High Efficiency TCR Gene Transfer into Primary Human Lymphocytes Affords Avid Recognition of Melanoma Tumor Antigen Glycoprotein 100 and Does Not Alter the Recognition of Autologous Melanoma Antigens

Cell lines

The cell lines used include: PG13 gibbon ape leukemia virus-packaging cell line (ATCC CRL 10,686), the human lymphoid cell line SupT1 (ATTC CRL-1942), and the human ecotropic packaging cell line, Phoenix Eco (kindly provided by G. Nolan, Stanford University, Stanford, CA). Cells were cultured at 37°C, 5% CO₂ in RPMI 1640 (Life Technologies-BRL, Gaithersburg, MD), in the presence of 10% FCS (Life Technologies). T2 is a lymphoblastoid cell line deficient in TAP function, whose HLA class I proteins can be easily loaded with exogenous peptides (17). HLA-A2-positive and A2-negative human melanoma cell lines expressing MART-1 and gp100 were established in the Surgery Branch from resected tumor lesions, as previously described (18). The 526 Mel (HLA-A2⁺), 624 Mel (HLA-A2⁺), 888 Mel (HLA-A2⁻), and 938 (HLA-A2⁻) lines were maintained in complete medium consisting of RPMI 1640 medium supplemented with heat-inactivated 10% FBS (Biofluids, Rockville, MD), penicillin (100 U/ml)-streptomycin (100 μm/ml), and l-glutamine (2.92 mg/ml) (Life Technologies). Cells were cultured at 37°C in a 5% CO₂ humidified incubator.

The CTL clones R6C12, CK3H6, and D4F12 are HLA-A2 restricted and gp100:209–217 specific. Their derivation has been described elsewhere (19). Briefly, PBLs from patients who had been previously vaccinated with the gp100:209–217 (210M) peptide were sensitized in vitro, then cloned by limiting dilution. The clones were expanded using a modification of the rapid expansion protocol of Riddell and Greenberg (20) with OKT3, IL-2, and irradiated allogeneic feeder cells.

Construction of TCR-containing retroviral vectors

Isolation of poly(A)⁺ RNA from R6C12 cells was accomplished using poly(A) pure mRNA purification kit (Ambion, Austin, TX). RT-PCR was used to isolate the individual α and β cDNAs while simultaneously introducing restriction enzyme sites to facilitate subsequent molecular cloning. Oligonucleotide primers used for vector APB were: (to amplify α-chain) ccaacagcggccgctgtgagcttctgc + cagaggcaagactaggctgaagagct and (to amplify β-chain) tggtctagaagcttccacatctgc + catcccaggtcgaccttcatcc. Oligonucleotide primers used for vector BIA were: (to amplify α-chain) aacagagacctgatcgagcttctgctg + cagaggcaagtgatgctgaagagct and (to amplify β-chain) tggtctagaagcttccacatctgc + catcccaggtcagaccttcatcc. The individual PCR products were inserted into the pCR2.1 vector using the TA cloning method (Invitrogen, Carlsbad, CA) to produce plasmids pCR2.1 TCR α and pCR2.1 TCR β. Following DNA sequence analysis, the individual TCR genes (TRAV19 and TRBV12–3) were inserted into two different retroviral vectors to produce GCsamgp100APB and GCsapgp100BIA (Fig. 1⇓A), as follows. The β-chain was first combined with the human phosphoglycerol kinase (PGK) promoter (in plasmid pBS-PGK) to yield pBS-PGK TCR β. The DNA fragments containing the α and the PGK-TCR β1 sequences were then inserted into retroviral vector pGCsam (21) to yield the final vector pGCsamgp100APB (APB). To produce retroviral vector BIA, the α- and β-chains were first inserted into internal ribosome entry site (IRES) vector pPBS (22) to yield the product pPBS TCR β-IRES-α. The DNA fragment containing TCR β-IRES-α was then inserted into the retroviral vector of GCsap (23) to yield the product of pGCsapgp100BIA. Generation of PG13-packaging cell clones was initiated by starting a coculture of PG13 and Phoenix Eco cells. This coculture was then transfected with 50 μg of DNA for each construct, GCsamgp100APB and GCsamgp100BIA, using the GenePorter reagent (Gene Therapy Systems, San Diego, CA). After 14 days of coculture, Phoenix Eco cells were removed from PG13 cells using magnetic bead negative selection (with anti-LYT-2; Dynal, Lake Success, NY) and PG13 cell clones obtained by limiting dilution. Clones were expanded and high titer clones were selected by the dot-blot titration method (24). As estimated by physical titer determination using RNA dot blot, both vectors had approximately the same physical titer (relative to a known titer control vector) and were estimated by this method to be ∼1 × 10⁶ CFU/ml. Clones were determined to be producing biologically active retrovirus vector by transduction of SupT1 cells and analysis of FACS data (using anti-Vβ8). Southern blot analysis was used to confirm vector integration and copy number.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

TCR expressing retroviral vectors. A, Diagrams of the two retroviral vectors used to transfer and express the TCR gene from CTL clone R6C12. In vector GCsamgp100APB (APB), expression of the α-chain is mediated by the vector LTR, while the β-chain expression is driven by an internal PGK gene promoter. In vector Gcsapgp100BIA (BIA), expression of both chains is mediated by the LTR, with translation coupled by the use of an IRES element. Location of retroviral vector-packaging signal (ψ) and splice donor (sd) and splice acceptor (sa) sites is as indicated. B, FACS histogram of CD3-reactive cells from Sup T1 cells, or Sup T1 cells transduced with the APB or BIA vectors. The percentage of positive staining cells was as indicated. C, FACS profile of Sup T1 cells double stained with anti-CD3 Ab plus gp100 tetramer. Profile of Sup T1 cells, or Sup T1 cells transduced with the APB or BIA vectors is shown with the corresponding percentage of positive cells, as indicated.

Transduction of PBL

PBL were collected by leukopheresis, and lymphocytes were separated by centrifugation on a Ficoll/Hypaque cushion, washed in HBSS, then resuspended at a concentration of 1 × 10⁶/ml in AIM-V medium (Life Technologies) supplemented with 50 ng/ml OKT3, 300 IU/ml IL-2, and 5% human AB serum (Valley Biomedical, Winchester, VA). The lymphocytes were then plated at 1×10⁶ cells/ml in 24-well plates (Costar, Cambridge, MA). The lymphocytes were cultured in vitro for 48 h before transduction. Following stimulation, lymphocytes were transduced with retroviral vectors by transfer to culture dishes that had been precoated with retroviral vectors. To coat culture plates with vector, nontissue culture-treated six-well plates (BD Labware, Franklin Lakes, NJ) were first treated with 25 μg/ml recombinant fibronectin fragment (RetroNectin; Takara, Otsu, Japan). To these plates was then added retroviral vector supernatant, and the plates were incubated at 32°C for 2 h, followed by overnight incubation at 4°C. The following day, plates were allowed to warm to room temperature, the supernatant was removed, and stimulated PBL was added to each well at 1 × 10⁶ cells/ml, 4–6 ml/well. Cells were then incubated overnight at 32°C, and the procedure was repeated the following day (total of two transductions), after which time cells were expanded at 37°C in a 5% CO₂ incubator and split as necessary to maintain cell density between 0.5 and 4 × 10⁶ cells/ml.

Cytokine release assays

PBL cultures and TIL were tested for reactivity in cytokine release assays using commercially available ELISA kits (IFN-γ, GM-CSF, IL-2 IL-4, IL-10, and TNF-α; Endogen, Cambridge, MA). Cytokine release was measured with T2 cells either alone or pulsed with peptide (2 μg/ml, or as described in figure legends) in complete medium. Peptides were incubated with T2 cells for 3 h at 37°C, followed by washing (three times) before initiation of cocultures. For these assays, 100,000 responder cells (PBL) and 100,000 stimulator cells (T2) were incubated in a 0.2-ml culture volume in individual wells of 92-well plates. In experiments in which melanoma cells served as stimulator cells, 50,000 cells were used in the same volume. Stimulator cells and responder cells were cocultured for 24 h for all cytokines, except TNF-α, which was measured after 6 h of incubation. Cytokine secretion was measured in culture supernatants diluted as to be in the linear range of the assay.

FACS analysis

Cell surface expression of TCRBV8, CD3, CD4, and CD8 molecules on PBL or TIL was measured by immunofluorescence using FITC- or PE-conjugated Abs, as directed by the supplier of anti-TCR BV8 (Immunotech, Westbrook, ME) and all others (BD Biosciences, San Jose, CA). For analysis, the relative log fluorescence of live cells was measured using a FACScan flow cytometer (BD Biosciences). For tetramer analysis, a commercially available anti-gp100 product was used (iTAg MHC Tetramer; Beckman Coulter, Fullerton, CA). Intracellular cytokine staining was performed using BD FastImmune intracellular cytokine detection kits, as directed by the manufacturer (BD Biosciences)

⁵¹Cr release assay

The ability of transduced PBL to lyse HLA-A2⁺, melanoma target cells was measured in ⁵¹Cr release assays, as described (18). Briefly, 10⁶ melanoma cells were labeled for 1 h at 37°C with 200 mCi of ⁵¹Cr (Amersham, Arlington Heights, IL). Labeled target cells (5 × 10³) were incubated with effector cells at the ratios indicated in the text for 4 h at 37°C in 0.2 ml of complete medium. Supernatants were harvested and counted using a Wallac 1470 Wizard automatic gamma counter (Wallac, Gaithersburg, MD). Total and spontaneous ⁵¹Cr release by each target was determined by incubating 5 × 10³ labeled target cells in 2% SDS or medium, respectively, for 4 h at 37°C. Each point represented the average of quadruplicate wells, and percentage of specific lysis was calculated as follows:

Vector construction and transduction of target cell line

CTL line R6C12 is a highly avid CTL clone derived from the PBL of a melanoma patient who had been vaccinated with gp100 peptide (gp100:209–217 (210M)). To obtain the optimum expression of the TCR from this clone, two different retroviral vector designs were produced (Fig. 1⇑A). In construct GCsamgp100APB (APB), the α-chain cDNA expression is mediated by transcription from the retroviral long terminal repeat (LTR), while the β-chain is driven off an internal promoter derived from the human PGK gene. Construct GCsapgp100BIA (BIA) uses the LTR to express a bicistronic RNA in which the expression of the second gene (in this case the α-chain) is governed by an IRES.

As an initial test of the TCR vectors, we transduced the human T cell line SupT1, a human T cell leukemia cell line with chromosomal translocations involving both the α and β TCR genes that prevents surface expression of the endogenous TCR complex. SupT1 cells were transduced with vectors APB and BIA and tested by Western blot analysis for expression of the Vβ8 protein, and both vector-transduced cell populations produced an appropriately sized protein (data not shown). Transduced cells were next assayed for cell surface expression of the CD3 protein. As expected from the lack of TCR α and β expression by Sup T1, untransduced cells did not stain for CD3 (Fig. 1⇑B). Significant CD3 expression was detected in vector-transduced cells (86 and 75% for APB- and BIA-engineered cells, respectively), suggesting successful assembly of the full TCR complex. To determine whether the transduced cells had the potential to recognize the gp100 peptide that was recognized by the native TCR in R6C12 cells, HLA-A2/peptide tetramer staining was performed (Fig. 1⇑C). Cells positive for both CD3 and the gp100-specific tetramer were readily detected by FACS analysis of transduced cells.

Transduction of PBL

To engineer PBL with the anti-gp100 TCR vector, we used a modification of a procedure (25) that involves precoating tissue culture plates with Retronectin (a recombinant fibronectin molecule). This method allows for high efficiency retroviral vector-mediated gene transfer, while permitting the cultured T cells to remain in the appropriate growth medium because vector supernatant is removed before transduction. PBL were obtained from two patients, one from a fresh leukopheresis (patient 1) and the other from cryopreserved cells (patient 2). T cell cultures were initiated with IL-2 plus OKT3 Ab stimulation. Transduction was performed at day 2 poststimulation, and 2 days later (4 day poststimulation), cells were stained for CD3 and Vβ8 and subjected to FACS analysis (Fig. 2⇓). The percentage of Vβ8-positive cells in the transduced cell populations ranged from 40 to 60% (background staining for Vβ8 was ∼4%). Gene transfer occurred equally in both CD4- and CD8-positive cells (data not shown). As a control for vector transduction, we transduced cells with a high titer YFP-expressing retroviral vector, and between 70 and 80% gene transfer was obtained (data not shown). The overall cell surface phenotype to the transduced cell populations at 2–3 wk poststimulation is consistent with an Ag-experienced population (CD45RO⁺) of an intermediate effector-like phenotype (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

TCR vector-transduced primary human PBL. FACS profiles of PBL from mock transduced (no vector, NV) or transduced with TCR vectors APB or BIA. Cells were double stained with anti-Vβ8 plus anti-CD3, percentage of positive cells, as indicated. A, Patient 1. B, Patient 2.

Cytokine release

To determine whether TCR vector-transduced PBL could mediate the release of effector cytokines IFN-γ and GM-CSF, coculture experiments were performed. T2 cells were pulsed with HLA-A2-specific peptides derived from the influenza virus (Flu), the MART-1:27–35 peptide, the native gp100:209–217 peptide recognized by R6C12 (gp100), or the anchor residue-modified peptide gp100:209–217 (210M). PBL cultures serving as responder cells were mock-transduced cells (no vector), control vector-transduced cells (YFP), or cultures of transduced with the anti-gp100 TCR vectors APB and BIA. As positive controls for cytokine release assay, the CTL clone R6C12 as well as a gp100-reactive TIL culture derived from melanoma patient 2 were used (Table I⇓).

The TCR-engineered T cell cultures from patient 1 (both APB- and BIA-transduced populations) secreted high levels of the IFN-γ in response to gp100 peptide-pulsed T2 cells (78,525 and 58,800 pg/ml for APB- and BIA-transduced cells, respectively) that were comparable to the R6C12 CTL clone. The amount of IFN-γ produced following exposure to T2 cells pulsed with the anchor-modified peptide was between 158,200 and 204,700 pg/ml in this assay. Similar results were obtained by analysis of GM-CSF production using PBL from melanoma patient 2 (Table I⇑). Although this patient’s cells had a higher background level of GM-CSF production, a 6-fold increase in GM-CSF production was demonstrated when TCR-engineered cells were incubated with gp100 peptide-pulsed T2 cells (∼30,000 pg/ml of GM-CSF was produced by the TCR-engineered cells). GM-CSF production of both TCR vector-engineered cell populations was comparable to a nontransduced melanoma-reactive TIL culture (this TIL also reacted to MART-1 peptide-pulsed cells). No significant differences in cytokine production were observed between mock-transduced and control vector-transduced cell populations. Analysis of other cytokines produced by the engineered PBL revealed no detectable expression of IL-4 or IL-10, with peptide-inducible low level expression of IL-2, IL-8, IL-13, RANTES, and TNF-α (data not shown). The relative avidity of the transduced PBL populations was determined by coculturing transduced cells with T2 cells pulsed with serial dilutions of the gp100 peptide (Fig. 3⇓). The engineered PBL populations were capable of releasing cytokines at peptide concentrations as low as 0.2 ng/ml, and in the case of GM-CSF, released more cytokine at the lowest dilution than did the R6C12 and melanoma TIL cultures.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Sensitivity of cytokine secretion to dilutions of gp100 peptide. Shown is the resultant cytokine secretion of TCR vector-transduced PBL exposed to T2 cells pulsed with dilutions of gp100 peptide. A and B, Data from PBL from patient 1. C and D, Data for patient 2. Samples were: no vector-transduced cells (NV), control YFP vector-transduced cells (YFP), anti-gp100 TCR vector-transduced cells APB and BIA, anti-gp100 CTL (R6C12), and antimelanoma TIL (TIL).

Distribution of cytokine-producing cells in the TCR-engineered PBL population

The data presented on cytokine release by the bulk engineered PBL populations cannot distinguish between cytokine expression evenly distributed throughout the transduced cell population or whether cytokine release is favored in a small percentage of engineered cells. We used intracellular cytokine staining followed by FACS analysis to determine the relative distribution of IFN-γ expression in the transduced cell populations (Fig. 4⇓). Transduced and control-engineered cell populations were cocultured overnight with gp100 peptide-pulsed T2 cells. Cells within the lymphocyte gate of the FACS were further gated for CD3⁺ and CD8⁺ cells, which were then analyzed for the expression of the T cell activation marker CD69 plus intracellular expression of IFN-γ. Between 19 and 22% anti-gp100 TCR-engineered cells were double positive for CD69 and intracellular IFN-γ compared with 1–2% of the control cocultures (transduced cell plus T2 pulsed with no peptide or the control Flu peptide). The distribution of staining for IFN-γ was uniform, suggesting that IFN-γ expression in the TCR gene-transduced cell populations was evenly distributed.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Intracellular cytokine staining of transduced CD8 cells. Shown are the resultant FACS histograms for control PBL from patient 1, or PBL transduced with TCR vectors APB or BIA. Cells were cocultured with T2 cells pulsed with either HLA-A2-specific influenza virus peptide (Flu) or gp100 peptide 209–217 (210M). Cells were gated for CD3- plus CD8-positive cells and then analyzed for CD69 plus intracellular IFN-γ expression. The percentage of positive cells in the gated boxes was as shown.

Recognition of melanoma cells by TCR-transduced lymphocytes

In potential clinical applications, it is essential that the TCR-engineered PBL recognize the naturally processed gp100 peptide as it is expressed on melanoma cells. To determine melanoma reactivity, two HLA-A2-positive melanoma cell lines and two non-HLA-A2 melanoma cell lines were cocultured with TCR and control vector-transduced PBL cultures from melanoma patient 2. Table II⇓ presents data on cytokine release from these T cell populations. HLA-A2-restricted IFN-γ release (in the range of 866-2528 pg/ml) was demonstrated in both APB- and BIA-engineered PBL populations, with no specific production of IFN-γ observed in the coculture with the gp100-expressing, HLA-A2-negative melanoma cell lines. The levels of cytokine production were comparable to control TIL cultures that produced 2240–2703 pg/ml of IFN-γ. Two additional effector cytokines, GM-CSF and TNF-α, were also specifically released by TCR-engineered PBL (data not shown).

We next measured lysis of melanoma cell lines by the engineered PBL from both patients in a 4-h ⁵¹Cr release assay (Fig. 5⇓). The TCR-transduced cells readily lysed the HLA-A2-positive cell lines with similar reactivity to CTL clones. There was little or no lysis observed in the non-HLA-A2 melanoma lines, and mock-transduced or control vector-transduced cell populations were nonreactive.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Lysis of melanoma cell lines. PBL from patient 1 (A and B) or 2 (C and D) were tested in a ⁵¹Cr release assay. Transduced or control PBL (see legend) were cocultured with HLA-A2-positive melanoma cell line 526 (A and C) or non-HLA-A2 888 melanoma line (B and D) that had been labeled with ⁵¹Cr. Cells were incubated at the indicated E:T ratios for 4 h, after which the percentage of lysis of the target cells was calculated. The indicated CTL lines served as controls; see text for details. Samples were: no vector-transduced cells (NV), control YFP vector-transduced cells (YFP), anti-gp100 TCR vector-transduced cells APB and BIA, and anti-gp100 CTLs (R6C12, CK3H6, and D4F12).

CD8-independent Ag recognition

Because TCR gene transfer is evenly distributed into CD8 and CD4 cells, we investigated whether transfer of the anti-gp100 TCR into CD4⁺ T cells could impart gp100 peptide-mediated reactivity to these cells. Bulk populations of transduced PBL from patient 1 were depleted of CD8 cells using magnetic beads. Cultures that had >60% CD8⁺ T cells before depletion had less than 1% remaining CD8⁺ cells using this method. The CD4⁺/CD8⁻ cultures were then cocultured with peptide-pulsed T2 cells, and IFN-γ levels were determined following 24-h incubation (Fig. 6⇓A). Peptide-specific cytokine release from the CD4⁺/CD8⁻ lymphocytes was evident in the TCR-engineered cells (APB and BIA) at a level of 1800–2245 pg/ml, with 10-fold less cytokine release observed in the control-engineered cells. These CD4⁺ cell populations had 0.3% CD8⁺ T cells at the time of assay. As a control for the potential IFN-γ production by a small number of CD8⁺ cells, 1% CD8⁺ BIA-engineered cells were spiked into mock-transduced (no vector) CD4⁺ cells and assayed. The amount of IFN-γ produced by this control population (containing 3-fold more CD8⁺ cells than the TCR-transduced CD4⁺ cells) was 3 times less (648 pg/ml) than the TCR-engineered CD4⁺ cell cultures. This result suggested that the TCR-engineered PBL could recognize gp100 peptide in a CD8-independent fashion.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Cytokine production by TCR-transduced CD4 cells. A, PBL from patient 1 were depleted for CD8 cells using magnetic beads and CD4⁺ cells cocultured with T2 cells pulsed with influenza peptide (Flu) or gp100 peptide 209–217 (210M). Twenty-four hours later, IFN-γ production was determined. B, FACS profile of PBL from patient 2 following exposure to T2 cells pulsed with gp100:209–217 (210M). Untransduced cells (control) or TCR vector-transduced cells (APB and BIA) were gated for CD3 plus CD4-positive cells and then analyzed for CD69 plus intracellular IFN-γ expression. The percentage of positive cells in the gated boxes was as shown.

To further explore the possibility that TCR-engineered CD4 cells were capable of CD8-like effector functions, we used intracellular cytokine staining for IFN-γ expression. TCR-transduced PBL gated of CD4⁺ cells and stimulated with peptide-pulsed T2 cells were then analyzed for expression of CD69 and for the intracellular expression of IFN-γ. Data obtained in this experiment (Fig. 6⇑B) demonstrate that between 10 and 11% of the APB and BIA TCR vector-engineered CD4⁺ T cells specifically produced IFN-γ in this assay compared with a background level of 2%.

Rescue of nonreactive TIL cultures

To determine whether TCR gene transfer can be used to engineer Ag-nonreactive TIL to recognize melanoma targets, we transduced three nonreactive TIL cultures with the gp100 vector and tested them in 24-h coculture assays (Fig. 7⇓). In each case, control-engineered TIL remained nonreactive to gp100 peptide-pulsed T2 cells, while the gp100-transduced cells from these three different nonreactive TIL cultures produced IFN-γ, GM-CSF, and TNF-α when cocultured with appropriately peptide-pulsed T2 cells.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Rescue of nonreactive TIL cultures. TIL cultures from three melanoma patients were tested and determined to be nonreactive to HLA-matched melanoma cell lines. TIL were transduced with control YFP vector or TCR vector APB and then cocultured with peptide-pulsed T2 cells. Shown are representative cytokine productions for each patient following coculture. Peptides used were HLA-A2-specific peptides for influenza virus (Flu) melanoma Ag MART-1 (MART) or gp100:209–217.

We next determined whether gp100 TCR gene transfer into TIL with native autologous tumor reactivity would negatively affect the autologous TIL reactivity. As seen in Table III⇓, autologous tumor reactivity was not altered (as measured by cytokine release) by anti-gp100 TCR vector transduction. These gp100 TCR gene-transduced TIL now recognized HLA-A2-matched (gp100-expressing) melanoma tumor cell lines (526 and 624), but not non-HLA-A2-matched melanoma lines (888 and 938). These data suggest that it is possible to engineer TIL to be reactive with shared melanoma Ags while not affecting pre-existing recognition of additional tumor Ags.