Substance P Augments Borrelia burgdorferi-Induced Prostaglandin E₂ Production by Murine Microglia

SP receptor-deficient mice

SP receptor-deficient mice, bred for >10 generations onto a C57BL/6 background, were derived at the University of Iowa Medical Center (Iowa City, IA) (26). These mice were originally derived from induced mutations made by insertion of the lacZ gene into exon 1 of the SP receptor (5). SP receptor-deficient mice were routinely screened by PCR to confirm disruption of the SP receptor, as previously described (5, 27), using the positive and negative strand primers CCAACACCTCCAAGACTTCTG and GCCACAGCTATGGAGTAGAT for wild type, and TCCAGACTGCCTTGGGAAAA and GCCACAGCTGTCATGGAGTAGAT for SP receptor deficiency, respectively.

Isolation of primary murine microglia

Murine neonatal brain microglia were isolated, as described previously, by our laboratory (18, 19, 28). Briefly, six to eight neonatal BALB/c or C57BL/6 (NK-1R^−/−) mouse brains per preparation were dissected free of meninges and large blood vessels, and minced with sterile surgical scissors. The minced tissue was forced through a wire screen and briefly incubated with 0.01% trypsin-0.005% EDTA for 5 min. The cell suspension was then washed, and this mixed glial culture was maintained in RPMI 1640 containing 10% FBS and gentamicin for 2 wk. A microglia culture was obtained from this mixed glial culture by shaking flasks for 1 h at 200 rpm in an orbital shaker (New Brunswick Scientific, Edison, NJ) and allowing the transferred dislodged cells to adhere to new tissue culture vessels for 1 h. The medium was then removed, and fresh RPMI 1640 with 10% FBS and 20% conditioned medium from LADMAC cells (ATCC number CRL-2430) was added as a source of CSF-1 to maintain microglia cultures for 1 wk, as described previously (29). Cells isolated in this manner were previously demonstrated to be >95% authentic microglia due to their characteristic morphology and the presence of the microglia cell surface markers CD11b and F4/80, as determined by FACS analysis (19).

Preparation of B. burgdorferi Ags

A clonal low passage of B. burgdorferi strain N40 was used throughout these studies (30). Spirochetes were grown in Barbour-Stoenner-Kelly II medium (31). Cells were centrifuged at 10,000 × g and washed three times with PBS. After the final wash, bacteria were resuspended in PBS and pulsed three times with a cell sonicator for 20 s at 25-s intervals. B. burgdorferi Ags isolated in this manner have been previously demonstrated to be free of detectable levels of LPS (25). Isolated microglia were exposed to 1 μg/ml B. burgdorferi cell lysate, as indicated.

Isolation of RNA and semiquantitative RT-PCR

Total RNA was isolated from microglia using TRIzol reagent (Life Technologies, Gaithersburg, MD), as described previously (18, 19, 28).

PCR was performed to determine the expression of COX-1, COX-2, EP2R, and EP4R. PCR was performed on 5% of the reverse-transcribed cDNA product to quantify expression of the mRNAs encoding COX-2, COX-1, EP2R, EP4R, and G3PDH using 95°C denaturation, 60°C annealing, and 72°C extension temperatures (Robocycler 40; Stratagene, La Jolla, CA) with the first 3 of 28 total cycles having extended denaturation and annealing times, as previously described (18, 28, 32).

Positive and negative strand primers used, respectively, were TCAGCCAGGCAGCAAATCCTT and TAGTCTCTCCTATGAGTATGAGTC to amplify mRNA encoding COX-2 (25) (932-bp fragment), CACCCTCGGTCCTGCTCGCAGAT and GTTGGACCGCACTGTGAGTACCAG to amplify mRNA encoding COX-1 (371-bp fragment), GTGGCCCTGGCTCCCGAAAGT and GGCAAGGAGCATATGGCGAAGGTG to amplify mRNA encoding EP2R (33, 34) (535-bp fragment), TTCCGCTCGTGGTGCGAGTGTTC and GAGGTGGTGTCTGCTTGGGTCAG to amplify mRNA encoding EP4R (35) (423-bp fragment), and CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify mRNA encoding the housekeeping gene, G3PDH (340-bp fragment). PCR primers were derived from the published sequences of COX-1 (35) and G3PDH (36). These primers were designed using Oligo 4.0 primer analysis software (National Biosciences, Plymouth, MA) based on their location in different exons of the genomic sequences for each in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software; IBI, New Haven, CT).

PCR amplification of the housekeeping gene, G3PDH, was performed on cDNA from each sample to insure similar input of RNA and efficiencies of reverse transcription. The identities of the PCR-amplified fragments were verified by size comparison with DNA standards (Promega, Madison, WI).

Quantification of PGE₂ secretion in primary microglia culture supernatants

PGE₂ levels were determined using a Biotrak enzyme immunoassay system, according to the directions provided by the manufacturer (Amersham Pharmacia Biotech, Piscataway, NJ), as described previously (18). The minimum detectable level in this assay was 2.5 pg/ml.

Western blot analysis for NF-κB p65 (RelA) in microglia nuclear extracts

Western blot analysis for the presence of NF-κB p65 (RelA) in microglia nuclear extracts was performed, as described previously (19, 37). Nuclear extract protein samples from primary microglia were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P transfer membranes (Millipore, Bedford, MA). The primary Ab used was an anti-NF-κB (RelA) subunit polyclonal Ab purchased from Chemicon International (Temecula, CA). After reacting with primary Ab, blots were washed and incubated in the presence of a donkey anti-rabbit IgG Ab conjugated to HRP (Southern Biotechnology Associates, Birmingham, AL). Bound enzyme was detected with the ECL system (Amersham Pharmacia Biotech).

Western blot analysis for EP2 and EP4 receptor expression in microglia whole cell lysates

Western blot analysis for the presence of EP2 and EP4 receptors in microglia whole cell lysates was performed, essentially, as described previously (19). Briefly, whole cell protein samples from primary microglia were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P transfer membranes (Millipore). The primary Ab used was an anti-EP2 or anti-EP4 receptor polyclonal Ab purchased from Cayman Chemical (Ann Arbor, MI). After reacting with primary Ab, blots were washed and incubated in the presence of a donkey anti-rabbit IgG Ab conjugated to HRP (Southern Biotechnology Associates). Bound enzyme was detected with the ECL system (Amersham Pharmacia Biotech).

Confocal microscopy analysis for NF-κB p65 (RelA) in primary microglia

Primary microglia cells were isolated and grown to confluency on glass coverslips in 24-well tissue culture plates. Cells were then washed and fixed in 95% methanol for 30 min at 25°C. After fixing, the cells were blocked with 10% nonimmune goat serum (Zytec, San Francisco, CA) for an additional 30 min. After washing, cells were incubated with a polyclonal rabbit anti-mouse Ab (Chemicon International) directed against the p65 subunit of NF-κB (RelA) or an Ab directed against an irrelevant Ag for 1 h at room temperature. Cells were then washed three times with PBS before the addition of a secondary donkey anti-rabbit IgG Ab conjugated to tetramethylrhodamine isothiocyanate (Molecular Probes, Eugene, OR) for an additional hour. Cells were then washed three times with PBS and mounted on glass slides using the ProLong AntiFade kit, according to the manufacturer’s instructions (Molecular Probes), and analyzed by confocal microscopy (Olympus, Mellville, NY) using a ×60 objective.

Densitometric analyses

Densitometric analyses of RT-PCR products were performed using NIH Image (obtained from the National Institutes of Health website: http://rsb.info.nih.gov/nih-image). Each image was imported into NIH Image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting.

SP augments B. burgdorferi-induced COX-2 mRNA expression by murine microglia

To begin to determine whether SP is capable of modulating microglial responses, we investigated the effect of SP and B. burgdorferi stimulation on levels of expression of mRNA encoding the enzyme, COX-2, in primary murine microglia. Microglia were cultured in the presence or absence of B. burgdorferi Ags (Bb) at a dose below that previously shown to elicit maximal inflammatory responses by cultured microglia (1 μg/ml) (18), and with or without SP (1 nM) at a dose that has previously been demonstrated to activate the transcription factor NF-κB in cultured microglia (19). At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-2 mRNA expression. As shown in Fig. 1⇓A, stimulation with Bb or SP alone failed to induce the expression of mRNA encoding COX-2 after 4 h, although these agents did elicit modest elevations in mRNA encoding COX-2 after 8 h (1.3- and 2.2-fold increases, as measured by densitometric analysis, respectively) (Fig. 1⇓A). Intriguingly, simultaneous exposure of microglia to Bb and SP resulted in a marked increase in the levels of expression of mRNA encoding COX-2 as rapidly as 4 h posttreatment (46-fold increase, as measured by densitometric analysis) (Fig. 1⇓A). This effect of SP on Bb-induced COX-2 mRNA expression was sustained after 8 h (12.5-fold increase, as measured by densitometric analysis), but abated after 12 h posttreatment (Fig. 1⇓A).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

SP augments B. burgdorferi-induced COX-2 mRNA expression by murine microglia. A, COX-2 mRNA expression is enhanced by B. burgdorferi in the presence of SP. Semiquantitative RT-PCR analysis of COX-2 mRNA expression in primary microglia either unstimulated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), Bb + SP, NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist for 4, 8, and 12 h. SP fails to augment B. burgdorferi-induced COX-2 mRNA expression in microglia derived from mice genetically deficient in SP receptor expression. B, Semiquantitative RT-PCR analysis of COX-1 mRNA expression in primary NK-1R^−/− microglia either unstimulated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), or both stimuli together for 4 and 8 h. PCR amplification of the housekeeping gene, G3PDH, was performed to ensure similar amounts of input RNA and similar efficiencies of reverse transcription. These experiments were performed five times with similar results.

To confirm the specificity of the SP effects on COX-2 mRNA expression, we used a specific nonpeptide, NK-1R antagonist, L-703,606 (Sigma-Aldrich, St. Louis, MO). Microglia were either treated or untreated with L-703,606 (10 nM) for 15 min before exposure of the cells to Bb and SP. As shown in Fig. 1⇑A, L-703,606 attenuates the effect of SP on B. burgdorferi-induced COX-2 mRNA expression seen at 4 and 8 h posttreatment (50 and 52% inhibition, as measured by densitometric analysis, respectively). To ensure that differences in mRNA levels could not be attributed to differences in input RNA, or efficiencies of reverse transcription, RT-PCR amplification of the housekeeping gene, G3PDH, was performed for each sample (Fig. 1⇑A).

To further confirm the NK-1R-mediated ability of SP to augment the levels of expression of mRNA encoding COX-2, we isolated microglia from mice genetically deficient in the expression of the SP receptor (NK-1R^−/− mice). NK-1R^−/− microglia were cultured in the presence or absence of Bb Ags (1 μg/ml), SP (1 nM), or both stimuli together. At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-2 mRNA expression. As shown in Fig. 1⇑B, stimulation with Bb alone failed to elicit increased levels of expression of mRNA encoding COX-2, consistent with experiments using wild-type microglia (Fig. 1⇑A). As expected, the lack of SP/SP receptor interactions in these cells resulted in a loss of synergistic increases in levels of expression of mRNA encoding COX-2 in the presence of Bb and SP (Fig. 1⇑B), confirming a NK-1R-mediated ability of SP to augment B. burgdorferi-induced microglial responses. Taken together, these results demonstrate the ability of the neuropeptide, SP, to enhance and specifically augment B. burgdorferi-induced microglial responses in vitro.

Levels of mRNA encoding COX-1 are constitutive and are unaffected by B. burgdorferi and SP stimulation

COX-1 has been shown to be constitutively expressed in a variety of tissues, including the CNS. To determine whether the ability of SP to augment B. burgdorferi-induced COX expression is restricted to the inducible form of the enzyme (COX-2), we investigated the effect of SP and B. burgdorferi stimulation on levels of expression of mRNA encoding COX-1 in primary murine microglia. Microglia were cultured in the presence or absence of B. burgdorferi Ags (Bb) (1 μg/ml), SP (1 nM), or both stimuli together. At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-1 mRNA expression. As shown in Fig. 2⇓, levels of mRNA expression encoding COX-1 are not significantly altered from constitutive expression, in both wild-type microglia and microglia isolated from NK-1R^−/− mice (Fig. 2⇓). Taken together, these results demonstrate that, in contrast to COX-2, levels of expression of COX-1 mRNA are independent of Bb and SP treatment.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Levels of mRNA encoding COX-1 are constitutive and are unaffected by B. burgdorferi and SP stimulation. A, Semiquantitative RT-PCR analysis of COX-1 mRNA expression in primary microglia either unstimulated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), Bb + SP, NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist for 4, 8, and 12 h. PCR amplification of the housekeeping gene, G3PDH, was performed to ensure similar amounts of input RNA and similar efficiencies of reverse transcription. B, Semiquantitative RT-PCR analysis of COX-1 mRNA expression in primary NK-1R^−/− microglia either unstimulated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), or both stimuli together for 4 and 8 h. PCR amplification of the housekeeping gene, G3PDH, was performed to ensure similar amounts of input RNA and similar efficiencies of reverse transcription. These experiments were performed three times with similar results.

SP augments B. burgdorferi-induced PGE₂ production by murine microglia

Recently, studies from our laboratory have demonstrated the ability of B. burgdorferi Ags to elicit the production of significant levels of PGE₂ by cultured microglia (18). To address whether the effect of SP on B. burgdorferi-induced COX-2 mRNA expression translates into increased secretion of PGE₂, a specific capture ELISA was performed to detect the presence of this prostanoid in microglial culture supernatants. Culture supernatants of untreated primary microglia or microglia treated with B. burgdorferi (Bb) alone (1 μg/ml), SP alone (1 nM), or both stimuli together were harvested 4 h posttreatment and assayed for PGE₂ production. As shown in Fig. 3⇓A, treatment of microglia with Bb or SP alone failed to elicit detectable levels of PGE₂ production by these cells. Importantly, simultaneous exposure to both Bb and SP resulted in a marked increase in PGE₂ secretion by microglia (Fig. 3⇓A) compared with untreated cells or cells exposed to either stimulus alone (Fig. 3⇓A). The effect of SP- on Bb-induced PGE₂ production was dependent on SP/SP receptor interactions, as shown by its sensitivity to the presence of the specific SP receptor antagonist, L-703,606 (10 nM) (Fig. 3⇓A), which by itself or in combination with Bb or SP had no significant effect on the production of this prostanoid by microglia (Fig. 3⇓A). In addition, to confirm the specificity of the effects of SP on Bb-mediated PGE₂ production, similar experiments were performed using microglia derived from NK-1R-deficient mice. As shown in Fig. 3⇓B, treatment of microglia with B. burgdorferi alone or SP alone failed to elicit detectable levels of PGE₂ production by these cells. Importantly, exposure to both Bb and SP simultaneously had no effect on levels of PGE₂ secretion by these cells after 4 h (Fig. 3⇓B) or 8 h (data not shown), confirming the importance of SP/SP receptor interactions in augmenting B. burgdorferi-induced microglial responses (Fig. 3⇓B). For comparison purposes and to ensure the functionality of the assay, culture supernatants from primary microglia were harvested 4 h after stimulation with B. burgdorferi (5 Bb) at a concentration previously demonstrated to maximally induce PGE₂ production by cultured microglia (5 μg/ml) (18) and is shown in Fig. 3⇓B.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

SP augments B. burgdorferi-induced PGE₂ production. A, Cultured primary murine microglia were untreated (−) or treated (+) with B. burgdorferi lysate (Bb) (1 μg/ml), SP (1 nM), NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist, and culture supernatants were taken 4 h postexposure. A specific capture ELISA was performed to quantify PGE₂ secretion. B, Cultured NK-1R^−/− primary murine microglia were untreated (−) or exposed (+) to B. burgdorferi lysate (Bb) (1 μg/ml), SP (1 nM), or both stimuli together, and culture supernatants were taken 4 h postexposure. A specific capture ELISA was performed to quantify PGE₂ secretion. For comparison purposes and to ensure the functionality of the assay, culture supernatants from primary microglia were harvested 4 h after stimulation with 5 μg/ml Bb whole cell lysate (5 Bb). Results are presented as the mean of three experiments ± SEM (∗#, denotes p < 0.05).

SP augments B. burgdorferi-induced activation of the transcription factor, NF-κB, in murine microglia

Given the ability of both B. burgdorferi and SP to elicit activation of NF-κB in murine microglia (18, 19), we hypothesized that simultaneous stimulation of cultured microglia with B. burgdorferi and SP would result in a marked increase in the activation of NF-κB when compared with untreated cells or cells treated with either stimulus alone.

Microglia were untreated or treated with B. burgdorferi (Bb) Ags (1 μg/ml), SP (1 nM), or both stimuli together for 30 min and assayed for the cellular localization of the p65 (RelA) subunit of NF-κB via confocal microscopy. As shown in Fig. 4⇓, treatment with either Bb or SP alone failed to elicit increased levels of RelA in the nucleus when compared with untreated microglia cells (Fig. 4⇓, A–C). In contrast, microglia cells exposed to Bb and SP simultaneously exhibited a robust increase in the expression of RelA in the nucleus (Fig. 4⇓D). Furthermore, this increase in the levels of nuclear RelA was dependent on the actions of SP through its receptor, as evidenced by the ability of L-703,606 (10 nM) to abrogate this response (Fig. 4⇓F), while having no effect by itself when compared with untreated cells (Fig. 4⇓E).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

SP augments B. burgdorferi-induced NF-κB translocation, as determined by confocal microscopy. Microglia were prepared from untreated cells (A) or cells stimulated with B. burgdorferi (Bb) whole cell lysate (1 μg/ml) (B), SP (1 nM) (C), Bb + SP (D), NK-1R antagonist (10 nM) (E), or Bb + SP + NK-1R antagonist (F) for 30 min and analyzed by confocal microscopy using a ×60 objective. Cells were stained with an Ab directed against RelA (A–F) or with an Ab directed against an irrelevant Ag (G). These experiments were performed three times with similar results.

To confirm the ability of SP to augment B. burgdorferi-induced NF-κB activation, microglial nuclear extracts were analyzed for the cellular localization of the p65 (RelA) subunit of NF-κB by Western blot analysis. As shown in Fig. 5⇓, microglia treated simultaneously with both stimuli exhibited a dramatic increase in the level of RelA present in the nucleus when compared with either treatment alone (133 vs 45 and 37 arbitrary densitometric units, respectively) (Fig. 5⇓). Importantly, this marked induction was attenuated in the presence of the NK-1R antagonist, L-703,606 (1 nM) (56% inhibition, as measured by densitometric analysis).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

SP robustly increases B. burgdorferi-induced nuclear translocation of the RelA subunit of NF-κB in murine microglia as determined by Western blot analysis. Cells were untreated (−) or treated (+) with B. burgdorferi lysate (Bb) (1 μg/ml), SP (1 nM), NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist for 30 min. Nuclear extracts were harvested, and 10 μg of total protein was analyzed for the presence of RelA by Western blot analysis. These experiments were performed three times with similar results.

Taken in concert, these data demonstrate the ability of SP to augment B. burgdorferi-induced NF-κB activation in cultured microglia, as evidenced by the marked increases in nuclear translocation of the RelA subunit (Figs. 4⇑ and 5⇑).

SP markedly increases levels of mRNA encoding the PGE₂ receptors, EP2 and EP4, as well as each receptor protein, in B. burgdorferi-challenged microglia

PGE₂ has been demonstrated to exert its effects on a variety of cell types by binding to one or a combination of four subtypes of receptor designated, EP1, EP2, EP3, and EP4. Importantly, the interaction between PGE₂ and the EP receptor subtypes 2 and 4 has previously been demonstrated to modulate macrophage effector functions (38, 39) as well as potentiate inflammatory disease progression (40). Microglia cells were untreated or exposed to B. burgdorferi (Bb) Ags (1 μg/ml), SP (1 nM), or both stimuli together. RNA was isolated 4 h later, and semiquantitative RT-PCR was performed for the presence of mRNA encoding the EP2 and EP4 receptors. As shown in Fig. 6⇓A, neither receptor subtype was constitutively expressed by untreated murine microglia. Importantly, Bb treatment alone resulted in an increase in the levels of expression of mRNA encoding the EP2 receptor (18-fold increase, as measured by densitometric analysis), while failing to elicit detectable increases in expression of mRNA encoding the EP4 receptor (Fig. 6⇓A). Similarly, SP treatment alone evoked increases in the levels of expression of mRNA encoding both the EP2 and EP4 receptor, compared with untreated cells (49- and 49-fold increases, as measured by densitometric analysis, respectively) (Fig. 6⇓A). In contrast, the combined presence of B. burgdorferi and SP elicited synergistic increases in the levels of mRNA encoding both the EP2 and EP4 receptors (194- and 96-fold increases, as measured by densitometric analysis, respectively) (Fig. 6⇓A). Furthermore, this effect was dependent, in part, on the actions of SP through its receptor, as shown by the ability of L-703,606 (10 nM) pretreatment to inhibit this effect (96 and 64% inhibition, as measured by densitometric analysis, respectively) (Fig. 6⇓A).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

SP increases levels of mRNA encoding the PGE₂ receptors, EP2 and EP4, as well as each receptor protein, in B. burgdorferi-challenged microglia. A, SP markedly increases B. burgdorferi-induced EP2 and EP4 receptor mRNA expression in murine microglia. Cells were untreated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), Bb + SP, NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist for 4 h. RNA was isolated, and RT-PCR was performed for the presence of mRNA encoding the EP2 or EP4 receptor. PCR amplification of the housekeeping gene, G3PDH, was performed to ensure similar amounts of input RNA and similar efficiencies of reverse transcription. These experiments were performed at least three times with similar results. B, Cells were untreated (−) or stimulated (+) with B. burgdorferi (Bb) whole cell lysate (1 μg/ml), SP (1 nM), Bb + SP, NK-1R antagonist (NK-1R Antag) (10 nM), or Bb + SP + NK-1R antagonist for 12 h. Whole cell protein isolates were extracted and analyzed for the presence of the EP2 and EP4 receptor by Western blot analysis. To ensure equal loading of protein samples between wells, the membrane was reprobed for the presence of β-actin. These experiments were performed three times with similar results.

To assess whether synergistic increases in mRNA encoding the EP2 and EP4 receptors in microglia translate into increases in expression of these receptor proteins, we investigated the combined effect of Bb and SP treatment on EP2 and EP4 receptor protein levels in microglia by Western blot analysis. Cells were untreated or exposed to B. burgdorferi Ags (Bb) (1 μg/ml), SP (1 nM), or both stimuli together for 12 h. As shown in Fig. 6⇑B, Bb treatment alone had no effect on levels of EP2 and EP4 receptor protein when compared with unstimulated cells. Similarly, SP treatment alone failed to evoke an increase in the levels of expression of EP2 and EP4 receptor protein, compared with untreated and Bb-treated cells (Fig. 6⇑B). However, the combined presence of B. burgdorferi and SP elicited marked increases in the levels of both EP2 and EP4 receptor proteins (2-fold increases in each, as measured by densitometric analysis corrected for background intensity for each lane) (Fig. 6⇑B). Furthermore, this effect was dependent on SP/SP receptor interactions, as shown by the ability of L-703,606 (10 nM) pretreatment to inhibit this effect (100% inhibition of the increases observed, as measured by densitometric analysis) (Fig. 6⇑B).

Taken together, these data demonstrate that Bb and SP act in concert to augment the expression of the EP receptor subtypes, 2 and 4, by primary murine microglia.