Cryptic Epitope Identified in Rat and Human Cardiac Myosin S2 Region Induces Myocarditis in the Lewis Rat

Antigens

Thirty-two overlapping peptides from the S2 region of HCM (Table I⇓) were synthesized and purified as 25-mers with an 11 aa overlap by Genemed Synthesis (South San Francisco, CA).

Preparation of purified HCM or RCM and its subfragment

Cardiac myosin was purified from human and Lewis rat heart tissue according to the method of Tobacman and Adelstein (39), with slight modification. Briefly, heart tissue was homogenized in a low-salt buffer (40 mM KCL, 20 mM imidazole, (pH 7.0), 5 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 μg of leupeptin/ml) for 15 s on ice. The washed myofibrils were collected by centrifugation at 16,000 × g for 10 min. The pellets were then resuspended in high-salt buffer (0.3 M KCL, 0.15 M K₂HPO₄, 1 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 μg of leupeptin/ml) and homogenized for three 30-s bursts on ice. The homogenized tissue was further incubated on ice with stirring for 30 min to facilitate actomyosin extraction. After clarification by centrifugation, actomyosin was precipitated by addition of 10 volumes of cold water, followed by a pH adjustment to 6.5. DTT was added to 5 mM, and the precipitation was allowed to proceed for 30 min. The actomyosin was then pelleted by centrifugation at 16,000 × g. The actomyosin pellet was then resuspended in high-salt buffer, ammonium sulfate was increased to 33%, and the KCL concentration was increased to 0.5 M. After the actomyosin pellet and salts were dissolved, ATP was added to 10 mM and MgCl₂ was added to 5 mM, and then the solution was centrifuged at 20,000 × g for 15 min to remove actin filaments. The supernatant was removed and stored at 4°C in the presence of the following inhibitors: 0.5 mM PMSF, 5 μg/ml N-tosyl-l-lysine chloromethyl ketone, and 1 μg of leupeptin/ml.

Immunization of animals

Female Lewis, Brown Norway, F344, and BB/DR rats (6–8 wk old) were purchased from Harlan Sprague Dawley (Indianapolis, IN) and maintained in groups of three at the Animal Resources Unit at the University of Oklahoma Health Sciences Center (Oklahoma City, OK). The study was conducted under an Institutional Animal Care and Use Committee approved protocol. The rats, after being anesthetized with 10 mg of ketamine/0.2 mg of xylazine, were injected in one hind footpad with 500 μg of cardiac myosin or S2 peptide emulsified in CFA at 1:1 ratio (v/v). On day 0 and day 3 after immunization, the rats were injected i.p. with 1 × 10¹⁰ heat-killed Bordetella pertussis. Seven days after primary immunization, the rats were boosted s.c. with 500 μg Ag emulsified in IFA at 1:1 ratio (v/v). Control rats received PBS plus adjuvants. All rats were sacrificed at day 21 by cardiac puncture under anesthesia.

Histopathological examination of tissue

Skeletal muscle, hearts, livers, and kidneys were fixed in 10% buffered Formalin and imbedded in paraffin. Sections (5 μM) were stained with H&E for microscopic histological examination. Myocardium was blindly scored for the presence of histopathological myocarditis according to the scale: 0 = normal, 1 = mild (<5% of heart cross-section involved), 2 = moderate (5–10% of cross-section involved), 3 = marked (10–25% of cross-section involved), and 4 = severe (>25% of cross-section involved). Skeletal muscle, livers, and kidneys were also evaluated for cellular infiltrates as well as myocardium.

ELISA for Ab detection

For sera IgG Ab detection, 10 μg/ml Ag was coated onto Immulon-4 96-well microtiter plates (Dynatech Laboratories, Chantilly, VA) at 50 μl/well in 0.1 M carbonate-bicarbonate coating buffer (pH 9.6), then incubated overnight at 4°C. Plates were washed three times with PBS containing 0.05% Tween 20, then blocked with 1% BSA in PBS for 1 h at 37°C, and washed with PBS Tween 20. Diluted rat serum samples (50 μl, 1/200 dilution for epitope mapping) in PBS with 1% BSA were added to wells in duplicate and incubated overnight at 4°C. Plates were washed with PBS with Tween 20, and 50 μl of goat anti-rat IgG whole molecule (Sigma-Aldrich, St. Louis, MO) conjugated with alkaline phosphatase (1/250 dilution for epitope mapping) was added and incubated at 37°C for 1 h. Plates were washed and 50 μl of substrate para-nitrophenyl phosphate 104 (Sigma-Aldrich) in 0.1 M diethanolamine buffer (pH 9.8) was added. After 30 min, OD was measured at 410 nm in an ELISA plate reader (Dynex Technologies, Chantilly, VA). Controls included Ab conjugate alone and BSA alone.

Lymphocyte proliferation assays

Spleens were removed from rats and pressed through fine mesh screens. The single cell suspension was prepared, counted by trypan blue exclusion, and resuspended to 5 × 10⁶/ml in culture medium (RPMI 1640 supplemented with 10% FBS, 1% sodium pyruvate, 1% nonessential amino acids, and antibiotics). The cells were plated in 96–well round-bottom tissue culture plates (Nunc, Naperville, IL) in 100 μl of culture medium. Splenocytes were incubated at 37°C in 5% CO₂ for 6 days with protein or peptide Ags at various concentrations before addition of 0.5 μCi of tritiated thymidine (ICN, Irvine, CA). After 18–24 h, cells were harvested onto filters with a cell harvester (MACH II; Wallac, Turku, Finland), and tritiated thymidine incorporation was measured in a liquid scintillation counter (Betaplate 1250; Wallac). Values represent the stimulation index with the equation: Stimulation index = (mean test cpm/mean of medium control cpm). MHC restriction was determined by measuring proliferation of splenic T cells in the presence of 0.5 μg/ml anti-RT1.B (OX-6) or anti-RT1.D (OX-17) Abs (Serotec, Raleigh, NC).

Adoptive transfer of EAM

Female 6- to 8-wk-old Lewis rats were immunized with S2–16 or PBS in CFA as previously described. Fourteen days after first injection, spleens were removed from rats, and single cell suspension was prepared and cultured with 10 μg/ml S2–16 at 5 × 10⁶/ml for 2 days. Cells were then washed three times, and 0.5–1 × 10⁸ cells were injected into the inguinal veins of naive syngeneic recipients. Fourteen days following transfer, the recipients were sacrificed for histological examination.

RT-PCR for detection of cytokine mRNA

On day 14 and day 21 postimmunization, poly(A)⁺ RNA extraction from myocardium of rats, and cDNA synthesis were performed according to manufacturer’s instruction (Qiagen, Valencia, CA; Invitrogen, Carlsbad, CA). In a total volume of 50 μl of PCR buffer, 4 μl of cDNA were incubated with 1.25 U of TaqDNA polymerase, 0.5 mM deoxynucleotide triphosphates, and 1 μM sense and antisense cytokine-specific primers. Samples were placed in a thermocycler, and each cycle consisted of 94°C denaturing for 60 s, 54°C annealing for 60 s, and 72°C extension for 90 s. Five percent of the PCR were electrophoresed in agarose/ethidium bromide gels and visualized under UV light. The sizes of the bands were determined by m.w. standards (DNA low mass ladder; Invitrogen, Carlsbad, CA). The sequences of primer pairs specific for rat IL-6, IL-12 (p40), IFN-γ, TNF-α, and G3PDH are as follows: IL-2, GCGCACCCACTTCAAGCCCT and CCACCACAGTTGCTGGCTCA; IL-6, GAAATACAAAGAAATGATGG and GTGTTTCAACATTCATATTGC; IL-12 (p40), CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG; IL-10, TGCCTTCAGTCAAGTGAAGACT and AAACTCATTCATGGCCTTGTA; IFN-γ, GCTCTGCCTCATGGCCCTCTCTGGC and GCACCGACTCCTTTTCCGCTTCCTT; TNF-α, GAGATGTGGAACTGGCAGAG and CTTGAAGAGACCCTGGGAGTA; G3PDH, TCCACCACCCTGTTGCTGTA and ACCACAGTCCATGCCATCAC.

ELISA for cytokine detection

To determine cytokine production, splenocytes were cultured in culture medium alone or culture medium containing 10 μg/ml Ags for 24–72 h. Cytokine levels were assayed in 24 h (IL-2) or 48 h (IL-4, IL-10, TNF-α, and IFN-γ) culture supernatants by cytokine-specific ELISA according to the manufacturer’s protocol (BD PharMingen, San Diego, CA). OD was measured at 450 nm in the ELISA plate reader (Dynatech Laboratories). Sample cytokine concentrations were determined according to the standard curves established using known concentration of each cytokine.

Statistical analysis

Means, SEMs, and unpaired Student’s t test were used to analyze the data. Groups were considered statistically different if p ≤ 0.05.

Myocarditic epitope is located in the S2 fragment of cardiac myosin

Thirty-two overlapping synthetic peptides (25-mers) spanning the amino acid sequence of the S2 region of HCM were divided into eight groups with four contiguous peptides in each group (Table I⇑). Groups of 6- to 8-wk-old female Lewis rats were immunized with each of the S2 peptide groups. Examination of heart sections from rats immunized with the S2–13 to S2–16 peptide group revealed myocarditis in all animals tested (Table II⇓ and Fig. 1⇓C). Two other S2 peptide groups shown to induce mild myocarditis in immunized rats were peptide groups S2–9 to S2–12, and S2–25 to S2–28, which had average scores of 0.5 and 0.7, respectively (Table II⇓). HCM immunized rats, comprising the positive control group, developed moderate to severe myocarditis (Table II⇓ and Fig. 1⇓B). Heart tissue sections from rats immunized with PBS and CFA had no cellular infiltrate and exhibited normal myocardium (Table II⇓ and Figure 1⇓A). Rats immunized with other peptide groups were negative for myocarditis (Table II⇓ and Fig. 1⇓D).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Histopathologic features of autoimmune myocarditis in rats. Female 6–8-wk-old Lewis rats were immunized with PBS (A), HCM (B), S2 peptide group 13–16 (C), and S2 peptide group 21–24 (D), S2–16 peptide (E), rS2–16 (rat S2–16 sequence) (F), tS2–16d (the truncated sequence identical in RCM and HCM) (G), and tS2–16a (the truncated 11-mer peptides) (H) in CFA. Experiments in several rat strains revealed that the Lewis rat (E) was most susceptible, whereas other strains (Table IV⇓) including F344 were more resistant to developing myocarditis after S2–16 immunization (I). BB/DR rats (I) and Brown Norway rats did not develop myocarditis, whereas F344 rats developed weak myocarditis (J).

To further identify the highly pathogenic epitope in the S2 subfragment of cardiac myosin, Lewis rats were immunized with single S2 peptides from S2–13 to S2–16. S2–16 peptide (residues 1052–1076) induced moderate to severe myocarditis in all six peptide-immunized rats, with average histopathological score of 2.9 (Table III⇓ and Fig. 1E⇑). The frequency and severity of myocarditis induced by S2–16 was comparable to that induced by intact cardiac myosin. S2–13, S2–14, and S2–15 did not induce myocarditis in most tested rats. In addition to actively inducing EAM, S2–16 primed lymphocytes were also found to be capable of passively transferring the disease after adoptive transfer of S2–16 peptide activated splenic T cells into naive syngeneic rats. Results showed myocarditis in five of six recipients of S2–16 primed T cells, whereas none of the rats receiving CFA-primed T cells developed EAM (Table III⇓).

To delineate the myocarditic sequence within S2–16, we generated a panel of truncated or modified peptides based on the S2–16 sequence (Table III⇑). Among them, rS2–16 was designed based upon the rat S2–16 sequence, which has only one amino acid difference from S2–16 derived from HCM sequence (leucine vs glutamine at residue 1074). To identify the optimal length of the pathogenic S2–16 epitope, we also generated four truncated peptides of S2–16 including tS2–16a, tS2–16b, and tS2–16c, which are three shortened 11-mer peptides, and tS2–16d, which was synthesized as a 22-mer with the last three amino acids in S2–16 deleted. The design of the truncated peptide tS2–16d eliminated the single amino acid difference between the rat and human sequence. Therefore, tS2–16d sequence was identical in both RCM and HCM. We found both rS2–16 and tS2–16d produced moderate to severe myocarditis in Lewis rats (Table III⇑ and Fig. 1⇑, F and G, respectively), whereas the three truncated shorter 11-mer tS2–16 peptides were completely nonmyocarditic (Table III⇑ and Fig. 1⇑H). Therefore, the myocarditic portion of S2–16 was localized to a 22 amino acid sequence (residues 1052–1073), which is identical in both RCM and HCM.

The myocarditis inducing capacity of S2–16 was Lewis strain-specific

Immunization of Brown Norway, F344, and BB/DR rats with S2–16 failed to induce severe (3+ to 4+) histopathological myocarditis (Table IV⇓). Heart tissue sections from PBS/CFA immunized control rats and other rat strains immunized with S2–16 had little or no cellular infiltration in myocardium (Table IV⇓ and Fig. 1⇑I). F344 rat strain immunized with S2–16 showed little (0.1+) myocardial infiltration (Table IV⇓ and Fig. 1⇑J), whereas the BB/DR and Brown Norway rat strains demonstrated no myocarditis lesions (Table IV⇓). Therefore, Lewis rats were the most susceptible strain to S2–16-induced EAM.

Fig. 1⇑ shows cellular infiltrates in sections of rat myocardium stained with H&E. Lesions contained mononuclear cell infiltrates and were granulomatous with myocyte necrosis. Multinucleated giant cells were present in the inflammatory lesions. Inflammatory infiltrates were similar in hearts of rats immunized with HCM (Fig. 1⇑B), S2–16 (Fig. 1⇑E), rat S2–16 peptide (rS2–16, Fig. 1⇑F), and the truncated 22-mer S2–16 peptide (tS2–16d, Fig. 1⇑G). Heart tissue sections from PBS immunized control rats had no cellular infiltration and showed normal myocardium (Fig. 1⇑A). Examination of multiple sections of skeletal muscle, liver, and kidney from rats with myocarditis did not find evidence of tissue infiltration of mononuclear cells (data not shown).

Enhanced cellular immune responses against S2–16 correlate with disease in immunized Lewis rats

We first detected the proliferative responses of lymphocytes from S2–16 immunized multistrain rats. Splenic lymphocytes were isolated, and in vitro stimulated with various concentrations of S2–16 peptide (Fig. 2⇓). Lymphocytes from Lewis rats responded strongly against S2–16 restimulation in a dose-dependent pattern. Although S2–16 reactive lymphocytes were also present in BB/DR and F344 rats after immunization with S2–16, the lymphocyte proliferative response to S2–16 was much lower than that of Lewis rats. None or very low lymphocyte reaction to S2–16 was detected in Brown Norway rats. Therefore, the high reactivity of S2–16 specific T cell responses was associated with EAM induction.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Recall proliferative response of lymphocytes from S2–16 immunized Lewis rats as compared with F344, Brown Norway (BN), and BB/DR strain of rats. Splenic lymphocytes were isolated from four strains of rats 21 days after they were immunized with S2–16. Lymphocytes were stimulated with various concentrations of S2–16 peptides for 6 days, and the proliferative responses were measured by [³H]thymidine incorporation. Results of the proliferation assay were expressed as stimulation index = (mean test cpm/mean of medium control cpm) ± SEM. Results presented represent an average of two independent experiments.

S2–16 is a cryptic epitope with characterization of Ab and lymphocyte responses in S2–16 and HCM immunized Lewis rats

For Lewis rats, we mapped the peptide epitopes recognized by T cells and Abs from S2–16 immunized rats, and compared them with those of cardiac myosin immunized rats and PBS/CFA immunized control rats. We measured both Ab (Fig. 3⇓) and T cell (Fig. 4⇓) responses against 32 overlapping synthetic peptides spanning the HCM S2 region after immunization. Ab from S2–16 immunized Lewis rats recognized not only S2–16, but also S2–4, S2–17, and S2–18 peptides. However, sera from HCM and RCM (data similar for the RCM) immunized Lewis rats did not show strong reactivity with any specific S2 peptide although sera reacted strongly with HCM and RCM (Fig. 3⇓). A similar IgG Ab response pattern was also observed at day 14 and day 28 after immunization. No peptide reactivity was shown by PBS/CFA control Ab (OD 0.3–0.5 for each peptide).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

IgG Ab responses of S2–16 and HCM immunized Lewis rats to synthetic S2 peptides. Sera were collected from S2–16 and HCM immunized Lewis rats at day 21. The reaction of IgG Ab to 32 overlapping synthetic peptides of the HCM S2 region were measured by ELISA. Multiple serum dilutions were tested, but the serum dilution used for this figure was 1/200. Error bars represent SEMs. The same assay was also performed for PBS/CFA immunized control Lewis rats. No peptide-specific IgG response was observed in control rats (OD 0.3–0.5) with each peptide. RCM immunized Lewis rats demonstrated little response against the S2 peptides similar to that shown for HCM (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Proliferative responses of splenic lymphocytes from Lewis rats immunized with S2–16, HCM, RCM, and PBS in CFA. Lymphocytes taken from spleens at day 21 were cultured in vitro with each of 32 overlapping S2 peptides. Results of proliferative assay were expressed as stimulation index = (mean test cpm/mean of medium control cpm) ± SEM. Results presented represent an average of 3–5 independent experiments. A mean SI ≥ 2 was considered positive.

Lymphocytes from spleens of S2–16 and HCM immunized rats were stimulated in vitro with overlapping synthetic peptides of the S2 fragment of HCM or the native Ag HCM, and proliferative responses were measured by tritiated thymidine incorporation. Lymphocytes from S2–16 immunized rats proliferated with a stimulation index greater than 2 in response to S2–16, S2–17, S2–22, S2–28, S2–29, S2–31, and S2–32, but not HCM, whereas lymphocytes from HCM immunized rats proliferated in the presence of S2–28, S2–29, S2–31, S2–32, and HCM (Fig. 4⇑). As a comparison, lymphocytes from RCM immunized rats proliferated to S2–10, S2–15, S2–21, S2–22, S2–27, S2–28, S2–29, S2–31, S2–32, and HCM, but not S2–16 (Fig. 4⇑). Lymphocytes from adjuvant control rats did not proliferate in response to any S2 peptides. T cells primed with intact RCM and HCM did not recognize and respond in proliferation assays to the S2–16 peptide (Fig. 4⇑), even when S2–16 was given at higher concentrations (data not shown), indicating that S2–16 is a cryptic epitope of both RCM and HCM. The definition of a cryptic epitope is an epitope not recognized by Ab or T cells of animals immunized with intact Ag (40). The immune dominant epitope of both RCM and HCM was observed in peptide S2–28/S2–29 (Fig. 4⇑). Furthermore, S2–16- and cardiac myosin-primed T cells had common S2 peptide reactivity in peptides S2–28, S2–29, S2–31, and S2–32. A similar lymphocyte proliferation response pattern was also observed at day 14 and at day 28 of disease (data not shown).

To define the Ag specificity of S2–16 sensitized T cells, a series of modified S2–16 peptides and HCM were tested in vitro for their capacity to induce proliferative responses by splenocytes from S2–16 immunized rats. Human S2–16 peptide, and rat S2–16 peptide as well as truncated S2–16d, the truncated identical sequence of rat and human S2–16, stimulated strong recall proliferative responses in an Ag dose-dependent pattern (Fig. 5⇓A). T cells primed with S2–16 did not respond well to HCM (Fig. 5⇓A) and RCM (data not shown). The three 11-mer truncated peptides tS2–16a, tS2–16b, and tS2–16c were nonstimulatory, which was consistent with the absence of pathogenicity of these 11-mer S2 peptides.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Proliferative responses of lymphocytes from spleens of Lewis rats immunized with S2–16. A, Lymphocytes were isolated from Lewis rats at 21 days after immunization with S2–16, and cultured in vitro with S2–16, rS2–16, and truncated 11-mer peptides tS2–16a, tS2–16b, tS2–16c, and tS2–16d. Ags were added to a final concentration from 0.1 μg/ml to 100 μg/ml. Results of proliferative assays were expressed as stimulation index = (mean test cpm/mean of medium control cpm) and represent averages of three independent experiments. B, MHC restriction of S2–16 response. Abs against rat MHC class II molecule RT1.B (OX-6), RTI.D (OX-17), as well as an isotype control Ab mouse IgG1 (mIgG1) were added to the cell culture when testing the recall response of splenocytes from S2–16 immunized rats (▪) and HCM immunized rats (▨). The Ags S2–16 and HCM were used respectively in the proliferative assay. The percentage of inhibition of proliferation by Ab was calculated relative to the SI without Ab addition. Data are representative of three to five experiments. Error bars represent SEMs, and Student’s t test was used to determine the significant differences between anti-RT1.B or anti-RT1.D and an isotype control Ab mouse IgG1 inhibition (∗, p ≤ 0.05; ∗∗∗, p ≤ 0.0005).

MHC restriction indicates dual recognition of S2–16 and HCM by RT1.B and RT1.D

To characterize the MHC restriction of the S2–16 specific in vitro lymphocyte response and compare it with that of HCM-induced lymphocyte response, Abs against rat MHC class II RT1.B (OX-6) and RT1. D (OX-17) loci were added into S2–16 and HCM stimulated splenocyte culture. As shown in Fig. 5⇑B, the addition of both RT1.B and RT1.D blocking Abs substantially reduced proliferation responses initiated by S2–16 as well as HCM, compared with the control mouse IgG1 Ab addition (p < 0.05). Therefore, both S2–16 peptide and HCM were presented by MHC class II RT1.B and RT1.D molecules.

Cytokine expression of S2 and HCM immunized rats

To determine the cytokine profile in S2–16-induced EAM and compare it with that of HCM-induced EAM, RT-PCR of inflammatory cytokine genes were performed by using RNA isolated from the myocardium of S2–16 and HCM immunized rats, as well as myocardium of adjuvant control rats. Marked mRNA expression of IL-6, IL-2, IL-12, IFN-γ, TNF-α, and IL-10 were detected in the maximum inflammatory phase (day 21), in the myocardium of both S2–16 and HCM immunized rats, but not in myocardium of control rats. IL-6 and IL-12 gene expression was also observed on day 14 in S2–16 and HCM immunized rats (Fig. 6⇓A). In addition, S2–16 stimulated spleen cells from S2–16 immunized rats (day 21) secreted significantly higher levels of IFN-γ (p < 0.005), IL-2, and TNF-α (p < 0.05), compared with cells from PBS/CFA only injected rats. In contrast, there was no significant difference in IL-10 production for these two groups of rats when cell culture supernatants were assayed by cytokine-specific ELISA (Fig. 6⇓B). The production of IL-4 by splenocytes from S2–16/CFA and PBS/CFA immunized rats was virtually nondetectable (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Cytokine mRNA expression in S2–16, HCM, and PBS immunized rat heart as detected by RT-PCR. A, Poly(A)⁺ RNA was extracted from hearts of each group of rats, and was reverse transcribed using oligo(dT) primers. Reverse transcriptase reaction (10%) was used in PCR to detect the presence of the indicated cytokine mRNA. Cytokine mRNA expression (lanes 1–3) in day 14 hearts of immunized rats and that of day 21 hearts (lanes 4–6) of immunized rats. Control rats (lanes 1 and 4), HCM immunized rats (lanes 2 and 5), and S2–16 immunized rats (lanes 3 and 6) are shown. Size of the amplified fragments are indicated to the right and were determined by comparison to DNA standards separated by electrophoresis on the same gel. B, Cytokine production in cell culture supernatant. Spleen cells were collected after Lewis rats were immunized with S2–16 in CFA or CFA only were sacrificed on day 21 and were cultured in the presence of medium alone or medium containing S2–16. Cytokine levels were assayed in 24 h (IL-2), or 48 h (IL-4, IL-10, TNF-α, and IFN-γ) culture supernatants by cytokine-specific ELISA. Data are representative of three independent experiments. Error bars represent SEMs, and Student’s t test was used to determine the significant differences between S2–16/CFA immunized group and CFA only injected group. ∗, p ≤ 0.05, ∗∗, p ≤ 0.005. Cytokine levels of cells cultured with medium alone were below 20% of specific response (data not shown).