Cutting Edge: TLR4 Deficiency Confers Susceptibility to Lethal Oxidant Lung Injury

Mice

TLR4^−/− (B6;129Tlr4^tm1Aki) and the control mice (B6;129F2) have been described previously (9). The TLR4^−/− mice were originally provided by S. Akira (Osaka University, Osaka, Japan) (4). Mice were maintained and bred under specific pathogen-free conditions at the animal facility of Yale University School of Medicine. All of the protocols were reviewed and approved by the Animal Care and Use Committee at Yale University.

Murine hyperoxia exposure

Mice were exposed to 100% oxygen (O₂) in a Plexiglas exposure chamber. Naive mice were kept at room air. For survival studies, animals were carefully monitored and the time of death noted. Lung injury was assessed 72 h after the initiation of hyperoxia by performing bronchoalveolar lavage (BAL) cell counts and protein analyses. Lung specimens were also processed for histology, RNA and protein extraction, apoptosis, and immunohistochemistry analyses.

Cell culture and hyperoxia exposures

Lung endothelial cells and type II alveolar epithelial cells were isolated from lungs of wild-type (WT) and TLR4^−/− mice with modification of the methods described previously (10). Hyperoxic conditions were achieved as described previously (11).

Apoptosis assays

TUNEL assay was performed, and TUNEL-positive cells were expressed as a percentage to total cells as described previously (11). Flow cytometry was performed on cells using a FACS to detect Annexin V-FITC labeling (BD Pharmingen) as described previously (12).

Western blot analysis

Protein levels of Bcl-2, Bad, Bax, caspase-3 (Santa Cruz Biotechnology), HO-1 (StressGen Biotechnologies), and phospho-Akt (Cell Signaling Technology) were analyzed by Western blot assays as described previously (13).

Intranasal administration of recombinant adenovirus-containing HO-1 cDNA

Mice were anesthetized with methoxyflurane, and then 5 × 10⁸ PFU of adenoviral HO-1 (Ad-HO-1) (a gift from L. E. Otterbein, Harvard University, Boston, MA) or adenoviral β-galactosidase (Ad-LacZ) (BD Biosciences) were administered intranasally to each mouse in a volume of 50 μl as described previously (12).

Total RNA isolation and RT-PCR amplification

Total RNA from lung tissue was extracted as described previously (12). For mouse TLR4, sense: GCTTTCACCTCTGCCTTCAC; antisense: CGAGGCTTTTCCATCCAATA; and for mouse β-actin, sense: GTGGGCCGCTCTAGGCACCAA; antisense: CTCTTTGATGTCACGCACGATTTC. RT-PCR was performed using RT-PCR Master Mix (USB).

Statistics

Data are expressed as mean ± SE and analyzed by Student’s t test. Survival studies were evaluated using log-rank analysis (14), and statistical analysis was performed using GraphPad Prism 3.0 (GraphPad) software. Significant difference was accepted at p < 0.05.

TLR4 is essential for survival during hyperoxia

To investigate whether TLR4 and its endogenous ligands are involved in hyperoxia-induced lung injury, we exposed WT mice to hyperoxia for 72 h, a time point previously determined to be most representative of maximal stress responses in the murine lung (15). We found that hyperoxia increased TLR4 mRNA expression in whole lung lysates (Fig. 1⇓A). We also confirmed increased TLR4 protein expression by immunohistochemistry in a variety of lung cells (including lung epithelial and endothelial cells) after hyperoxia (data not shown). Hyperoxia also increased expression of the endogenous TLR4 ligands fibronectin and hyaluronan in both WT and TLR4-deficient mice (TLR4^−/−) (data not shown). To determine whether there was a functional role in vivo for TLR4 induction during hyperoxia, we assessed survival rates of WT and TLR4^−/− mice in continuous hyperoxia. Given that TLR4 deficiency has been shown to be protective in other models of noninfectious injury (4, 5, 6), we expected TLR4^−/− mice would be less susceptible to the damaging effects of hyperoxia. To our surprise, TLR4^−/− mice showed significantly increased mortality during hyperoxia compared with WT mice (Fig. 1⇓B). After 5 days of hyperoxia exposure, 55.6% of the WT mice (n = 18) remained alive, whereas none of the TLR4^−/− mice (n = 18) were alive. The range of survival for TLR4^−/− mice was 2.5–5 days, and the range for WT mice was 3.5–6.5 days. This indicated that a TLR4-dependent signaling pathway was critical for survival during hyperoxia. Consistent with the survival data, TLR4^−/− mice exposed to hyperoxia exhibited significantly greater inflammation, lung permeability, and oxidative DNA damage compared with WT mice (Fig. 1⇓, C–E). Of note, naive TLR4^−/− mice and naive WT mice have similar basal levels of BAL cell counts, protein, and DNA oxidation (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

TLR4 is essential for survival during hyperoxia. A, RT-PCR analysis for TLR4 mRNA expression in lung lysates from WT naive mice (lane 1) and mice exposed to 72-h O₂ (lanes 2–4). B, Survival curves of WT (n = 18) and TLR4^−/− (n = 18) mice exposed to hyperoxia (p = 0.004, WT vs TLR4^−/−). C, Lung inflammation was detected by BAL cell counts in naive mice, WT mice, and TLR4^−/− mice exposed to 72-h O₂. D, Lung permeability was assessed by BAL protein. Data represent mean ± SE. ∗, p < 0.05 compared with naive mice; ∗∗, p < 0.05 compared with WT O₂. E, DNA oxidation was detected by 8-hydroxy-2′-deoxyguanosine immunohistochemical staining in the lungs of naive, WT mice exposed to 72-h O₂, and TLR4^−/− mice exposed to 72-h O₂. Arrows indicate positive red staining (×400, original magnification). Results shown are representative of three to five independent experiments.

TLR4 is essential for appropriate antiapoptotic responses during hyperoxia in vivo and in vitro

Both animal and recent patient studies have established apoptosis, specifically lung endothelial and epithelial apoptosis, as an important part of the pathogenesis of acute lung injury (16, 17). We found that TLR4^−/− mice exhibited significantly greater lung TUNEL staining (Fig. 2⇓A). Both epithelial and endothelial cells isolated from TLR4^−/− mice also showed significantly more apoptosis than cells from WT mice during hyperoxia (Fig. 2⇓, B and C).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

TLR4 is essential for lung endothelial and epithelial survival during hyperoxia. A, Lung sections were processed for TUNEL staining and quantitation expressed as percentage of total cells. Data are shown as mean ± SE. ∗, p < 0.05 compared with naive mice; ∗∗, p < 0.05 compared with WT 72-h O₂. B, Apoptosis of lung endothelial cells isolated from WT and TLR4^−/− mice was measured by flow cytometry after 72-h O₂. C, Apoptosis of lung alveolar type II cells isolated from WT and TLR4^−/− mice was measured by flow cytometry after 72-h O₂. Graphical representation of the data is shown as mean ± SE. ∗, p < 0.05 compared with corresponding 72-h O₂; ∗∗, p < 0.05 compared with WT 72-h O₂. Results shown are representative of three to five independent experiments.

We postulated that a potential mechanism of increased lung apoptosis in TLR4^−/− mice might be differences in anti- and proapoptotic protein expression. Our Western blot results showed that hyperoxia increased expression of Bcl-2 in WT lungs (Fig. 3⇓). However, TLR4^−/− mice were unable to significantly increase Bcl-2 protein in their lungs. The expression of Bad and Bax appeared relatively unchanged during hyperoxia in the WT and TLR4^−/− mice. The Akt pathway is also known to play an important role in modulating apoptosis and was recently linked to TLR4 in response to LPS (18, 19). We found that TLR4^−/− mice were unable to increase phospho-Akt expression in response to hyperoxia, unlike WT mice (Fig. 3⇓). In addition, TLR4^−/− mice have exaggerated levels of activated caspase-3 expression in lungs, as assessed by Western blot analysis, during hyperoxia compared with WT mice (Fig. 3⇓). These data indicated that the mechanism of increased lung apoptosis and injury in TLR4^−/− mice was the lack of key antiapoptotic responses, namely Bcl-2 and phospho-Akt induction, and increased proapoptotic processes such as caspase-3 activation. TLR4 signaling is generally thought to be proapoptotic, but this has previously been studied in the context of LPS, microbes, or immune cells (20, 21, 22). We show both in vivo and in epithelial and endothelial cells isolated from TLR4^−/− mice that TLR4 is necessary to maintain appropriate antiapoptotic responses during hyperoxia.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

TLR4 modulates antiapoptotic protein and caspase-3 expression during hyperoxia. Western blot analysis for pro- and antiapoptotic protein expression in lung lysates from single animals: naive mice (lane 1), WT mice exposed to 72-h O₂ (lanes 2 and 3), and TLR4^−/− mice exposed to 72-h O₂ (lanes 4 and 5). Ab to β-tubulin was used as loading control. Results shown are representative of three to five independent experiments.

Hyperoxia likely induces lung TLR4 signaling via increased endogenous ligands such as fibronectin and hyaluronan in vivo. Alternatively, ROS may directly “ligate” TLR4 by affecting redox-sensitive moieties of the receptor given that hyperoxia can also induce TLR4 in isolated lung cell culture systems (data not shown). Others have demonstrated the involvement of the endothelial and epithelial cell in TLR signaling (23, 24). Potential explanations as to why TLR4 deficiency is protective in certain settings yet not in others include the use of different mouse strains and injury models. It is clear that distinct TLR signaling pathways are used in response to different types of injury. For instance, unlike LPS or ischemia-reperfusion-induced TLR signaling in which NF-κB mediates TLR signal transduction (25), NF-κB does not appear to have a major role in hyperoxia-induced injury (26).

An antioxidant and antiapoptotic strategy with HO-1 overexpression rescues TLR4^−/− mice from lethal hyperoxia

HO-1 and its reaction products exert potent antioxidant and antiapoptotic properties in a variety of injury models (12, 27). We have demonstrated that HO-1 and its reaction product CO have the ability to induce the antiapoptotic proteins Bcl-2 and phospho-Akt (13, 28), both of which are lacking in the TLR4^−/− mice. Of note, TLR4^−/− mice have the ability to up-regulate HO-1 expression during hyperoxia. However, stress-induced HO-1 expression is likely a consequence of severe oxidant injury, and HO-1 levels as well as timing of induction in this context are inadequate to provide significant protection (12). High levels of HO-1 and its products are required before or at the onset of injury to have beneficial effects. Therefore, we administered intranasal rat HO-1 in an adenoviral vector (Ad-HO-1) to achieve HO-1 overexpression in mouse lungs before hyperoxia exposure. WT mice given Ad-HO-1 showed significantly increased survival during hyperoxia compared with WT mice given empty vector (Ad-LacZ) (Fig. 4⇓A). Furthermore, TLR4^−/− mice given Ad-HO-1 also showed markedly increased survival compared with TLR4^−/− mice given Ad-LacZ, reaching a survival rate comparable to WT/Ad-LacZ mice (Fig. 4⇓A). After 5 days of hyperoxia exposure, 50% of TLR4^−/− mice with Ad-HO-1 remained alive, whereas all of the TLR4^−/− mice with Ad-LacZ were dead. The range of survival for TLR4^−/− mice with Ad-HO-1 was 4–6 days, and for TLR4^−/− mice with Ad-LacZ the range of survival was 3.5–5 days. The improved survival with Ad-HO-1 correlated with attenuation of lung inflammation, permeability, and oxidative DNA damage in TLR4^−/− mice during hyperoxia (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Ad-HO-1 gene transfer rescues TLR4^−/− mice from hyperoxia-induced mortality and apoptosis. TLR4^−/− mice were intranasally administered Ad-LacZ or rat Ad-HO-1 48 h before hyperoxia and then assessed for survival and lung injury. A, Survival curves for WT and TLR4^−/− administered Ad-HO-1 or Ad-LacZ before hyperoxia (p = 0.03, WT/Ad-LacZ vs WT/Ad-HO-1; p = 0.02, TLR4^−/−/Ad-LacZ vs TLR4^−/−/Ad-HO-1). B, Lung sections were processed for TUNEL staining, and quantitation was expressed as percentage of total cells. Data are shown as mean ± SE. ∗, p < 0.05 compared with naive mice; ∗∗, p < 0.05 compared with TLR4^−/− Ad-HO-1 72-h O₂. C, Western blot analysis in lung lysates from naive WT (lane 1), WT mice exposed to 72-h O₂ (lane 2), naive TLR4^−/− mice (lane 3), TLR4^−/− mice administered Ad-HO-1 before 72-h O₂ (lane 4), and TLR4^−/− mice administered Ad-LacZ before 72-h O₂ (lane 5). Results shown are representative of three to five independent experiments.

In addition, Ad-HO-1 rescued TLR4^−/− mice from hyperoxia-induced lung apoptosis (Fig. 4⇑B). As expected, Ad-HO-1 led to appropriately increased levels of lung HO-1 protein expression in TLR4^−/− compared with TLR4^−/− mice given Ad-LacZ before hyperoxia (Fig. 4⇑C). Interestingly, Ad-HO-1 restored levels of Bcl-2 and phospho-Akt protein expression in TLR4^−/− mice to that of WT mice when challenged with hyperoxia (Fig. 4⇑C). This indicated that TLR4^−/− mice retain the ability to induce cytoprotective pathways. Taken together, these data demonstrate that TLR4 is essential for survival, possibly by maintaining appropriate levels of antiapoptotic responses such as Bcl-2 and phospho-Akt induction in the face of oxidant stress. Although links between TLR4 and Akt have been described (19), the precise pathway(s) whereby TLR4 modulates Akt and Bcl-2 during oxidant injury is unknown and will be an important focus of future studies. There is also a possibility that TLR4^−/− mice are deficient in multiple signaling pathways, which thus opens up new avenues of investigation.

Our current data point to a novel paradigm for TLR4 signaling in response to exogenous oxidants. TLR4, at least in the lung, appear to be not only important sensors of conserved microbial components but also exogenous oxidants and thereby modulators of downstream responses such as inflammation and apoptosis. This would make teleological sense for an organ that is the first-line defense against inhaled microbial Ags as well as numerous oxidative stressors in the environment. In addition, the mechanisms of TLR4 responses in the lung during oxidant stress are likely to be distinct from what has thus far been described in other systems. Ultimately, these studies bring forth a fundamental link between innate immunity pathways and exogenous, noninfectious injury signals. These new insights will allow broader approaches for the prevention and treatment of a variety of oxidant-mediated disease processes.