Article Figures & Data
Figures
- FIGURE 1.
Hierarchical clustering modulated genes during infection of Caco-2 cells with Shigella, in the presence or absence of L. casei. Caco-2 cells were incubated overnight in the presence or absence of L. casei and challenged for 3 h with M90T-AfaE, the virulent strain of S. flexneri. Radioactive nucleotides were incorporated during cDNA synthesis. The labeled probes were hybridized onto macroarrays consisting of 1050 human genes represented by PCR products spotted onto nylon membranes. After washings and scanning, signal detection and normalization were performed allowing group comparisons. Modulated genes were then clustered using dChip software. Each row represents a gene, and each column represents the mean expression for each replicate. The red color represents an expression level above the mean expression of a gene across all samples, and the blue color represents an expression level lower than the mean. For each condition, eight biological replicates were made.
- FIGURE 2.
Anti-inflammatory effect of L. casei. The cells were treated as described in Material and Methods and in the legend to Fig. 1. After RNA extraction, cDNA was synthetized using Oligo-dT and reverse transcriptase enzyme. Five microliters of a 1/20 dilution were used as a template for the PCR. A, Confluent, polarized Caco-2 cells were used. B, Densitometric quantification of PCR products ((gene/GAPDH) × 100).
- FIGURE 3.
Inhibition of Shigella-induced NF-κB activation by L. casei. Overnight preincubation of HEK293 cells with L. casei blocks NF-κB activation induced by the invasive bacteria S. flexneri. CTR, Control.
- FIGURE 4.
L. casei infection results in up-regulation of I-κBα protein and inhibits Shigella-induced I-κBα degradation. A, Overnight preincubation of HEK293 cells with L. casei induces the up-regulation of I-κBα protein, while leaving other proteins of the Nod1-dependent signaling pathway unchanged. B, Overnight (O/N) preincubation of HEK293 cells with L. casei blocks I-κBα degradation induced by the invasive bacteria S. flexneri. CTR, Control.
- FIGURE 5.
L. casei infection results in up-regulation of the phosphorylated form of the I-κBα protein. Overnight (O/N) preincubation of HEK293 cells with L. casei (ranging from 2.5 106 to 5.107 bacteria/ml) induced a dose-dependent increase of I-κBα protein phosphorylation as determined by Western blotting using a specific polyclonal anti-human phospho-I-κBα Ab. CTR, Control.
- FIGURE 6.
Inhibition of TNF-α-induced NF-κB activation by L. casei. A, HEK293 cells were preincubated overnight with L. casei or MRS buffer (control medium) before stimulation for 4 h with TNF-α. Three bacterial concentrations were used: 5.106, 2.107, or 5.107 bacteria/ml. B, HEK293 cells were preincubated overnight with L. casei or MRS buffer (control medium) before stimulation for various times (15, 30, or 45 min) with TNF-α, followed by lysis of the cells. The I-κBα protein content was determined by Western blotting using a polyclonal anti-human I-κBα Ab. CTR, Control.
- FIGURE 7.
L. casei induced a down-regulation of genes involved in ubiquitination/degradation processes. Caco-2 cells were cultured overnight with L. casei with a MOI of 100. A, After washes with PBS and RNA extraction with the Rneasy mini kit, cDNA was synthetized using oligo-d(T) and reverse transcriptase. PCRs were performed as described in the legend to Fig. 2. B, After washes with PBS and lysis with Laemmli buffer, aliquots of the lysates were loaded on 15 or 10% SDS-PAGE for the subsequent detection of Rbx-1 or tubulin, respectively. The Rbx-1 or tubulin protein contents were determined by Western blotting using a polyclonal anti-human Rbx-1 or a monoclonal anti-human tubulin Ab, respectively. C, HEK cells were treated overnight with L. casei or for 6 h with 50 μM of the proteasome inhibitor MG-132 before incubation with or without TNF. The I-κBα protein content and global ubiquitinated proteins were determined by Western blotting (WB) using a polyclonal anti-human I-κBα Ab or monoclonal anti-ubiquitin Ab, respectively.
Tables
Gene Name Forward Reverse Length GAPDH TGAAGGTCGGAGTCAACGGATTTGGT CATGTGGGCCATGAGGTCCACCAC 983 Amphiregulin CTAGTAGTGAACCGTCCTCG CTCCTTCATATTTCCTGACG 489 CXCL1 TGTCAACCCCAAGTTAGTTC TCAATAATTAAGCCCCTTTG 400 CXCL2 CCAAAGTGTGAAGGTGAAGT ATGGGAGAGTGTGCAAGTAG 400 IL-8 ATGACTTCCAAGCTGGCCGTGGCT TCTCAGCCCTCTTCAAAAACTTCTC 289 ICAM-1 AGTCACCTATGGCAACGACTCC GGCCATACAGGACACGAAGCT 401 Rbx-1 AAGAAGCGCTTTGAAGTGAA GGTAACAGCAGGGAAAGTCA 339 Skp-1 GGAAATTGCCAAACAATCTG TTGAAGGTCTTGCGAATCTC 366 Proteasome ATPase 1 CAATCATGCCATCGTGTCTA GAGCCAACCACTCTCAAGAA 405 Proteasome ATPase 6 CAGCTGGACTGCAATTTCTT GCGAACATACCTGCTTCAGT 494 - Table II.
Macroarray analysis of polarized Caco-2 cell gene expression during Shigella infectiona
Probe Set NI (mean ± SD) M90T (mean ± SD) P value Fold Change Vimentin 14.62 ± 0.18 14.15 ± 0.13 0.041027 −1.39 Postmeiotic segregation 1 14.32 ± 0.09 13.97 ± 0.09 0.008549 −1.27 Human chemokine α 3 (CKA-3) 13.44 ± 0.1 13.1 ± 0.09 0.015804 −1.27 Collagen, type II, α 1 14.23 ± 0.12 13.91 ± 0.09 0.038098 −1.25 PAC 179D3 13.8 ± 0.08 13.55 ± 0.05 0.009966 −1.20 Uk-13 13.59 ± 0.05 13.39 ± 0.06 0.015796 −1.16 v-erb-a avian erythroblastic leukemia viral oncogene 13.35 ± 0.09 13.14 ± 0.03 0.045152 −1.16 Bullous pemphigoid antigen 1 13.25 ± 0.06 13.05 ± 0.05 0.014533 −1.15 FK506-binding protein 1A (12 kDa) 13.75 ± 0.07 13.55 ± 0.06 0.043947 −1.15 Flavin containing monooxygenase 4 13.11 ± 0.03 12.95 ± 0.04 0.004456 −1.13 FK506-binding protein 4 (59 kDa) 13.36 ± 0.06 13.19 ± 0.04 0.031667 −1.12 Bcl-2 binding protein 13.35 ± 0.05 13.2 ± 0.03 0.012662 −1.11 Heparan sulfate proteoglycan 2 13.15 ± 0.05 13.02 ± 0.05 0.041943 −1.10 IL-2 13.09 ± 0.09 13.32 ± 0.04 0.023695 1.18 CXCL1 13.09 ± 0.08 13.33 ± 0.08 0.042154 1.19 IEX 13.21 ± 0.05 13.45 ± 0.08 0.016412 1.19 Connective tissue growth factor 13.05 ± 0.05 13.36 ± 0.07 0.000867 1.24 CXCL3 12.9 ± 0.07 13.22 ± 0.12 0.037018 1.24 Coproporphyrinogen oxidase 14.19 ± 0.08 14.53 ± 0.1 0.01293 1.27 SOCS-3 13.34 ± 0.12 13.68 ± 0.1 0.032277 1.27 CL100 mRNA for protein tyrosine phosphatase 12.9 ± 0.07 13.24 ± 0.08 0.003215 1.27 IRF-1 12.99 ± 0.06 13.37 ± 0.14 0.019869 1.30 Ribosomal protein S3 17.22 ± 0.11 17.63 ± 0.09 0.009622 1.32 Ryudocan 13.99 ± 0.07 14.4 ± 0.14 0.02105 1.32 MAD-3 (IK-B like activity) 12.95 ± 0.07 13.37 ± 0.13 0.007291 1.34 CCL20 (MIP-3 α) 13.61 ± 0.12 14.1 ± 0.18 0.032425 1.39 GRO-2 oncogene 12.91 ± 0.1 13.42 ± 0.18 0.018873 1.42 Heat shock 70 KDa protein 6 14.09 ± 0.12 14.61 ± 0.12 0.005595 1.42 Homo sapiens chemokine exodus-1 12.73 ± 0.1 13.27 ± 0.22 0.03742 1.45 TNF ip20 13.16 ± 0.03 13.74 ± 0.14 0.000984 1.49 Amphiregulin 13.92 ± 0.16 14.52 ± 0.1 0.003459 1.52 CXCL2 13.37 ± 0.06 14.01 ± 0.23 0.015317 1.56 EST-2 14.46 ± 0.2 15.11 ± 0.14 0.011017 1.58 v-jun 13.4 ± 0.12 14.14 ± 0.13 0.000343 1.67 Superoxide dismutase 2, mitochondrial 16.83 ± 0.25 17.66 ± 0.3 0.041135 1.77 Heat shock 70 KDa protein 1A 15.12 ± 0.18 16.28 ± 0.12 0.000013 2.23 -
a Signal intensity resulting from macroarray hybridizations done with eight biological replicates of M90T infected Caco-2 cells were normalized and log2 transformed. Data analysis using the unpaired Welch t test from the dChip software gives a fold change between experimental point and baseline in a linear scale and an associated p value. Results with a p < 0.05 were considered as statistically significant.
-
- Table III.
Determination of modulated probe sets during time course culture of Caco-2 cells with L. caseia
Time Course Probe Set Number Decrease Increase 2 h 53 35 6 h 63 59 24 h 357 237 -
a Caco-2 cells were cultured 2, 6, or 24 h with L. casei. After RNA extraction, labeling and hybridizations onto U133A Affymetrix GeneChip were performed. The number represents the modulated probe set with a fold change > 2.
-
GO Biological Processb Probe Set RefSeq ID Gene Name Modulationc Fold Changed Group 1: Cell growth/cell cycle 201278_at NM_001343 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) D −4.68 201202_at NM_002592 Proliferating cell nuclear antigen D −4.29 216237_s_at NM_006739 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 D −4.07 203625_x_at NM_005983 S-phase kinase-associated protein 2 (p45) D −3.93 204318_s_at NM_016426 G-2 and S-phase expressed 1 D −3.42 204709_s_at NM_004856 Kinesin family member 23 D −3.14 200659_s_at NM_002634 Prohibitin D −3.08 209662_at NM_004365 Centrin, EF-hand protein, 3 (CDC3 1 homolog, yeast) D −2.98 204162_at NM_006101 Kinetochore associated 2 D −2.88 214710_s_at NM_031966 Cyclin B1 D −2.83 207165_at NM_012484 Hyaluronan-mediated motility receptor (RHAMM) D −2.73 202883_s_at NM_002716 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), β D −2.73 208712_at NM_001758 Cyclin D1 (PRAD1: parathyroid adenomatosis 1) D −2.51 213222_at NM_015192 Phospholipase C, β 1 (phosphoinositide-specific) D −2.51 203145_at NM_006461 Sperm associated antigen 5 D −2.46 204444_at NM_004523 Kinesin family member 11 D −2.46 202240_at NM_005030 Polo-like kinase 1 (Drosophila) D −2.42 200959_at NM_004960 fusion (involved in t(12;16) in malignant liposarcoma) D −2.38 218350_s_at NM_015895 geminin, DNA replication inhibitor D −2.34 203078_at NM_003591 Cullin 2 D −2.30 203362_s_at NM_002358 MAD2 mitotic arrest deficient-like 1 (yeast) D −2.22 212426_s_at NM_006826 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation D −2.22 212949_at NM_015341 Barren homolog (Drosophila) D −2.18 208727_s_at NM_001791 cell division cycle 42 (GTP binding protein, 25 kDa) D −2.18 201938_at NM_004642 CDK2-associated protein 1 D −2.14 203740_at NM_005792 M-phase phosphoprotein 6 D −2.03 201664_at NM_0012799 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) D −1.90 218009_s_at NM_003981 Protein regulator of cytokinesis 1 D −1.90 201725_at NM_006023 Chromosome 10 open reading frame 7 D −1.87 220789_s_at NM_004749 Transforming growth factor β regulator 4 D −1.87 204817_at NM_012291 Extra spindle poles like 1 (S. cerevisiae) D −1.87 201186_at NM_002337 Low-density lipoprotein receptor-related protein associated protein 1 D −1.65 221509_at NM_003677 Density-regulated protein D −1.57 201173_x_at NM_006600 Nuclear distribution gene C homolog (A. nidulans) D −1.46 217839_at NM_006070 TRK-fused gene I 1.87 219910_at NM_007076 Huntingtin interacting protein E I 2.38 203226_s_at NM_005981 Sarcoma amplified sequence I 2.55 202205_at NM_003370 Vasodilator-stimulated phosphoprotein I 3.86 202061_s_at NM_005065 sel-1 suppressor of lin-12-like (C. elegans) I 3.86 210513_s_at NM_003376 Vascular endothelial growth factor I 4.07 205569_at NM_014398 Lysosomal-associated membrane protein 3 I 4.92 200598_s_at NM_003299 Tumor rejection antigen (gp96) 1 I 5.46 Group 2: Apoptosis 220643_s_at NM_018147 Fas apoptotic inhibitory molecule D −5.10 221690_s_at NM_017852 NACHT, leucine rich repeat and PYD containing 2 (Nalp2) D −4.68 202268_s_at NM_003905 Amyloid β precursor protein binding protein 1, 59 KDa D −2.14 220044_x_at NM_006107 Cisplatin resistance-associated overexpressed protein D −2.14 208424_s_at NM_020313 Cytokine induced apoptosis inhibitor 1 D −2.11 219275_at NM_004708 Programmed cell death 5 D −1.65 203489_at NM_006427 CD27-binding (Siva) protein D −1.49 221479_s_at NM_004331 BCL2/adenovirus E1B 19 kDa interacting protein 3-like I 2.30 202731_at NM_014456 Programmed cell death 4 (neoplastic transformation inhibitor) I 3.36 202014_at NM_014330 Protein phosphatase 1, regulatory (inhibitor) subunit 15A I 7.21 Group 3: Hypoxia 200825_s_at NM_006389 Hypoxia up-regulated 1 I 3.86 202887_s_at NM_019058 HIF-1 response RTP801 I 4.92 Group 4: Ubiquitination/ 218117_at NM_014248 Ring-box 1 D −4.07 degradation 212751_at NM_003348 Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) D −2.88 201377_at NM_014847 Ubiquitin associated protein 2-like D −2.42 201498_at NM_003470 Ubiquitin specific protease 7 (herpes virus-associated) D −2.34 211764_s_at NM_003338 Ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) D −2.22 GO Biological Processb Probe Set RefSeq ID Gene Name Modulationc Fold Changed 201199_s_at NM_002807 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 D −2.00 204219_s_at NM_002802 Proteasome (prosome, macropain) 26S subunit, ATPase, 1 D −1.97 200683_s_at NM_003347 Ubiquitin-conjugating enzyme E2L 3 D −1.93 200988_s_at NM_005789 Proteasome (prosome, macropain) activator subunit 3 (PA28 γ Ki) D −1.87 201699_at NM_002806 Proteasome (prosome, macropain) 26S subunit, ATPase, 6 D −1.83 202151_s_at NM_016172 Ubiquitin associated domain containing 1 D −1.77 212987_at NM_012347 F-box protein 9 D −1.71 202038_at NM_004788 Ubiquitination factor E4A (UFD2 homolog, yeast) D −1.65 202128_at NM_014821 KIAA0317 D −1.62 200786_at NM_002799 Proteasome (prosome, macropain) subunit, β type, 7 D −1.57 201671_x_at NM_005151 Ubiquitin specific protease 14 (tRNA-guanine transglycosylase) D −1.46 212576_at NM_015246 Mahogunin, ring finger 1 D −1.37 208723_at NM_004651 Ubiquitin specific protease 11 D −1.21 218582_at NM_017824 Ring finger protein 153 I 1.74 201133_s_at NM_014819 Praja 2, RING-H2 motif containing I 1.97 208980_s_at NM_021009 Ubiquitin C I 2.07 201881_s_at NM_005744 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 I 2.14 221962_s_at NM_003344 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) I 2.18 208663_s_at NM_003316 Tetratricopeptide repeat domain 3 I 2.34 36564_at NM_153341 BR domain containing 3 I 3.03 -
a The cells were treated as described in Table III⇑.
-
b Four different pathways were selected using the NetAffyx database.
-
c D and I indicate, respectively, whether the gene expression decreases or increases between the experimental point and the baseline (Caco-2 cells alone).
-
d Fold change between the experimental point and baseline in a linear scale.
-
Files in this Data Supplement:
In this issue
