Jonathan A. Hill, Thomas E. Ichim, Kornel P. Kusznieruk, Mu Li, Xuyan Huang, Xiaotao Yan, Robert Zhong, Ewa Cairns, David A. Bell, and Wei-Ping Min. Immune Modulation by Silencing IL-12 Production in Dendritic Cells Using Small Interfering RNA. The Journal of Immunology 2003; 171:691-696.
In Materials and Methods, under the subheading siRNA synthesis and transfection, two of the sequences in the second sentence are incorrect. The sentence should read as shown below.
The siRNA sequences specific for IL-12p35 (AACCUGCUGAAGACCACAGAU), IL-12p40 (AAGAUGACAUCACCUGGACCU), and IFN-γ (AACTGGCAAAAGGATGGTGAC) were synthesized and annealed by the manufacturer (Dharmacon, Lafayette, CO).
- Copyright © 2003 by The American Association of Immunologists
