacts with E-selectin on endothelial cells, and it is possible that the combined loss of PSGL-1 interactions with both of these endothelial selectins is responsible for the increase in CCL2 expression (58, 59). Support for this model comes from preliminary studies in our laboratory where we have observed that E-selectin mutant Faslpr mice also show accelerated lethality associated with the rapid development of glomerulonephritis, and increased CCL2 expression in LPS-stimulated E-selectin-deficient primary endothelial cells (X. He and D. C. Bullard, manuscript in preparation). Alternatively, other PSGL-1-dependent mechanisms may also be responsible for regulating CCL2 expression in PSGL-1/Faslpr mice. For example, engagement of PSGL-1 with the selectins may elicit signaling pathways in infiltrating leukocytes themselves, leading to reduced CCL2 production in these cells types, which in turn could inhibit or slow the progression of glomerulonephritis in Faslpr mice. Loss of expression of PSGL-1 would thus lead to increased expression of leukocyte-derived CCL2 and promote the rapid development of end-stage renal disease.

We did not observe significant differences in the overall numbers of infiltrating T cells and monocytes in the kidneys between P-selectin mutant and control mice at 20 wk of age, despite our findings that P-sel/Faslpr mice displayed higher levels of CCL2 in kidneys during the progression phases of glomerulonephritis. This may indicate that the concentration of this chemokine has reached saturation and that additional numbers of leukocytes cannot be recruited through CCL2-dependent pathways. Alternatively, increased numbers of infiltrating T cell and monocytes may occur in mice lacking P-selectin or PSGL-1 compared with controls, but at an earlier stage of glomerulonephritis. Due to the chronic nature of this model, it is difficult to accurately assess and compare specific numbers of infiltrating leukocytes between and within groups, since individual mice are not all synchronized for the same stage of glomerulonephritis. Finally, it is possible that the increased levels of CCL2 observed in P-selectin and PSGL-1 mutant mice act primarily to alter Th1/Th2 differentiation and activity, which may in turn promote the more rapid development of glomerulonephritis (48, 60, 61, 62).

CCL2-independent mechanisms may also be altered in P-selectin and PSGL-1 mutant Faslpr mice and contribute to the accelerated disease phenotype. These adhesion molecules may modulate the expression or activity of other proinflammatory mediators not analyzed in our studies that contribute to the pathogenesis of renal and vascular disease in this model. In addition, it is possible that loss of P-selectin and PSGL-1 expression may inhibit the recruitment of regulatory T cells or monocyte/macrophage populations to the kidney, thus allowing a more rapid development of glomerulonephritis (63).

Our findings further suggest that P-selectin/PSGL-1-mediated rolling is not absolutely required for leukocyte infiltration and tissue damage in response to IC deposition in this model. Our previous intravital microscopy analyses of P-sel/Faslpr mice support this hypothesis (28, 29). We found that the numbers of rolling leukocytes were reduced, but not completely inhibited, in the skin and brain microvasculature in these mutant mice compared with controls, and significant differences in the numbers of firmly adherent leukocytes were not observed. Thus, other adhesion molecules, such as VCAM-1, L-selectin, or CD44 may compensate for the loss of P-selectin or PSGL-1 and mediate rolling in postcapillary venules. Alternatively, leukocyte rolling may not be required for leukocyte firm adhesion and transendothelial migration in all tissues affected in this model, especially in the glomeruli during the development of renal disease. Evidence from studies in which leukocyte-endothelial cell interactions have been assessed in glomeruli of hydronephrotic kidneys have shown that selectin antagonists did not reduce inflammatory leukocyte recruitment to glomeruli (64), suggesting that rolling interactions may not be important in glomerular capillaries. Furthermore, we have recently observed using intravital microscopy that leukocytes undergo immediate adhesion in inflamed glomerular capillaries without undergoing a prior rolling step (65).

In summary, our analyses of P-selectin and PSGL-1 mutant Faslpr mice suggest that these adhesion molecules negatively regulate the development of IC-mediated disease in this model, possibly through modulating expression of inflammatory mediators such as CCL2. These findings also implicate these proteins as potentially important inflammatory modulators during the progression of lupus nephritis in SLE. Further investigations of P-selectin and PSGL-1 are necessary to define the inflammatory pathways regulated by these adhesion molecules and to determine their specific roles in the pathogenesis of SLE.

Disclosures

The authors have no financial conflict of interest.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 This work was supported by the National Institutes of Health Grant R01 RR017009 (to D.C.B.).

  • ↵2 Address correspondence and reprint requests to Dr. Daniel C. Bullard, Department of Genetics, University of Alabama at Birmingham, 640A Kaul Building, 720 South 20th Street, Birmingham, AL 35294. E-mail address: dcbullard{at}uab.edu

  • ↵3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; IC, immune complex; PSGL-1, P-selectin glycoprotein ligand-1; MAG3, mercaptoacetyltriglycine; %ID, percentage of injected dose; DiI,1,1′-dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanine perchlorate; DiI-Ac-LDL, DiI-conjugated acetylated low-density lipoprotein; vWF, Von Willebrand factor.

  • Received March 30, 2006.
  • Accepted September 25, 2006.

References

  1. ↵
    Munoz, L. E., U. S. Gaipl, S. Franz, A. Sheriff, R. E. Voll, J. R. Kalden, M. Herrmann. 2005. SLE—a disease of clearance deficiency?. Rheumatology 44: 1101-1107.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Tang, S., S. L. Lui, K. N. Lai. 2005. Pathogenesis of lupus nephritis: an update. Nephrology 10: 174-179.
    OpenUrlCrossRefPubMed
  3. ↵
    Calamia, K. T., M. Balabanova. 2004. Vasculitis in systemic lupus erythematosus. Clin. Dermatol. 22: 148-156.
    OpenUrlCrossRefPubMed
  4. ↵
    Doria, A., L. Iaccarino, P. Sarzi-Puttini, F. Atzeni, M. Turriel, M. Petri. 2005. Cardiac involvement in systemic lupus erythematosus. Lupus 14: 683-686.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Bagavant, H., U. S. Deshmukh, F. Gaskin, S. M. Fu. 2004. Lupus glomerulonephritis revisited 2004: autoimmunity and end-organ damage. Scand. J. Immunol. 60: 52-63.
    OpenUrlCrossRefPubMed
  6. ↵
    Grande, J. P.. 1998. Mechanisms of progression of renal damage in lupus nephritis: pathogenesis of renal scarring. Lupus 7: 604-610.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Quigg, R. J.. 2004. Complement and autoimmune glomerular diseases. Curr. Dir. Autoimmun. 7: 165-180.
    OpenUrlPubMed
  8. ↵
    McMurray, R. W.. 1996. Adhesion molecules in autoimmune disease. Semin. Arthritis Rheum. 25: 215-233.
    OpenUrlCrossRefPubMed
  9. ↵
    Segerer, S., P. J. Nelson, D. Schlondorff. 2000. Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies. J. Am. Soc. Nephrol. 11: 152-176.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Connolly, M. K., E. A. Kitchens, B. Chan, P. Jardieu, D. Wofsy. 1994. Treatment of murine lupus with monoclonal antibodies to lymphocyte function-associated antigen-1: dose-dependent inhibition of autoantibody production and blockade of the immune response to therapy. Clin. Immunol. Immunopathol. 72: 198-203.
    OpenUrlCrossRefPubMed
  11. ↵
    Bullard, D. C., P. D. King, M. J. Hicks, B. Dupont, A. L. Beaudet, K. B. Elkon. 1997. Intercellular adhesion molecule-1 deficiency protects MRL/MpJ-Faslpr mice from early lethality. J. Immunol. 159: 2058-2067.
    OpenUrlAbstract
  12. ↵
    Kevil, C. G., M. J. Hicks, X. He, J. Zhang, C. M. Ballantyne, C. Raman, T. R. Schoeb, D. C. Bullard. 2004. Loss of LFA-1, but not Mac-1, protects MRL/MpJ-Faslpr mice from autoimmune disease. Am. J. Pathol. 165: 609-616.
    OpenUrlCrossRefPubMed
  13. ↵
    Marshall, D., J. P. Dangerfield, V. K. Bhatia, K. Y. Larbi, S. Nourshargh, D. O. Haskard. 2003. MRL/lpr lupus-prone mice show exaggerated ICAM-1-dependent leucocyte adhesion and transendothelial migration in response to TNF-α. Rheumatology 42: 929-934.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Ley, K.. 2003. The role of selectins in inflammation and disease. Trends Mol. Med. 9: 263-268.
    OpenUrlCrossRefPubMed
  15. ↵
    Tam, F. W.. 2002. Role of selectins in glomerulonephritis. Clin. Exp. Immunol. 129: 1-3.
    OpenUrlCrossRefPubMed
  16. ↵
    Belmont, H. M., J. Buyon, R. Giorno, S. Abramson. 1994. Upregulation of endothelial cell adhesion molecules characterizes disease activity in systemic lupus erythematosus: the Schwartzman phenomenon revisited. Arthritis Rheum. 37: 376-383.
    OpenUrlCrossRefPubMed
  17. ↵
    Segawa, C., T. Wada, M. Takaeda, K. Furuichi, I. Matsuda, Y. Hisada, S. Ohta, K. Takasawa, S. Takeda, K. Kobayashi, H. Yokoyama. 1997. In situ expression and soluble form of P-selectin in human glomerulonephritis. Kidney Int. 52: 1054-1063.
    OpenUrlCrossRefPubMed
  18. ↵
    Zaccagni, H., J. Fried, J. Cornell, P. Padilla, R. L. Brey. 2004. Soluble adhesion molecule levels, neuropsychiatric lupus and lupus-related damage. Front. Biosci. 9: 1654-1659.
    OpenUrlCrossRefPubMed
  19. ↵
    Egerer, K., E. Feist, U. Rohr, A. Pruss, G. R. Burmester, T. Dorner. 2000. Increased serum soluble CD14, ICAM-1 and E-selectin correlate with disease activity and prognosis in systemic lupus erythematosus. Lupus 9: 614-621.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Nagahama, M., S. Nomura, Y. Ozaki, C. Yoshimura, H. Kagawa, S. Fukuhara. 2001. Platelet activation markers and soluble adhesion molecules in patients with systemic lupus erythematosus. Autoimmunity 33: 85-94.
    OpenUrlCrossRefPubMed
  21. ↵
    Ito, I., Y. Yuzawa, M. Mizuno, K. Nishikawa, A. Tashita, T. Jomori, N. Hotta, S. Matsuo. 2001. Effects of a new synthetic selectin blocker in an acute rat thrombotic glomerulonephritis. Am. J. Kidney Dis. 38: 265-273.
    OpenUrlCrossRefPubMed
  22. ↵
    Tipping, P. G., X. R. Huang, M. C. Berndt, S. R. Holdsworth. 1994. A role for P selectin in complement-independent neutrophil-mediated glomerular injury. Kidney Int. 46: 79-88.
    OpenUrlCrossRefPubMed
  23. ↵
    Zachem, C. R., C. E. Alpers, W. Way, S. J. Shankland, W. G. Couser, R. J. Johnson. 1997. A role for P-selectin in neutrophil and platelet infiltration in immune complex glomerulonephritis. J. Am. Soc. Nephrol. 8: 1838-1844.
    OpenUrlAbstract
  24. ↵
    Tipping, P. G., X. R. Huang, M. C. Berndt, S. R. Holdsworth. 1996. P-selectin directs T lymphocyte-mediated injury in delayed-type hypersensitivity responses: studies in glomerulonephritis and cutaneous delayed-type hypersensitivity. Eur. J. Immunol. 26: 454-460.
    OpenUrlCrossRefPubMed
  25. ↵
    Ogawa, D., K. Shikata, M. Matsuda, S. Okada, J. Wada, S. Yamaguchi, Y. Suzuki, M. Miyasaka, S. Tojo, H. Makino. 2002. Preventive effect of sulphated colominic acid on P-selectin-dependent infiltration of macrophages in experimentally induced crescentic glomerulonephritis. Clin. Exp. Immunol. 129: 43-53.
    OpenUrlCrossRefPubMed
  26. ↵
    Rosenkranz, A. R., D. L. Mendrick, R. S. Cotran, T. N. Mayadas. 1999. P-selectin deficiency exacerbates experimental glomerulonephritis: a protective role for endothelial P-selectin in inflammation. J. Clin. Invest. 103: 649-659.
    OpenUrlCrossRefPubMed
  27. ↵
    Harari, O. A., D. Marshall, J. F. McHale, S. Ahmed, D. O. Haskard. 2001. Limited endothelial E- and P-selectin expression in MRL/lpr lupus-prone mice. Rheumatology 40: 889-895.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    James, W. G., D. C. Bullard, M. J. Hickey. 2003. Critical role of the α4 integrin/VCAM-1 pathway in cerebral leukocyte trafficking in lupus-prone MRL/faslpr mice. J. Immunol. 170: 520-527.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Hickey, M. J., D. C. Bullard, A. Issekutz, W. G. James. 2002. Leukocyte-endothelial cell interactions are enhanced in dermal postcapillary venules of MRL/faslpr (lupus-prone) mice: roles of P- and E-selectin. J. Immunol. 168: 4728-4736.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Yang, J., T. Hirata, K. Croce, G. Merrill-Skoloff, B. Tchernychev, E. Williams, R. Flaumenhaft, B. C. Furie, B. Furie. 1999. Targeted gene disruption demonstrates that P-selectin glycoprotein ligand 1 (PSGL-1) is required for P-selectin-mediated but not E-selectin-mediated neutrophil rolling and migration. J. Exp. Med. 190: 1769-1782.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Durand, E., A. Prigent. 2002. The basics of renal imaging and function studies. Q. J. Nucl. Med. 46: 249-267.
    OpenUrlPubMed
  32. ↵
    Netland, P. A., B. R. Zetter, D. P. Via, J. C. Voyta. 1985. In situ labelling of vascular endothelium with fluorescent acetylated low density lipoprotein. Histochem. J. 17: 1309-1320.
    OpenUrlCrossRefPubMed
  33. ↵
    Potzsch, B., J. Grulich-Henn, R. Rossing, D. Wille, G. Muller-Berghaus. 1990. Identification of endothelial and mesothelial cells in human omental tissue and in omentum-derived cultured cells by specific cell markers. Lab. Invest. 63: 841-852.
    OpenUrlPubMed
  34. ↵
    Theofilopoulos, A. N., F. J. Dixon. 1985. Murine models of systemic lupus erythematosus. Adv. Immunol. 37: 269-391.
    OpenUrlCrossRefPubMed
  35. ↵
    Alexander, E. L., C. Moyer, G. S. Travlos, J. B. Roths, E. D. Murphy. 1985. Two histopathologic types of inflammatory vascular disease in MRL/Mp autoimmune mice: model for human vasculitis in connective tissue disease. Arthritis Rheum. 28: 1146-1155.
    OpenUrlCrossRefPubMed
  36. ↵
    Cohen, P. L., R. A. Eisenberg. 1991. lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu. Rev. Immunol. 9: 243-269.
    OpenUrlCrossRefPubMed
  37. ↵
    Rovin, B. H., M. Rumancik, L. Tan, J. Dickerson. 1994. Glomerular expression of monocyte chemoattractant protein-1 in experimental and human glomerulonephritis. Lab. Invest. 71: 536-542.
    OpenUrlPubMed
  38. ↵
    Kim, H. L., D. S. Lee, S. H. Yang, C. S. Lim, J. H. Chung, S. Kim, J. S. Lee, Y. S. Kim. 2002. The polymorphism of monocyte chemoattractant protein-1 is associated with the renal disease of SLE. Am. J. Kidney Dis. 40: 1146-1152.
    OpenUrlCrossRefPubMed
  39. ↵
    Okada, H., K. Moriwaki, R. Kalluri, H. Imai, S. Ban, M. Takahama, H. Suzuki. 2000. Inhibition of monocyte chemoattractant protein-1 expression in tubular epithelium attenuates tubulointerstitial alteration in rat Goodpasture syndrome. Kidney Int. 57: 927-936.
    OpenUrlCrossRefPubMed
  40. ↵
    Schneider, A., U. Panzer, G. Zahner, U. Wenzel, G. Wolf, F. Thaiss, U. Helmchen, R. A. Stahl. 1999. Monocyte chemoattractant protein-1 mediates collagen deposition in experimental glomerulonephritis by transforming growth factor-β. Kidney Int. 56: 135-144.
    OpenUrlCrossRefPubMed
  41. ↵
    Zoja, C., X. H. Liu, R. Donadelli, M. Abbate, D. Testa, D. Corna, G. Taraboletti, A. Vecchi, Q. G. Dong, B. J. Rollins, et al 1997. Renal expression of monocyte chemoattractant protein-1 in lupus autoimmune mice. J. Am. Soc. Nephrol. 8: 720-729.
    OpenUrlAbstract
  42. ↵
    Kuroiwa, T., R. Schlimgen, G. G. Illei, I. B. McInnes, D. T. Boumpas. 2000. Distinct T cell/renal tubular epithelial cell interactions define differential chemokine production: implications for tubulointerstitial injury in chronic glomerulonephritides. J. Immunol. 164: 3323-3329.
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Hasegawa, H., M. Kohno, M. Sasaki, A. Inoue, M. R. Ito, M. Terada, K. Hieshima, H. Maruyama, J. Miyazaki, O. Yoshie, et al 2003. Antagonist of monocyte chemoattractant protein 1 ameliorates the initiation and progression of lupus nephritis and renal vasculitis in MRL/lpr mice. Arthritis Rheum. 48: 2555-2566.
    OpenUrlCrossRefPubMed
  44. ↵
    Tesch, G. H., S. Maifert, A. Schwarting, B. J. Rollins, V. R. Kelley. 1999. Monocyte chemoattractant protein 1-dependent leukocytic infiltrates are responsible for autoimmune disease in MRL-Faslpr mice. J. Exp. Med. 190: 1813-1824.
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Kansas, G. S.. 1996. Selectins and their ligands: current concepts and controversies. Blood 88: 111
    OpenUrl
  46. ↵
    Bullard, D. C., J. M. Mobley, J. M. Justen, L. M. Sly, J. G. Chosay, C. J. Dunn, J. R. Lindsey, A. L. Beaudet, N. D. Staite. 1999. Acceleration and increased severity of collagen-induced arthritis in P-selectin mutant mice. J. Immunol. 163: 2844-2849.
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Ruth, J. H., M. A. Amin, J. M. Woods, X. He, S. Samuel, N. Yi, C. S. Haas, A. E. Koch, D. C. Bullard. 2005. Accelerated development of arthritis in mice lacking endothelial selectins. Arthritis Res. Ther. 7: R959-970.
    OpenUrlCrossRefPubMed
  48. ↵
    Karpus, W. J., N. W. Lukacs, K. J. Kennedy, W. S. Smith, S. D. Hurst, T. A. Barrett. 1997. Differential CC chemokine-induced enhancement of T helper cell cytokine production. J. Immunol. 158: 4129-4136.
    OpenUrlAbstract
  49. ↵
    Roth, S. J., M. W. Carr, T. A. Springer. 1995. C-C chemokines, but not the C-X-C chemokines interleukin-8 and interferon-γ inducible protein-10, stimulate transendothelial chemotaxis of T lymphocytes. Eur. J. Immunol. 25: 3482-3488.
    OpenUrlCrossRefPubMed
  50. ↵
    Huang, D. R., J. Wang, P. Kivisakk, B. J. Rollins, R. M. Ransohoff. 2001. Absence of monocyte chemoattractant protein 1 in mice leads to decreased local macrophage recruitment and antigen-specific T helper cell type 1 immune response in experimental autoimmune encephalomyelitis. J. Exp. Med. 193: 713-726.
    OpenUrlAbstract/FREE Full Text
  51. ↵
    Karpus, W. J., K. J. Kennedy. 1997. MIP-1α and MCP-1 differentially regulate acute and relapsing autoimmune encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J. Leukocyte Biol. 62: 681-687.
    OpenUrlAbstract
  52. ↵
    Weber, C., R. Alon, B. Moser, T. A. Springer. 1996. Sequential regulation of α4β1 and α5β1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis. J. Cell Biol. 134: 1063-1073.
    OpenUrlAbstract/FREE Full Text
  53. ↵
    Anders, H. J., V. Vielhauer, D. Schlondorff. 2003. Chemokines and chemokine receptors are involved in the resolution or progression of renal disease. Kidney Int. 63: 401-415.
    OpenUrlCrossRefPubMed
  54. ↵
    Frazier-Jessen, M. R., E. J. Kovacs. 1995. Estrogen modulation of JE/monocyte chemoattractant protein-1 mRNA expression in murine macrophages. J. Immunol. 154: 1838-1845.
    OpenUrlAbstract
  55. ↵
    Wang, Q., C. M. Doerschuk. 2002. The signaling pathways induced by neutrophil-endothelial cell adhesion. Antioxid. Redox. Signal. 4: 39-47.
    OpenUrlCrossRefPubMed
  56. ↵
    Lorenzon, P., E. Vecile, E. Nardon, E. Ferrero, J. M. Harlan, F. Tedesco, A. Dobrina. 1998. Endothelial cell E- and P-selectin and vascular cell adhesion molecule-1 function as signaling receptors. J. Cell Biol. 142: 1381-1391.
    OpenUrlAbstract/FREE Full Text
  57. ↵
    Aplin, A. E., A. Howe, S. K. Alahari, R. L. Juliano. 1998. Signal transduction and signal modulation by cell adhesion receptors: the role of integrins, cadherins, immunoglobulin-cell adhesion molecules, and selectins. Pharmacol. Rev. 50: 197-263.
    OpenUrlAbstract/FREE Full Text
  58. ↵
    Hirata, T., G. Merrill-Skoloff, M. Aab, J. Yang, B. C. Furie, B. Furie. 2000. P-Selectin glycoprotein ligand 1 (PSGL-1) is a physiological ligand for E-selectin in mediating T helper 1 lymphocyte migration. J. Exp. Med. 192: 1669-1676.
    OpenUrlAbstract/FREE Full Text
  59. ↵
    Zou, X., V. R. Shinde Patil, N. M. Dagia, L. A. Smith, M. J. Wargo, K. A. Interliggi, C. M. Lloyd, D. F. Tees, B. Walcheck, M. B. Lawrence, D. J. Goetz. 2005. PSGL-1 derived from human neutrophils is a high-efficiency ligand for endothelium-expressed E-selectin under flow. Am. J. Physiol. 289: C415-C424.
    OpenUrlCrossRef
  60. ↵
    Daly, C., B. J. Rollins. 2003. Monocyte chemoattractant protein-1 (CCL2) in inflammatory disease and adaptive immunity: therapeutic opportunities and controversies. Microcirculation 10: 247-257.
    OpenUrlCrossRefPubMed
  61. ↵
    Matsukawa, A., N. W. Lukacs, T. J. Standiford, S. W. Chensue, S. L. Kunkel. 2000. Adenoviral-mediated overexpression of monocyte chemoattractant protein-1 differentially alters the development of Th1 and Th2 type responses in vivo. J. Immunol. 164: 1699-1704.
    OpenUrlAbstract/FREE Full Text
  62. ↵
    Shimizu, S., H. Nakashima, K. Karube, K. Ohshima, K. Egashira. 2005. Monocyte chemoattractant protein-1 activates a regional Th1 immunoresponse in nephritis of MRL/lpr mice. Clin. Exp. Rheumatol. 23: 239-242.
    OpenUrlPubMed
  63. ↵
    Lan, R. Y., A. A. Ansari, Z. X. Lian, M. E. Gershwin. 2005. Regulatory T cells: development, function and role in autoimmunity. Autoimmun. Rev. 4: 351-363.
    OpenUrlCrossRefPubMed
  64. ↵
    De Vriese, A. S., K. Endlich, M. Elger, N. H. Lameire, R. C. Atkins, H. Y. Lan, A. Rupin, W. Kriz, M. W. Steinhausen. 1999. The role of selectins in glomerular leukocyte recruitment in rat anti-glomerular basement membrane glomerulonephritis. J. Am. Soc. Nephrol. 10: 2510-2517.
    OpenUrlAbstract/FREE Full Text
  65. ↵
    Kuligowski, M. P., A. R. Kitching, M. J. Hickey. 2006. Leukocyte recruitment to the inflamed glomerulus: a critical role for platelet-derived P-selectin in the absence of rolling. J. Immunol. 176: 6991-6999.
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section