Detection and Induction of CTLs Specific for SYT-SSX-Derived Peptides in HLA-A24⁺ Patients with Synovial Sarcoma

Cell lines and transfectants

Cell lines used were synovial sarcoma cell lines (Fuji, HS-SY-II, and SW982), a erythroleukemia cell line (K562), a lymphoblastoid cell line transfected with HLA-A*2402 (C1R-A*2402) and HLA-A*31012 (C1R-A*31012), and a mouse lymphoma cell line transfected with a chimera gene, A*2402/K^b (RMA-S-A*2402/K^b). Fuji cells (17) were obtained from Dr. T. Nojima (Kanazawa Medical University, Kanazawa, Japan), HS-SY-II cells (18) were from Dr. H. Sonobe (Kochi Medical College, Kochi, Japan), C1R-A*2402 cells (19) and C1R-A*31012 cells (19) were from Dr. M. Takiguchi (Kumamoto University School of Medicine, Kumamoto, Japan), and RMA-S-A*2402/K^b cells (20) were from H. Takasu (Research Institution of Sumitomo Pharmaceuticals, Osaka, Japan). SW982 cells and K562 cells were purchased from American Type Culture Collection (Manassas, VA). Cells were cultured in either RPMI 1640 (Fuji, SW982, C1R-A*2402, and C1R-A*31012) or DMEM (HS-SY-II) medium supplemented with 2 mM l-glutamine, 10% FCS, 100 U/ml penicillin G, and 100 μg/ml streptomycin and were maintained at 37°C in a humidified 5% CO₂ atmosphere. Hygromycin (0.5 mg/ml) was continuously added in the culture medium for C1R-A*2402 cells and C1R-A*31012 cells.

SW982 cells were transfected with the expression vector pIRES-puro (Clontech Laboratories, Palo Alto, CA) encoding the cDNA for HLA-A24 using lipofectin reagent (Life Technologies, Rockville, MD). The cDNA for HLA-A24 was cloned from the RNA extracts of the LHK-2 lung adenocarcinoma cell line with ISOGEN reagent according to the manufacturer’s protocol (Nippon Gene, Tokyo, Japan) and was reverse transcribed by using SuperscriptII reverse transcriptase with oligo(dT) primer (Life Technologies). The incubation was conducted at 42°C for 60 min and then at 70°C for 15 min. PCR procedure with Pfu DNA polymerase was performed using the forward primer 5′-GACTCAGATGATATCCAGACGCCGAGGATGGCCGTCATG-3′ and the reverse primer 5′-CGCGGATCCGCGGCCGCAGGGAGCACAGGTCAGCGTGGGAA-3′, which are specific for the HLA-A24 gene and contain the EcoRV and BamHI restriction sites, respectively. The mixture was denatured at 98°C for 5 min, followed by 30 cycles at 98°C for 15 s, 58°C for 45 s, and 72°C for 4 min. Purified PCR products were cloned into the pIRES-puro vector and the insert was sequenced by the ABI genetic analyzer PRIM 310 using the AmpliCycle sequencing kit (PerkinElmer, Foster City, CA). Stable transfectants were selected in RPMI 1640 medium in the presence of puromycin (1 μM) and designated as SW982-A24.

Peptide synthesis

The entire sequence of SYT-SSX1 (3) and SYT-SSX2 (4) fusion genes was searched to identify regions that contain anchor motif residues required for binding to HLA-A24 class I molecules. Criteria for selection were the presence of tyrosine, phenylalanine, tryptophan, or methionine at the 2nd portion and the presence of isoleucine, phenylalanine, leucine, tryptophan, arginine, or lysine at the 9th or 10th portion (21, 22). Consequently, two regions fulfilled the criteria from which four synthetic peptides were designated (Fig. 1⇓). Two peptides designated as SS391 (PYGYDQIMPK) and SS393 (GYDQIMPKK) were derived from the breakpoint, and the remaining two peptides, SS449a (AWTHRLRER) and SS449b (AWTHRLRERK), were from an SSX region. The amino acid sequences at the SYT-SSX junctional region as well as the SSX region used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes (3, 4, 5).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Design of SYT-SSX-derived peptides. Underlined amino acids indicate HLA-A24 binding motif residues. SS391 and SS393 were derived from the breakpoint of the SYT-SSX gene and SS449a and SS449b from the SSX region. These regions were shared by SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes.

In addition to SYT-SSX-derived peptides, three peptides with an HLA-A24-binding motif were synthesized for reference: TYGPVFMSL (termed EBV), derived from EB virus latent membrane protein 2 (23); AYIDNYNKF (termed NA24), a naturally processed HLA-A24-bound peptide (22); and QFQSIYAKFF (termed R49.2), derived from Recoverin, a causative Ag of cancer-associated retinopathy (24). Also, an HLA-B31-restricted CTL epitope of gastric cancer, YSWMDISCWI (termed F4.2), was used (25). None of SYT-SSX1, SYT-SSX2, or SYT-SSX4 genes has amino acid sequences corresponding to these four peptides.

Peptide-binding assay

The peptide-binding assay was performed as described by Nakao et al. (20). RMA-S-A*2402/K^b cells were incubated at 26°C for 18 h. After washing with PBS, the cells (2 × 10⁵) were suspended with OPTI-MEM (Life Technologies), 3 μg/ml human β₂-microgloblin, and 100 μg/ml of peptides. Then the cells were incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS, the cells were incubated with an anti-HLA-A24 mAb, C7709A2.6 (a kind gift from Dr. P. G. Coulie, Université Catholique de Louvain, Brussels, Belgium) (26), at 4°C for 30 min and then with PE-conjugated goat anti-mouse IgG Ab (Cappel, Aurora, OH) at 4°C for 30 min. After washing, the cells were suspended with 1 ml of PBS containing 1% formaldehyde and were analyzed with FACScan (BD Biosciences, Mountain View, CA) using the EXPO32 program (EPICS; Beckman Coulter, Fullerton, CA). Binding activity was evaluated by the mean fluorescence intensity (MFI)³ of the HLA-A*2402 molecule of the RMA-S-A*2402/K^b cells that were pulsed with a peptide (100 μM).

Participants

This study was approved by the ethical committees of the individual participating institutions. Peripheral blood samples were collected from patients with synovial sarcoma, patients with other soft tissue malignant tumors, and normal donors after they had given informed consent. Mononuclear cells isolated from blood samples using Ficoll-Conray density gradient centrifugation were screened for the expression of HLA-A24 by RT-PCR as described above, and those defined as HLA-24-positive were subjected to the analysis. There were 16 patients with synovial sarcoma, 5 with osteosarcoma, 3 with malignant fibrous histiocytoma (MFH), 1 with Ewing’s sarcoma, 1 with liposarcoma, and 10 normal donors. Diagnosis of the tumors was made histologically. Of 16 synovial sarcomas, 10 tumors were confirmed for the presence of SYT-SSX mRNA by RT-PCR.

Tetramer construction and FACS analysis

HLA-A24/peptide tetramers were constructed according the procedure described by Altman et al. (27). To improve translation efficiency, we developed a soluble form of mutated HLA-A24 heavy chain by PCR. HLA-A24 cDNA from LHK-2 cells was used as a template of soluble HLA class I heavy chain. Forward primer was designated as 5′-CATACCATGGGCAGCCATTCTATGCGCTATTTTTCTACCTCCGT-3′. This contains an NcoI site (CATACC) followed by the start codon (ATG) at the 5′ terminus. Oligonucleotide from the 10th base represents the nucleotide sequence of HLA-A24 (73–107 from the N terminus), in which mammalian codon usage was exchanged for that of Escherichia coli: TCC, CAC, TCC, AGG, TTC, and ACA to AGC, CAT, TCT, CGC, TTT, TCT, and ACC, respectively. Reverse primer was designated as 5′-TAAAGCGGCCGC¹GGAACCACGCGGAAC CAGACGATGATTCCACACCATTTTCTGTGCATCCAGAATATGATGCAGGGATCC²TGGCTCCCATCTCAGGGTGAGGGGCTTGGGCAGACCCTC-3′. Underlines 1 and 2 encode NotI and BamHI restricted sites, respectively. Oligonucleotide from the 13th to 30th bases represents the thrombin recognition site. The bold character region encodes BirA substrate peptide that is specifically recognized by biotin-protein ligase. The last oligonucleotide sequence represents the 900-862 nucleotide sequence of HLA-A24, thus deleting the transmembrane domain.

PCR amplifications were performed according to a LA-Taq polymerase system (Takara, Tokyo, Japan) in the following conditions: starting at 95°C for 1 min for denaturation, followed by 30 cycles at 95°C for 45 s, at 40°C for 1.5 min, at 68°C for 1 min, and then at 72°C for 10 min. The amplified DNAs were gel purified, digested with NcoI/NotI, and ligated into pET21d (Novagen, Madison, WI) that had been digested with the corresponding enzymes. HLA-A24 constructs in pET21d were transformed into the BL21 (DE3) strain of E. coli. Recombinant human β₂-microgloblin was expressed in E. coli (a gift from Sumitomo Pharmaceuticals). After purification, HLA-A24 and human β₂-microgloblin were refolded with the synthesized SYT-SSX peptides. The refolded HLA-A24-peptide complexes were biotinylated by incubation for 17 h at room temperature with BirA enzyme (Avidity, Denver, CO). The biotinylated product was purified using fast protein liquid chromatography. Tetrameric HLA-peptide complexes were produced by adding streptavidin-PE (Vector Laboratories, Burlingame, CA) to achieve a 1:4 molar ratio. Four types of tetramers were constructed: HLA-A24/SS391, HLA-A24/SS393, HLA-A24/SS449a+b (the mixture of SS449a and SS449b peptides), and HLA-A24/R49.2.

For flow cytometric analysis, PBMCs were isolated from the blood samples using Ficoll-Conray density gradient centrifugation and then were stained with the appropriate PE-labeled tetramers at 37°C for 20 min and with FITC-conjugated anti-CD8 mAb (BD Biosciences) at 4°C for 30 min. Cells were washed twice with PBS before fixation in 1% formaldehyde. Analysis of stained PBMCs was performed using FACScan (BD Biosciences) and CellQuest software (BD Biosciences). The frequency of CTL precursors was calculated as the number of tetramer-positive cells divided by the number of CD8⁺ cells.

Statistical analysis

Association between increased frequency of CD8⁺ T cells to the SYT-SSX peptides and clinical parameters of 16 synovial sarcoma patients was analyzed with respect to age, gender, and the state of primary tumor, pulmonary metastasis, and chemotherapy. Patients were divided into two groups according to the frequency of CD8⁺ T cells reacting with the MHC/SYT-SSX peptide tetramers, in which those with the T cell frequency of 0.25% or more were referred to the increased group. Association with patients’ ages was statistically analyzed using the Student t test and association with gender and the state of primary tumor, pulmonary metastasis, and chemotherapy was done using Fisher’s probability test. Statistical significance was defined as p < 0.05.

In vitro CTL induction using synthetic peptides

In vitro CTL induction was performed as previously described (24, 25). PBMCs were isolated from HLA-A24⁺ synovial sarcoma patients using Ficoll-Conray density gradient centrifugation and were cultured in AIM-V medium (Life Technologies). After 24-h incubation, nonadherent cells were transferred to another culture dish and maintained in AIM-V medium (Life Technologies) with 100 U/ml rIL-2 (a gift from Takeda Pharmaceuticals, Osaka, Japan) until the next procedure. To induce APCs, the remaining adherent cells were cultured in AIM-V medium (Life Technologies) with 1000 U/ml IL-4 (Life Technologies) and 1000 U/ml GM-CSF (a gift from Novartis Pharmaceuticals, Basel, Switzerland) for 5 days, and then 10-μM peptides (the mixture of SS391 and SS393 or that of SS449a and SS449b) were pulsed for 1 day. On the next day, 10 ng/ml TNF-α (DAKO, Kyoto, Japan) and 1000 U/ml IFN-α (a gift from Sumitomo Pharmaceuticals) were added to induce maturation of the APCs. Meanwhile, CD8⁺ T cells were isolated from nonadherent cells using an anti-CD8 mAb coupled to magnetic microbeads (MACS; Miltenyi, Bergisch Gladbach, Germany). On day 7, CD8 ⁺ T cells were cocultured with the peptide-pulsed APCs. The remaining CD8⁻ PBMCs, including CD4⁺ T cells, were cultured in AIM-V with PHA (1 μg/ml) and IL-2 (100 U/ml) for 3 days and without PHA for the next 4 days. On days 14 and 21, the responding CD8 ⁺ T cells were restimulated with PHA-activated CD8⁻ PBMCs that had been pulsed with the peptides for 2 h and irradiated with 5000 rad. The cytotoxic activity of the responder cells was evaluated on day 28.

Cytotoxicity assay

The cytotoxic activity of stimulated CD8 ⁺ T cells was measured using a conventional ⁵¹Cr release assay (24, 25). Cell lines used as targets were Fuji, HS-SY-II, SW982-A24, K562, C1R-A*2402, and C1R-A*31012. The target cells were labeled with 100 μCi of ⁵¹Cr for 1 h at 37°C. The peptide-pulsed targets, C1R-A*2402 cells and C1R-A*31012 cells, were prepared by incubating the cells with 10-μM peptides (the mixture of SS391 and SS393, that of SS449a and SS449b, or a control peptide) overnight at 37°C and then labeling with ⁵¹Cr. The stimulated CD8 ⁺ T cells were mixed with the labeled target cells in the well at a concentration of 5 × 10³ cells/well. After a 4-h incubation period at 37°C, the release of the ⁵¹Cr label was measured by collecting the supernatant, followed by quantification in an automated gamma counter. The percentage of specific cytotoxicity was calculated as the percentage of specific ⁵¹Cr release: [day(experimental ⁵¹Cr release − spontaneous ⁵¹Cr release)/(maximum ⁵¹Cr release − spontaneous ⁵¹Cr release) ] × 100.

Detection of SYT-SSX and HLA-A24 mRNAs

Expression of SYT-SSX, SSX, and HLA-A*2402 mRNAs in cell lines was determined using RT-PCR. Briefly, total RNA was isolated from 1 × 10⁷ cells with ISOGEN. The first-strand cDNAs were synthesized with 1 μg of total RNA by using the Superscript Preamplification System (Life Technologies). Target cDNAs were amplified by PCR with KOD Dash polymerase (Toyobo, Osaka, Japan) and gene-specific primer pairs for SYT-SSX (forward primer, 5′-CAACAGCAAGATGCATACCA-3′; reverse primer, 5′-CACTTGCTATGCACCTGATG-3′), SSX1 (forward primer, 5′-CTAAAGCATCAGAGAAGAGAAGC-3′; reverse primer, 5′-AGATCTCTTATTAATCTTCTCAGAAA-3′), SSX2 (forward primer, 5′-GTGCTCAAATACCAGAGAAGATC-3′; reverse primer, 5′-TTTTGGGTCCAGATCTCTCGTG-3′), and HLA-A24 (forward primer, 5′-GGCCGGAGTATTGGGACGA-3′; reverse primer, 5′-CCAAGAGCGCAGGTCCTCT-3′). The conditions for PCR amplification were as follows: 3 min at 94°C, 30 cycles of 30 s at 94°C, 5 s at 55°C, and 1 min at 72°C, followed by an extension for 5 min at 72°C. Reaction products were analyzed by electrophoresis in 1.0% agarose gels with ethidium bromide.

Generation of synthetic peptides from SYT-SSX fusion genes

To investigate the immunogenic property of peptides derived from the synovial sarcoma-specific SYT-SSX fusion gene, we searched the entire sequence of SYT-SSX1 and SYT-SSX2 genes for identifying regions that contain anchor motif residues required for binding to HLA-A24 class I molecules. Consequently, we defined two regions, from which four peptides were synthesized (Fig. 1⇑). Two peptides designated as SS391 and SS393 were derived from the breakpoint, and the remaining two peptides, SS449a and SS449b, were from the SSX region. The amino acid sequences at the SYT-SSX junctional region as well as the SSX region used to designate peptides were conserved in SYT-SSX1, SYT-SSX2, and SYT-SSX4 genes (3, 4, 5).

Binding activity of SYT-SSX peptides to the HLA-A*2402 molecule

We first evaluated the binding activity of these SYT-SSX-derived peptides to HLA-A*2402 molecules. In this assay, MFI of HLA-A*2402 molecules on RMA-S-A*2402/K^b cells after peptide pulsation, which reflected the property of peptides to stabilize HLA-A*2402 molecules on the cell surface, was regarded as the binding activity. As shown in Fig. 2⇓, RMA-S-A*2402/K^b cells that had been pulsed with EBV peptide or NA24 peptide (both having an HLA-A24-binding motif) showed substantially high MFI of HLA-A*2402 molecules (1.15 and 1.55, respectively). In contrast, pulsation of F4.2 peptide that has binding activity to HLA-B*31012 but not HLA-A*2402 molecules resulted in MFI of 0.1. Among the SYT-SSX-derived peptides, pulsation of SS393 led to the highest MFI (0.8), whereas the other three peptides showed relatively low MFI (SS391, 0.15; SS449a, 0.2; and SS449b, 0.1).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Binding activity of SYT-SSX-derived peptides to the HLA-A*2402 molecule. Binding activity of SYT-SSX peptides to HLA-A*2402 molecules was evaluated by the MFI of the HLA-A*2402 molecule of the RMA-S-A*2402/K^b cells that were pulsed with a peptide. Peptides EBV and NA24 were used for positive controls, and F4.2 peptide was used for a negative control.

Frequency of SYT-SSX peptide-specific CTL precursors in HLA-A24⁺ PBMCs

We analyzed the frequency of the CTL precursor (CTLp) specific for these SYT-SSX-derived peptides in PBMCs using MHC/peptide tetramers (HLA-A24/SS391 tetramer, HLA-A24/SS393 tetramer, and HLA-A24/SS449a+b tetramer). To determine the baseline level of CTLp frequency, we analyzed PBMCs of 10 patients with osteosarcoma, MFH, Ewing’s sarcoma, and liposarcoma (Table I⇓). The average number and SD of the frequency of CTLps for SS391, SS393, and SS449a+b in these patients were 0.11 ± 0.09. Accordingly, the frequency of 0.25% or higher was determined as significantly high (Fig. 3⇓). Such high CTLp frequency of CTLp was observed for SS391 and SS393 peptides in a patient with Ewing’s sarcoma, whereas none of these 10 sarcoma patients showed CTLp frequency of 0.25% or higher for SS449a+b peptides.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Average frequency of CTLps reacting with SYT-SSX-derived peptides. The frequency of CTLps was determined as the number of tetramer-positive cells divided by the number of CD8⁺ cells, and the average frequency and SD were calculated for each group.

Subsequently, we analyzed HLA-A24⁺ PBMCs of 10 healthy donors (Table II⇓) and 16 synovial sarcoma patients (Table III⇓). As shown in Table II⇓, none of the 10 healthy donors showed high CTLp frequency of 0.25% or higher for SYT-SSX peptides. In contrast, high CTLps for SS393 peptide were detected in 6 of the 16 synovial sarcoma patients (Table III⇓). Of these six patients, four also showed high CTLp frequency for SS391 peptide and two patients showed high CTLp frequency for SS499a+b peptides. The specificity of CTLp for the SYT-SSX sequence was examined using HLA-A24/Recoverin peptide (R49.2) tetramer. None of the three patients examined (cases 3, 6, and 10) showed high CTLp frequency to the R49.2 peptide (Table III⇓ and Fig. 4⇓). Moreover, in vitro peptide stimulation procedures that had been repeated three times further increased the frequency of CTLp. As shown in Fig. 5⇓ (case 3), CTLp frequency to the SS391 and SS393 peptide tetramers increased from 0.40 to 1.17% and from 0.34 to 1.14%, respectively, after a three-time stimulation with the mixture of SS391 and SS393 peptides. These increases were specific to the peptides used because this procedure did not increase the CTLp frequency to SS449a+b peptide tetramer. Likewise, stimulation with the mixture of SS499a+b peptide increased the CTLp frequency to SS449a+b tetramer from 0.18 to 2.28%, but it did not increase the frequency to the SS391 or SS393 peptide tetramers. Also, there was association between CTLp frequency and successful induction of CTLs. Two patients (cases 1 and 3) from whom CTLs had been inducible had a CTLp frequency of 0.25 or more for SYT-SSX peptides, whereas the remaining two patients (cases 12 and 14) did not show such high CTLp frequency.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

A case presentation of CTL precursors that react with SYT-SSX-derived peptides. PBMCs from a synovial sarcoma patient (case 3) were stained with HLA-A24/peptide tetramer and FITC-conjugated anti-CD8 mAb. Tetramer staining intensity is shown on the y-axis and anti-CD8 staining is shown on the x-axis. The number in the top right quadrant indicates the percentage of HLA-A24/peptide tetramer-positive cells in CD8⁺ cells.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Increased frequency of CTLps after in vitro three-time stimulation with SYT-SSX-derived peptides. PBMCs from a synovial sarcoma patient (case 3) were stimulated three times weekly with the peptide mixture of SS391 + SS393 or with the peptide mixture of SS449a+b. Stimulated T cells were stained with HLA-A24/SYT-SSX peptide tetramers and FITC-conjugated anti-CD8 mAb. Tetramer staining intensity is shown on the y-axis and anti-CD8 staining is shown on the x-axis. The number in the top right quadrant indicates the percentage of HLA-A24/peptide tetramer-positive cells in CD8⁺ cells.

We assessed association between reactivity of CTLp to the SYT-SSX peptides and the clinical features of synovial sarcoma patients. Notably, all of the six patients showing high CTLp frequency to the SYT-SSX peptides had either a present or past history of pulmonary metastasis. There were three patients (cases 4, 5, and 9) who had a history of pulmonary metastasis but did not show high CTLp frequency. Of these three patients, two had undergone chemotherapy and one was receiving chemotherapy at the time the blood sample was taken. High CTLp frequency for SYT-SSX peptides was detected in all of the three patients with untreated pulmonary metastasis (cases 1, 2, and 3). Statistical analysis revealed the significant association of the increased CTLp frequency to the SYT-SSX peptides with development of pulmonary metastasis (p < 0.03), but not with age, gender, the state of primary tumor, or chemotherapy.

Induction of CTLs from HLA-A24⁺ synovial sarcoma patients

To determine whether HLA-A24-restricted SYT-SSX-specific CTLs can be induced by these synthetic peptides, we conducted CTL assays using peripheral blood from four HLA-A24⁺ synovial sarcoma patients (cases 1, 3, 12, and 14 in Table III⇑). We pulsed APCs derived from PBMCs of these patients with the peptide mixture of SS391 + SS393 or SS449a+b and subsequently mixed them with T cells. Such T cell stimulation was done three times every week. Cytotoxicity assays were then conducted against target C1R-A*2402 cells pulsed with those peptides and an irrelevant control peptide, NA24. CTLs were successfully induced from PBMCs of two synovial sarcoma patients (cases 1 and 3). As shown in Fig. 6⇓A (case 3), CTLs induced with the SS391 + SS393 peptide mixture lysed C1R-A*2402 cells that had been pulsed with SS391 or SS393 but not with those with a control NA24 peptide or K562 cells. In contrast, cytotoxicity was no longer elicited against C1R-A*31012 cells, despite stimulation and pulsation with SS391 and SS393 peptides. Similarly, CTLs induced with SS449a+b mixture showed cytotoxicity to C1R-A*2402 cells that had been pulsed with SS449a or SS449b (Fig. 6⇓B). In the other patient (case 1), CTLs induced with the SS391 + SS393 peptide mixture lysed C1R-A*2402 cells with peptide specificity (Fig. 7⇓), whereas stimulation with the SS499a+b peptide mixture failed to elicit such peptide-specific cytotoxicity.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Peptide-specific and MHC-restricted CTLs induced from a synovial sarcoma patient (case 3) upon stimulation with SYT-SSX-derived peptides. CTLs were induced from PBMCs of a synovial sarcoma patient (case 3) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against targets C1R-A*2402 or CIR-A*31012, which had been pulsed with corresponding peptides or NA24 control peptide. K562 cells that lack class I molecules were also used as a control.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Peptide-specific CTLs induced from another synovial sarcoma patient (case 1). CTLs were induced from PBMCs of a synovial sarcoma patient (case 1) using the peptide mixture of SS391 + SS393. Cytotoxicity assays were conducted against target C1R-A*2402, which had been pulsed with corresponding peptides or NA24 control peptide.

We next conducted CTL assays against synovial sarcoma cell lines. Before CTL assays, we determined the expression profiles of HLA-A24, SYT-SSX, and SSX genes (Table IV⇓). RT-PCR yielded the amplified products of HLA-A24 mRNA from Fuji, HS-SY-II, SW982-A24, and C1R-A*2402 cells and SYT-SSX mRNA from Fuji and HS-SY-II cells, as previously shown in the original papers (17, 18). SSX mRNA was detected in SW982-A24 cells. As shown in Fig. 8⇓A, CTLs induced from a synovial sarcoma patient (case 3) with the peptide mixture of SS391 + SS393 lysed synovial sarcoma cell lines, Fuji, and HS-SY-II. On the contrary, no such cytotoxic activity was observed against K562 cells or SW982-A24 synovial sarcoma cells that lacked SYT-SSX. CTLs induced with SS499a+b mixture lysed SW982-A24 cells (Fig. 8⇓B). Although Fuji cells and HS-SY-II cells were confirmed to express SSX mRNA at levels similar to those of SW982-A24 cells (data not shown), no apparent cytotoxicity was observed against these cells. Likewise, CTLs induced from the case 1 synovial sarcoma patient with the peptide mixture of SS391 + SS393 lysed Fuji cells (Fig. 9⇓A), whereas those induced with the SS449a+b mixture showed no apparent cytotoxic activity against Fuji cells (Fig. 9⇓B).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 8.

Cytotoxicity of CTLs against synovial sarcoma cell lines (case 3). CTLs were induced from PBMCs of a synovial sarcoma patient (case 3) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against synovial sarcoma cell lines, Fuji (•) and HS-SY-II (○), which express SYT-SSX gene and SW982-A24 cells (▪) that express the SSX gene but not SYT-SSX. K562 cells (□) were used as control.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 9.

Cytotoxicity of CTLs against synovial sarcoma cell lines (case 1). CTLs were induced from PBMCs of a synovial sarcoma patient (case 1) using the peptide mixture of SS391 + SS393 (A) and the mixture of SS449a+SS449b (B). Cytotoxicity assays were conducted against Fuji cells (•) and K562 cells (▪).