Discovery and Pharmacological Characterization of a Novel Rodent-Active CCR2 Antagonist, INCB3344

INCB3344

INCB3344 is a small molecule antagonist (MW 577.6) of the chemokine receptor, CCR2, selected from >1000 analogs using structure-activity relationship studies determined from murine binding and chemotaxis assays (19).

Receptor binding assays

WEHI 274.1 (murine monocytic cell line; American Type Culture Collection) cells were used in a whole cell binding assay. Cells (5 × 10⁵) in RPMI 1640 (VWR), + 0.1% BSA (Sigma-Aldrich) + 20 mM HEPES (VWR), were added to various concentrations of INCB3344 in RPMI 1640 followed immediately by the addition of 150 pM ¹²⁵I-labeled mCCL2 (mouse CCL2(JE)) (PerkinElmer) and incubated for 30 min at room temperature (RT). For the nonspecific control, 0.3 μM mCCL2 (R&D Systems) was added in place of INCB3344. Cells were then harvested through 1.2-μm polyvinylidene difluoride filters (Millipore), the filters were air-dried, and binding was determined by counting in a gamma counter (PerkinElmer). Antagonist activity is reported as the inhibitor concentration required for IC₅₀ of specific binding. Specific binding is defined as the total binding minus the nonspecific binding and typically represents 97% of the total binding.

For the CCR5 receptor binding assay, stable transfectants of murine CCR5 were generated by using full-length mCCR5 cDNA amplified by PCR from a mouse spleen cDNA library (Clontech Laboratories). CCR5 was cloned into the mammalian expression vector, pFLAG-CMV (Sigma-Aldrich), sequenced, and transfected into HEK293SFM cells (Invitrogen Life Technologies) with Lipofectamine 2000 (Invitrogen Life Technologies). A mixed stable population was established after selection with 1000 μg/ml G-418 for 2 weeks. Mouse CCR5 expression on the cells was confirmed by FACS analysis using FACSCalibur (BD Biosciences) with the anti-FLAG M2 mAb (Sigma-Aldrich). The binding assay was performed in a 96-well MultiScreen filter plate (Millipore). The mouse CCR5 HEK293SFM transfectants (1 × 10⁵ cells/well) in RPMI 1640 (Invitrogen Life Technologies) with 20 mM HEPES (Invitrogen Life Technologies) and 0.3% BSA (Sigma-Aldrich) were incubated at RT for 1 h with 0.2 nM ¹²⁵I-human MIP-1β (PerkinElmer) and a series of concentrations of either mouse MIP-1β (R&D Systems) or INCB3344. Nonspecific binding was determined by incubating the cells with 0.3 μM mouse MIP-1β (R&D Systems). Binding was determined as described above for the mCCL2-binding assay.

Chemotaxis assay

The chemotaxis assay was performed as described previously (20). WEHI-274.1 cells (5 × 10⁵) in RPMI 1640 (VWR) with or without various concentrations of INCB3344 in RPMI 1640 were loaded in the wells on top of an 8-μm polycarbonate filter in a 96-well-modified Boyden chamber (NeuroProbe). Beneath the filter, 30 nM mCCL2 (R&D Systems) with or without INCB3344 or media was placed in a corresponding 96-well plate. The sealed chambers were incubated for 45 min at 37°C, 5% CO2. Filters were washed, stained with Wright-Giemsa (Sigma-Aldrich), and the number of cells that migrated toward mCCL2 in the bottom chamber counted by microscopy. The ability of INCB3344 to antagonize CCR2-mediated chemotaxis is reported as the inhibitor concentration required for IC₅₀ values of specific migration to mCCL2. Specific migration is defined as the total migration minus the background migration. A similar assay was used to determine the impact of INCB3344 on CCR1-mediated chemotaxis of WEHI-274.1 cells, by using mouse MIP-1α (R&D Systems) as a ligand. In addition C5a, FMLP (Sigma-Aldrich) and RANTES (R&D Systems) were similarly tested in the presence of INCB3344 for migration of WEHI-274.1 cells. For the studies on the impact of INCB3344 on CCR5-mediated chemotaxis, murine T cells were used as the cell system with mouse MIP-1β as the ligand. These cells were isolated from normal mouse spleen and were cultured in RPMI 1640 media containing 10% FBS, 1× Pen/Strep, 0.1 mM nonessential amino acids, 2 mM l-glutamine, 50 μM 2-ME (all reagents from VWR), 10 ng/ml murine IL-12 (R&D Systems), and 10 μg/ml anti-murine IL-4 (BD Biosciences). Cells were placed in anti-murine CD3ε (BD Biosciences)-coated flasks (coated with 10 μg/ml at RT for 2 h)) for 2 days at 37°C, 5% CO2. Cells were washed with RPMI 1640 media twice and placed in fresh media with the addition of 20 ng/ml murine IL-2 (Sigma-Aldrich) in an uncoated flask for 1 day. Cells were washed twice again in RPMI 1640, and 4 × 10⁵ cells with or without various concentrations of INCB3344 were loaded on the top of a 3-μm polycarbonate filter on a 96-well ChemoTX system plate (NeuroProbe). Beneath the filter, 30 nM murine MIP-1β (R&D Systems) with or without INCB3344, or media was placed in a corresponding 96-well plate. The plates were incubated for 2.5 h at 37°C, 5% CO2. Media in the bottom well was mixed and collected in 5-ml polystyrene tubes. The number of cells that migrated into the wells was determined by counting on a FACSCalibur (BD Biosciences). The antagonist activity of INCB3344 on CCR5-mediated chemotaxis was expressed as the total migration minus the background migration.

ERK phosphorylation

WEHI-274.1 cells were aliquoted into microfuge tubes at 5 × 10⁶ cells/sample in 1.0 ml of CCR2 binding buffer and prewarmed to 37°C for 10 min. Compound was added for 5 min before stimulation. The samples were stimulated with mCCL2 (30 nM; R&D Systems) for 1 min. The cells were quickly pelleted, the supernatant was removed, and 100 μl of ice-cold lysis buffer containing 10 mM Tris (pH 7.2), 150 mM NaCl, 1% Triton X-100, 1% deoxycholic acid, 0.1% SDS, 50 μg/ml leupeptin, 50 μg/ml aprotinin, 1 mM sodium vanadate, 50 mM sodium fluoride, and 1 mM PMSF was added. After 10 min on ice, the samples were microfuged at 13,000 rpm for 10 min at 4°C, and the supernatants were collected. For Western analysis, 15 μl of 2× Laemmli sample buffer was added to 15 μl of cell extract, and the samples were boiled for 5 min and loaded onto 10% Tris-Glycine gels (Invitrogen Life Technologies). Following electrophoresis and transfer onto PVDF membrane, the membranes were probed with either a rabbit polyclonal anti-phospo-ERK Ab or rabbit polyclonal anti-ERK to detect total ERK protein (1/1000 dilution; Cell Signaling Technology) followed by a HRP-conjugated goat anti-rabbit IgG Ab (1/2000; Cell Signaling Technology). After washing the blots in PBS + 0.1% Tween 20, chemiluminescent detection reagent (Pierce) was added, the blots exposed to film, and developed.

Selectivity assays against GPCRs

A panel of GPCR binding assays was performed by Cerep. The receptors tested included the following: human adenosine A1, A2A, and A3 receptors; adrenergic receptors α1 (nonselective), α2 (nonselective), β1 (nonselective), 2 (nonselective), and 1; angiotensin II receptor 1 (AT1); bradykinin receptor 2 (B2); cholecystokinin receptor 1 (CCK1); dopamine D1 and D2S receptors; endothelin receptor A (ETA); rat brain GABA receptor; galanin receptor 2 (GAL2); CXCR2; CCR1; histamine receptors H1 and H2; melanocortin receptor 4 (MC4); chicken melatonin receptor 1 (ML1); muscarinic receptors M1, M2, and M3; neurokinin receptors 2 and 3 (NK2, NK3); neuropeptide receptors 1 and 2 (NPY1, NPY2); neurotensin receptor 1 (NT1); opioid receptors d (DOP), k (KOP), and μ (MOP); nociceptin receptor (ORL1); serotonin receptors 5-HT1A, 5-HT2A, 5-HT3, 5-HT5A, 5-HT6, 5-HT7, and rat 5-HT1B; mouse somatostatin receptor (SST); vasoactive intestinal peptide receptor 1 (VIP1); and vasopressin receptor 1 (V1a). All assays were run using recombinant human receptors, except where noted. The full methods and references can be found on the Cerep website (www.cerep.fr). The assays were run at 1 μM INCB3344, and a percentage of inhibition was calculated based on two separate determinations.

Animals

Female BALB/c mice (20 g; Charles River Laboratories) were used for peritonitis and delayed-type hypersensitivity (DTH) studies. C57BL/6 (Charles River Laboratories) were used for the EAE model. Female Lewis rats (Charles River Laboratories) were used for the rat adjuvant arthritis studies. Rodents were allowed water and food ad libitum. Animals were housed in accordance with the Haskell Animal Care and Use Committee (HACUC), and experiments were performed in compliance with the institutional guidelines of HACUC.

Pharmacokinetics

Blood samples were collected at 0, 0.5, 1, 2, 4, 6, 8, 12, and 24 h after dosing using EDTA as the anticoagulant and centrifuged to obtain plasma. INCB3344 and internal standard (INCB3091) were extracted from plasma by liquid-liquid extraction using a 96-well plate format. Briefly, 50 μl of INCB3352 (200 nM), 200 μl of 0.1 M NaHCO3, and 800 μl of methyl t-butyl ether were added to 100 μl of plasma sample in a 96-well plate. The plate was vortexed, centrifuged, and the organic layer transferred into another 96-well plate. The plate was evaporated to dryness, residues were reconstituted with 100 μl of 25% acetonitrile, and 10 μl of sample was injected into liquid chromatography/mass spectrometry for analysis. The chromatographic separation was accomplished using a Zorbax SB-C8 column (3.5 μm, 50 × 2.1 mm) with a gradient elution. The mobile phase used consisted of 0.1% acetic acid in acetonitrile and 2 mM ammonium acetate. Mobile phase A increased in gradient from 34 to 42% over 5 min at flow rate 300 μl/min. INCB3344 and INCB3091 were detected by positive electrospray using a Sciex API-3000 triple quadruple mass spectrometer. The linear dynamic ranged from 5 to 5000 nM.

Thioglycolate-induced peritonitis

BALB/c mice received injections in the i.p. cavity with 2 ml of fluid thioglycolate medium (VWR). Peritoneal lavages were performed after thioglycolate medium injections, by injecting 5 ml of PBS with 0.1% EDTA into the peritoneal cavity. Cell counts were performed by Coulter Counter (Beckman Coulter). Cytospins were performed to determine differential leukocyte counts. The cells were stained for 3 min with Wright-Giemsa Stain (Sigma-Aldrich) and then rinsed with deionized water for 10 min. Differential counts were calculated based on a total of 100 cells counted per sample in five high-powered fields.

DTH in mice

BALB/c female mice were epicutaneously sensitized with 25 μl of 0.5% hapten (2,4-dinitro-fluorobenzene (DNFB); Sigma-Aldrich) on the shaved skin of their abdomen. Twenty-four hours after the first application, a second application of 25 μl of 0.5% DNFB was applied to the same area as a booster. Five days later, mice were anesthetized, and both of their ears are measured for thickness using an engineer’s micrometer. These ear measurements were recorded and used as a baseline. Following recovery from anesthesia, mice received a topical application of 0.2% DNFB (10 μl on the internal pinna and 10 μl on the external pinna) to induce DTH response. Ear swelling is calculated by subtracting the baseline ear thickness of the ear from that following DNFB challenge and is expressed as units of swelling (microns). Ears are either fixed in formalin and paraffin embedded for histopathological analysis or frozen in liquid nitrogen for real-time PCR analysis.

Real-time PCR

Real-time PCR was performed essentially as described (21). Primers and probes designed to specifically detect the murine CCR2 (accession no. NM_009915), CCL2 (accession no. NM_011333), and CD68 (accession no. NM_009853) transcripts were synthesized and purified by Biosearch Technologies. All probes, with the exception of the 18S rRNA probe, were modified at the 5′ end with the reporter dye FAM-aminohexylamidite and at the 3′ end with the black hole quencher BHQ1. The 5′ end of the 18 S rRNA probe was modified with VIC (Applied Biosystems). For detection of murine CCR2 mRNA, primers 5′-AGGGTCACAGGATTAGGAAGGTT and 5′-CGTTCTGGGCACCTGATTTAA and probe 5′-CCACTGCTCATGGATATGTTGAACAATAGAGACC were used. For detection of murine CCL2 mRNA, primers 5′-GCATCTGCCCTAAGGTCTTCA and 5′-GTGGAAAAGGTAGTGGATGCATT and probe 5′- ACCTTTGAATGTGAAGTTGACCCGTAAATCTGAAG were used. For detection of murine CD68 mRNA, primers 5′-AGCTCCCTTGGGCCAAAG and 5′-AAGGTGAACAGCTGGAGAAAGAA and probe 5′-TTCTGCTGTGGAAATGCAAGCA were used. For 18S rRNA, primers 5′-CGGCTACCACATCCAAGGAA and 5′-GCTGGAATTACCGCGGCT and probe 5′-TGCTGGCACCAGACTTGCCCTC were used. Total RNA was prepared from murine ears using the RNeasy purification system (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed with the Advantage RT-PCR kit (Clontech Laboratories) according to manufacturer’s instructions using random hexamers and 1 μg of DNase I-treated total RNA. For TaqMan-based real-time PCR expression profiling, 25 ng of each cDNA was added to the TaqMan Universal PCR Master Mix along with 900 nM of each primer and 200 nM of probe according to the manufacturer’s instructions (Applied Biosystems). Real-time fluorescence monitoring was performed with the ABI Prism 7900 (Applied Biosystems). Relative expression levels of the various transcripts were determined essentially as described (20). Briefly, standard curves were generated for each transcript using a serial dilution of cDNA generated from mouse ear samples isolated from DNFB-sensitized and challenged animals. Relative abundance was then determined by comparing the cycle threshold values for each reaction with this standard curve. Abundance levels calculated from negative control reactions performed in the absence of reverse transcriptase were then subtracted from experimental sample abundance. Input levels of cDNA were normalized to 18 S rRNA levels. All expression measurements were performed in duplicate using two independently generated cDNA samples.

Experimental autoimmune encephalomyelitis

Mice were immunized with 200 μg myelin oligodendrocyte glycoprotein (MOG) 35–55 (BioSource International) emulsified in CFA containing 4 mg/ml Mycobacterium tuberculosis (Sigma-Aldrich) s.c. on day 0. In addition, on day 0 and day 2 animals were given 200 ng of pertussis toxin (Calbiochem) i.v. Clinical scoring was based on a scale of 0–5: 0, no signs of disease; 1, flaccid tail; 2, hind limb weakness; 3, hind limb paralysis; 4, forelimb weakness or paralysis; 5, moribund. Dosing of INCB3344 was initiated on day 0 or day 7 and dosed once per day at 100 mg/kg s.c. Spinal cord mononuclear cells were isolated via discontinuous Percoll-gradient (9). Cells were stained using rat anti-mouse F4/80-PE or rat IgG2b-PE (Caltag Laboratories) and quantitated by FACS analysis using 10 ul of Polybeads per sample (Polysciences).

Adjuvant-induced arthritis in rat

Female Lewis rats received injections at the base of the tail with 100 ul of an emulsion of CFA (1 mg of Mycobacterium butyricum in IFA) to induce adjuvant arthritis. Rats are monitored daily for the clinical signs of arthritis, which may begin between 10 and 14 days after the injection. Each rat paw was scored using a rating of 0–3 (0, normal; 1, slight redness; 2, redness and swelling; 3, substantial redness and swelling). Ankles were harvested on day 21 and placed in decalcifying solution followed by 10% formalin. Ankles were cut and stained with H&E. Histological analyses were performed on a scale of 0–7 as follows: 0, normal; 1, minimal; 2, mild; 3, moderate; 4, marked; 5, severe; 6, very severe; 7, near destruction of joint for bone resorption or 7, very severe infiltration with severe edema and periarticular tissue expansion for inflammation scoring.

Statistical analysis

Statistical significance of differences between means was analyzed using the paired two-tailed t test with significance set at p values below 0.05.

In vitro pharmacology of INCB3344

Binding inhibition studies with INCB3344.

Characterization of the pharmacological activity of INCB3344 was first evaluated by testing its ability to inhibit CCL2 binding to CCR2 in a whole cell binding assay using a murine monocyte cell line, WEHI-274.1 and ¹²⁵I-labeled mCCL2 as a tracer. Previous studies showed that mCCL2 binding to the WEHI-274.1 cell line is specific with a K_d of 0.6 nM (data not shown), consistent with the published K_d value of CCL2 binding to recombinant CCR2 (22). The binding IC₅₀ of INCB3344 in this assay was determined to be 10 ± 5 nM, and inhibition of >90% binding was observed at a concentration of 90 nM (Fig. 1⇓a).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Effects of INCB3344 and INCB3090 on binding and functional responses of WEHI-274 cells to CCL2. a, Inhibition of CCL2 binding to WEHI cells by INCB3344 (▪) but not INCB3090 (▴). b, Dose-dependent inhibition of mCCL2-induced chemotaxis of WEHI-274 cells by INCB3344 (▪) but not INCB3090 (▴). The IC₅₀ of binding inhibition by INCB3344 is 10 nM. c, INCB3344 inhibits ERK phosphorylation in response to CCL2 stimulation in WEHI274 cells. IC₅₀ value of INCB3344 on ERK phosphorylation is similar to that in chemotaxis assay. A representative Western blot is shown.

The structural isomer of INCB3344, INCB3090 (19), was also tested in the mCCL2 binding assay. This molecule demonstrated poor CCR2 antagonistic activity with an IC₅₀ of >600 nM (Fig. 1⇑a), suggesting specific conformational requirements for INCB3344, which enable its interaction with CCR2 and its inhibition of CCR2 binding.

Selectivity of INCB3344.

Selectivity of INCB3344 was evaluated against a panel of GPCRs including several human chemokine receptors using radioligand binding assays. Results from these studies demonstrate at least 100-fold selectivity of INCB3344 against all of the receptors tested (data not shown).

Because CCR1 and CCR5 are most homologous to CCR2, we performed further analysis of INCB3344 activity against these two murine receptors. To determine the effect of INCB3344 on MIP-β binding to murine CCR5, a HEK293SFM cell line was established that stably expresses murine CCR5. In the competition binding assay, using human ¹²⁵I-MIP-1β as radioligand and the mouse CCR5 transfectants as the source of the receptor, mouse MIP-1β potently inhibited the radioligand binding to the receptor (IC₅₀ ≈ 4.5 nM). In contrast, INCB3344 demonstrated <50% inhibitory activity at concentrations >3 μM (Fig. 2⇓a), indicating that this molecule does not antagonize the mouse CCR5 receptor. INCB3090 also lacks activity in this assay when evaluated at concentrations up to 3 μM (data not shown). To evaluate the functional effects of INCB3344 on mouse CCR5, a chemotaxis assay was performed using murine T cells with MIP-1β as the chemoattractant. The IC₅₀ of INCB3344 in this assay was >3 μM, again indicating that the compound does not antagonize mouse CCR5 (data not shown). The selectivity of INCB3344 and INCB3090 were also determined against murine CCR1. Murine MIP-1α (100 nM) was used as the chemoattractant for the WEHI-274.1 cells (which express CCR1) in the chemotaxis assay. The IC₅₀ for both compounds were >1 μM, indicating selectivity against CCR1 (data not shown). In addition, selectivity was tested for migration of WEHI-274.1 cells to C5a, FMLP, and RANTES in the presence of INCB3344. There was no impact on the ability of these cells to migrate to these potent chemoattractants in the presence of INCB3344, further confirming the CCR2 selectivity of this compound (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Lack of inhibition of INCB3344 on MIP-1β binding or signaling. a, INCB3344 (▪) or unlabeled MIP-1β (▴), as a positive control, were evaluated in a binding assay using HEK293SFM cells stably transfected with murine CCR5 to determine the cross-reactivity of INCB3344 on murine CCR5. INCB3344 was inactive in this assay at concentrations up to 3 μM. b, INCB3344 inhibits ERK phosphorylation in response to MCP-5, a ligand for CCR2, but does not inhibit phosphorylation induced by the CCR1 ligand, MIP-1α, or a nonspecific activator PMA in WEHI-274 cells.

Finally, we evaluated the effects of INCB3344 on ERK phosphorylation induced by another known ligand specific for CCR2, MCP-5, and a CCR1 ligand, MIP1α, to determine potentially weak cross-reactivity to CCR1 that cannot be measured in binding and chemotaxis assays. The effect of INCB3344 on PMA-induced ERK phosphorylation was also measured to exclude nonreceptor-mediated effects on this signaling event (Fig. 2⇑b). Results from these studies clearly demonstrate that INCB3344 inhibits ERK phosphorylation selectively induced by CCR2 ligands but not by other mechanisms.

In vivo pharmacology of INCB3344

Pharmacokinetics of INCB3344.

The pharmacokinetic profile of INCB3344 was evaluated in mice following oral administration at a dose of 30 mg/kg. INCB3344 exhibited a time-concentration relationship consistent with two-compartment distribution (Fig. 3⇓). Based on the pharmacokinetic profile of INCB3344, in vitro chemotaxis inhibitory potency, and free fraction of INCB3344 in mouse plasma (15% fu), dosing regimens that targeted different levels of CCR2 inhibition at trough were designed for evaluation in animal models. At 30, 50, and 100 mg/kg oral doses, predicted inhibition of CCR2-mediated signaling at 12-h trough plasma concentrations were 40, 75, and >90%, respectively (Fig. 3⇓).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Pharmacokinetics of INCB3344 after a single oral dose of 30 mg/kg. The 12-h trough plasma concentrations of three doses of INCB3344 and corresponding predicted inhibition of CCR2 are shown.

Inhibition of macrophage influx by INCB3344.

Because multiple studies using CCR2 knockout mice have demonstrated a selective reduction of monocyte influx in the thioglycolate-induced peritonitis model (5, 6, 7), we used this model as a simple in vivo system to evaluate the pharmacodynamics and specificity of INCB3344, before extensive and longer-term in vivo studies.

Groups of mice received i.p. injection of thioglycolate followed by oral administration of vehicle or different doses of INCB3344 (30, 60, or 100 mg/kg BID). Mice were sacrificed 48 h later, and peritoneal lavages were obtained for cell influx analysis. At this time point, in control mice, the cellular component of peritoneal lavage consisted predominantly of macrophages and neutrophils with very few lymphocytes present. Treatment of mice with INCB3344 resulted in a dose-dependent reduction of total cell number in the lavage fluid, but the differences reached statistical significance (Fig. 4⇓a) (p < 0.005) only at the highest dose tested. Analysis of the differential leukocyte counts by morphological evaluation of cytospins from the lavage fluid demonstrated a dose-dependent suppression of monocyte influx (36% at 30 mg/kg, 55% at 60 mg/kg, and 73% at 100 mg/kg) (Fig. 4⇓b) with 60 and 100 mg/kg doses showing statistically significant effects (p < 0.02) with no statistically significant effects on the total numbers of lymphocytes, a minor fraction of the total cell infiltrate in this model.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Inhibition of macrophage influx by INCB3344 in the thioglycolate-induced peritonitis model. a, Effect of INCB3344 treatment on the total cell number in the lavage fluid following thioglycolate injection. Vehicle (▪) or different doses of INCB3344, 30 mg/kg BID (▧), 60 mg/kg BID (▦), or 100 mg/kg BID (▦) were evaluated in this model. b, Specific effects of INCB3344 on macrophages vs neutrophils.

To exclude potential nonspecific effects of INCB3344 on cell migration, we also examined the effect of INCB3344 administration on the non-CCR2-bearing neutrophil fraction of the peritoneal lavage. Results, shown in Fig. 4⇑b, demonstrate that INCB3344 did not impact peritoneal influx of neutrophils at any of the doses tested. We also examined the effects of INCB3344 administration on the eosinophil fraction of the lavage fluid and did not observe any differences between vehicle and INCB3344 groups (data not shown). These results indicate that the effect of INCB3344 in this model is specific to macrophages.

We further evaluated the possibility of non-CCR2-mediated effects of INCB3344 contributing to its inhibition in the thioglycolate peritonitis model by using CCR2^−/− mice. It has been previously demonstrated that there is an incomplete (∼70%) inhibition of macrophage influx in CCR2^−/− mice with this model. If the effect of INCB3344 is solely mediated through CCR2, then the treatment of CCR2^−/− mice with this molecule should not impact the remaining peritoneal macrophage influx. Indeed, when groups of CCR2^−/− mice were subjected to thioglycolate peritonitis following INCB3344 treatment (100 mg/kg), no further reduction of peritoneal macrophage influx was observed with INCB3344 beyond what occurs due to the absence of the CCR2 gene (data not shown).

Suppression of DTH response by INCB3344.

Given that INCB3344 inhibits macrophage influx in an in vivo model in a manner similar to that observed in the CCR2^−/− mice, and given that it has a favorable pharmacokinetic profile allowing dose-dependent inhibition of CCR2 in vivo, we sought to assess the activity of the molecule in a more complex model of cell-mediated immunity. One such model is the DTH reaction (25). This well-characterized model consists of a sensitization phase (immune education phase), and a challenge phase (inflammatory phase). A positive DTH reaction results in the influx of Ag-specific T cells as well as other inflammatory cells, including macrophages, leading to inflammation of the challenged tissue. We performed this model in mice using the ear as the challenge site and used ear thickness change as a gross measure of the degree of inflammation. Additionally, a more quantitative and specific measurement of macrophage influx in this model was obtained by using quantitative real-time PCR (qPCR) to measure the expression of CCR2 and other relevant inflammation-related marker genes from ear cDNA samples.

To determine the effect of INCB3344 in the murine DTH reaction, groups of mice (n = 6–8) were administered either vehicle or INCB3344 at varying doses orally twice a day (30, 50, and 100 mg/kg), starting at the time of ear challenge with DNFB (inflammatory phase only). Ear thickness was measured, as a clinical measure of ear inflammation, 48 h after ear challenge. Mice were then sacrificed, and both ears were collected for analysis of CCR2 expression by qPCR and for histological evaluation of inflammation. INCB3344 treatment resulted in a dose-dependent suppression of ear swelling (Fig. 5⇓a). The percentages of inhibition compared with the vehicle-treated group were 23, 35, and 54% in 30, 50, and 100 mg/kg BID dose groups, respectively (p < 0.01). Using qPCR analysis of CCR2 mRNA (a gene that is predominantly expressed by monocytes/macrophages), we evaluated the impact of INCB3344 treatment on tissue macrophage burden (Fig. 5⇓b). At doses of 30, 50, and 100 mg/kg BID, INCB3344 treatment resulted in 34, 69, and 84% inhibition of CCR2 mRNA (normalized to 18S RNA), respectively. This correlated with a significant decrease in CD68, a macrophage surface marker, as well CD4, a marker for helper T cells primarily found in the infiltrate in this model. Histological analyses also demonstrated a decrease in the inflammatory cell component in the dermis of the ears following INCB3344 treatment (Fig. 5⇓c). To exclude the possibility that the INCB3344 activity in the murine DTH model was due to potential non-CCR2-mediated effects, the pharmacologically inactive INCB003090 was tested in DTH. Administration of INCB3090 did not result in appreciable inhibition of macrophage influx as determined by qPCR analysis of CCR2 mRNA or inhibition of ear swelling (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

INCB3344 inhibits DTH response in mice. a, INCB3344 inhibition of ear swelling after DNFB challenge is dose responsive. b, Expression of CCR2 mRNA is significantly decreased by INCB3344 treatment. c, H&E staining of 5-μm ear sections illustrating the significant decrease in inflammatory cell infiltrate following treatment with INCB3344. ∗, p < 0.02 (two-tailed t test).

INCB3344 is protective in the mouse EAE model.

It has previously been reported that CCL2 and CCR2 knockout mice are resistant to the development of MOG-induced EAE (9, 10, 18). A similar model system has been used to evaluate the role of other chemokine receptors, CCR1 and CCR5, which are also present on monocytes. Although CCR1 gene deletion resulted in a lower incidence of disease (26), the effect was not nearly as profound as that observed in CCR2 or CCL2 knockout mice. Mice with the CCR5 gene deletion did not show any impact on the development of EAE (27). Given the demonstrated role of CCR2 in this well-characterized model, we chose mouse EAE as a disease model system to further evaluate the efficacy of INCB3344.

Starting from the day of immunization, mice received vehicle or INCB3344 (100 mg/kg QD) by s.c. administration and were monitored for the development of clinical signs of disease. The s.c. dosing regimen was used in this study because it allows once daily dosing. At this dose, in vivo CCR2 inhibition is ∼75% at trough (24 h postdose). The mean clinical scores of mice treated with INCB3344 were significantly lower (p < 0.05) than those receiving vehicle (Fig. 6⇓a), with a significant difference in disease incidence (vehicle 87.5% vs INCB3344 25%). Treatment with INCB3344 also resulted in a 50% decrease in the number of macrophages (F4/80 positive) isolated from the spinal cords (vehicle 5.8 × 10⁵ vs INCB3344 2.4 × 10⁵). Although prophylactic dosing replicates the data in the CCR2 knockout, we also show antagonism of CCR2 in a therapeutic dosing regimen. As shown in Fig. 6⇓b, animals that received their first dose of INCB3344 7 days after immunization still showed significant inhibition of disease as manifested by suppression of the apparent disease incidence (vehicle 100% vs INCB3344 64%) as well as severity (maximum mean clinical score vehicle 2.57 ± 0.78 vs INCB3344 1.43 ± 1.22). Dosing was initiated on day 7 when histological evidence of disease is present but few animals are presenting clinical signs (28). The data clearly show that CCR2 antagonism therapeutically can halt the progression of EAE.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

INCB3344 is efficacious in the MOG-induced model of mouse EAE. Treatment of mice orally with INCB3344 100 mg/kg s.c QD (▴) a, Dosing from the time of immunization results in significant suppression of the clinical signs of disease as compared with vehicle-treated animals (▪) b, Dosing was initiated 7 days postimmunization. The data are expressed as the mean clinical disease score for all mice in each group as a function of days after immunization. Mean clinical disease severity was significantly decreased in INCB3344-treated animals (n = p < 0.05, two-tailed t test).

INCB3344 is efficacious in the rat adjuvant arthritis model.

INCB3344 was also evaluated therapeutically in the rat adjuvant arthritis model by initiation of dosing at day 9 after adjuvant treatment. This time point correlates to a time at which macrophages have already begun to infiltrate into the joint (29). Significant inhibition of the severity of disease was achieved at 100 mg/kg PO BID (p < 0.001) (Fig. 7⇓a). In the rat, this dosing scheme provides an IC₅₀ at trough of ∼70%. Histological evaluation (Fig. 7⇓b) showed significant inhibition of inflammation in the joints of these animals (82% inhibition) as well as significant inhibition of bone resorption (64% inhibition) (Fig. 7⇓c).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

INCB3344 is efficacious in rat AIA. Treatment of rats with INCB3344 100 mg/kg BID s.c. from day 9 postimmunization resulted in significant inhibition of clinical and histological disease. a, Clinical score: each limb graded on a scale of 0–3, giving a maximum score of 12 per mouse (n = 10/group). Histological analyses of ankles. b, H&E comparison of ankles from vehicle- and INCB3344-treated animals (arrow indicates area of severe synovitis. c, Mean inflammation score and mean bone resorption score. Scored on a scale of 0–7, with 0 = normal and 7 = most severe. ∗, p < 0.02 (two-tailed t test).