NF-κB Regulates the Expression of the Human Complement Receptor 2 Gene

Cell cultures

Raji cells and CA46 cells were obtained from the American Type Culture Collection (Manassas, VA). Peripheral blood B cells were obtained from normal donors by magnetic separation using a negative selection strategy, as suggested by the manufacturer (Miltenyi Biotec, Bergisch Gladbach, Germany). We routinely obtained cell populations with 95% or more primary B cells, as assessed by staining for CD19, followed by flow cytometry. All cells were cultured in RPMI 1640 (Life Technologies, Gaithersburg, MD) containing 10% FBS (Life Technologies), 2 μM l-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 25 mM HEPES.

Truncated and mutated CR2 promoter constructs

The SP65-CAT plasmid containing the human CR2 promoter from −1252 to +75 was the gift of Dr. M. Holers, Denver, CO. Truncated CR2 promoter constructs were generated by PCR, as described previously (16). PCR-based mutagenesis was used with primers containing three to seven mutated nucleotides to introduce mutations into potential transcription factor binding sites (Table I⇓), as described (16). The sequences of all constructs were confirmed by DNA sequence analysis.

DNA transfection and reporter gene analysis

For B cell lines, plasmid DNA was introduced into cells by the DEAE-dextran method (25). Reporter plasmid (6 μg) and p50 or p65 expression plasmid (10 μg; gift of Dr. J. Hiscott, Montreal, Canada (26)) was used per 10⁷ cells. The integrity of the p50 and p65 expression vectors were verified after transfection by Western blotting (data not shown). After transfection, 5 × 10⁶ cells per sample in 5 ml medium were cultured for 44–48 h; then freeze-thaw lysates were assayed for chloramphenicol acetyltransferase (CAT) activity by TLC, as described (27). Data were analyzed with a Molecular Imager FX System and Quantity One software (Bio-Rad Laboratories, Hercules, CA).

Unstimulated primary human B cells were transfected immediately after purification, using the Human B Cell Nucleofector Kit and Nucleofector of Amaxa Biosystems (Cologne, Germany), as suggested by the manufacturer. For transfection, we used 8 μg reporter plasmid per 5 × 10⁶ cells, or 5 μg reporter plasmid and 3 μg p50 or p65 expression plasmid per 5 × 10⁶ cells, in a total volume of 100 μl. After transfection, 2.5 × 10⁶ cells per sample in 2 ml medium were stimulated with 10 μg/ml LPS (Sigma-Aldrich, St. Louis, MO; from Escherichia coli 0111:B4) or 100 ng/ml PMA (Sigma-Aldrich), then cultured for 15 h, and assayed for CAT activity.

EMSA

Nuclear proteins were obtained as described (28). Double-stranded oligonucleotides (Table I⇑) were end-labeled with [γ-³²P]ATP, purified on Centri-Sep columns (Princeton Separations, Adelphia, NJ), and used as probes in EMSA.

EMSA were performed using 4 μg of nuclear protein and 20 fmol of labeled oligonucleotide per sample, as described (17). In supershift experiments, the following Ab (3 μg per sample) were used: anti-p50, anti-p65, anti-c-Rel, anti-RelB, anti-p52, anti-Jun, and anti-ATF-1 (all from Santa Cruz Biotechnology, Santa Cruz, CA); anti-regulatory factor X5 (RFX5) (Rockland, Gilbertsville, PA); and anti-hnRNP D/AUF1 (Upstate Biotechnology, Lake Placid, NY). Ab were added to nuclear extracts just before the addition of the labeled oligonucleotide and then incubated for 30–40 min at room temperature.

Chromatin immunoprecipitation (ChIP)

Soluble chromatin was prepared as described (29), with several modifications. Live cells were fixed with 1% formaldehyde at 37°C for 10 min. The fixed cells were washed twice with cold PBS and then lysed in 50 mM Tris (pH 8.1), 10 mM EDTA, 1% SDS, 1 mM PMSF, 0.5 μM leupeptin, and 1 μg/ml aprotinin for 10 min on ice. The samples were subsequently sonicated on ice for 5 × 10 s using continuous output and setting 4. The sonicated samples were centrifuged at 13,000 rpm for 10 min, and the supernatant was diluted 10-fold in dilution buffer (167 mM NaCl, 16.7 mM Tris (pH 8.1), 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 1 mM PMSF, 1 μg/ml aprotinin, and 0.5 μM leupeptin) and filtered through a 45-μm pore size filter to remove remaining aggregates. Extracts obtained from 5 × 10⁶ cells per immunoprecipitation reaction was precleared for 0.5 h with Protein A/G PLUS-agarose that had been incubated overnight with 0.1 mg/ml sonicated salmon sperm DNA. The precleared samples were immunoprecipitated with 1 μg Ab at 4°C overnight; then the immune complexes were recovered by adding 40 μl of protein A/G PLUS-agarose, which had been treated with sonicated salmon sperm DNA, for 1 h. Precipitates were subsequently washed five times by rotating the samples for 6 min each with wash buffer 1 (150 mM NaCl, 20 mM Tris (pH 8.1), 2 mM EDTA, 0.1% SDS, and 1% Triton X-100), once for 6 min with wash buffer 2 (250 mM LiCl, 10 mM Tris (pH 8.0), 1 mM EDTA, 0.5% Nonidet P-40, and 0.5% sodium deoxycholate), and twice for 6 min with wash buffer 3 (10 mM Tris (pH 8.0), 1 mM EDTA). The samples were subsequently digested with 0.5 mg/ml proteinase K in 100 μl wash buffer 3 with 0.5% SDS at 37°C for 4 h. The cross-links were reversed by heating the samples at 65°C overnight. The samples were briefly centrifuged, and the DNA was recovered from the supernatant by phenol-chloroform extraction and ethanol precipitation. The purified DNA was run on 2% agarose gel, the 150- to 350-bp fraction was excised, and the DNA was recovered, as suggested for ChIP assay (30). One-fifth (10 μl) of the recovered DNA was used per PCR. The following primers were used in PCR: TCCCAGTTAACCCTTCAGAT and TGTCCTCAGCATTTTGGTATT to amplify the −1198/−944 segment of the CR2 promoter; GAGAAAGAATAGAGAATGGTAAAG and CTCCCAGTTTGAAAAAGCAGT to amplify the −596/−399 segment; and CCGCAACGAGGGGTGAGTCTGA and TCTGGGAGGGCAAGGCTGGAG to amplify the −148/+71 segment.

Flow cytometry

Freshly purified primary B cells (0.17 × 10⁶ cells in 0.3 ml medium per sample) were stimulated with 10 μg/ml LPS for 2.5 h or left unstimulated. Cells were stained with an anti-CD21-PE Ab (BD Biosciences, San Jose, CA) using standard protocols, and analyzed by flow cytometry.

The −57/+75 segment of the CR2 promoter is active in Raji B cells

To determine which segment(s) of the CR2 promoter are active in unstimulated B cells, we generated a series of sequentially truncated CR2 promoter constructs that drive CAT reporter genes. Raji B cells, a mature B cell line that highly expresses CR2 on its surface, were transfected with the reporter constructs, and the CAT activities were determined 2 days later. We found that truncation of sequences from −1252 to −57 did not have a significant effect on promoter activity (Fig. 1⇓A). Thus, the −57/+75 construct displayed activity similar to that of the −1252/+75 full promoter. These findings clearly suggest that critical positive promoter elements are present in the −57/+75 region, which contains potential the CREB/AP-1 half-site, X box, and E box. These findings do not exclude the possibility that promoter elements upstream of −57 play a role in regulating CR2 promoter activity. The truncation approach may not, for example, reveal pairs of activator and repressor elements that cancel out each other and were removed in one truncation step.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Deletion and mutation analysis of the human CR2 promoter in functional reporter gene assays reveal DNA motifs that are important for activity. Raji B cells were transiently transfected with CAT reporter plasmids driven by truncated (A), internally deleted (B), or mutagenized (C) (Table I⇑) CR2 promoter constructs, as indicated. In all numbering, the transcription initiation site is considered +1. Cells were assayed for CAT activity 44–48 h after transfection. A not-to-scale draft of the CR2 promoter denotes predicted (42 ) and known (17 ) transcription factor-binding sites; all CREB/AP-1 sites are half-sites. Values represent percent of CAT activity, considering the activity of the empty vector zero and the activity of the full length wild-type promoter 100%. Means ± SEM are shown (n = 4–8). All samples are compared with the full length wild-type CR2 promoter. ∗, p < 0.05, and ∗∗, p < 0.01, using an one-way ANOVA.

The −951/−65 segment of the CR2 promoter is involved in sustaining activity

To extend the above analysis and determine whether regulatory elements that participate in sustaining the activity of the CR2 promoter lie outside the −57/+75 region, but were not identified by truncation experiments, we internally deleted nucleotides −951 to −65 from the full promoter (construct Δ−951/−65). We found that removal of this nearly 900-nucleotide segment greatly decreased the promoter activity down to 11% (Fig. 1⇑B). This suggests that promoter elements within the −951/−65 region affect promoter activity.

Overall, the data that we present in Fig. 1⇑, A and B, indicate the complexity of the transcriptional regulation of the CR2 promoter. A possible explanation that could resolve the apparent contradiction between the results of the truncation and internal deletion experiments is that the internal deletion perturbed the functional connections between transcription factors that bind inside and outside the removed promoter segment. Alternatively, the positioning of upstream (−1252/−952) promoter elements next to TATA box proximal elements may have produced novel functional protein connections that resulted in reduced promoter activity.

Identification of promoter elements that regulate the expression of the CR2 promoter

To identify distinct regulatory elements in the CR2 promoter, we mutagenized several predicted transcription factor-binding sites. Within the −951/−65 promoter region, mutation of a consensus NF-κB site (Table I⇑, mutation 1) reduced promoter activity to ∼50% (Fig. 1⇑C), suggesting that transcription factor(s) that bind to this promoter element increase promoter activity. Mutation of an hnRNP D site (17) (mutation 2) resulted in ∼2-fold increase in promoter activity, implying that hnRNP D binding to this site reduces promoter activity. Mutation of a consensus AP-2 site (mutation 3) or mutation of all three elements in the same construct (mutation 4) did not affect CR2 promoter activity. The latter observation could be explained by the opposing effects of the NF-κB and hnRNP D sites on CR2 promoter activity.

Within the −57/+75 region, mutation of a predicted CREB/AP-1 half-site (one-half of the palindromic octamer core motif) (mutation 5) had no effect on promoter activity (Fig. 1⇑C). In contrast, mutation of the predicted overlapping X box and E box (mutation 6) reduced promoter activity by 72%. To assess the possible functional interaction of the CREB/AP-1 and X box/E box regulatory elements, we mutated both elements simultaneously (mutation 7). This double mutation did not reduce further the activity of the CR2 promoter over that already observed with mutation 6, indicating that the CREB/AP-1 half-site does not play a role in regulating basal CR2 promoter activity in Raji cells.

Identification of transcription factors that bind to functionally relevant DNA sites along the CR2 promoter

To identify proteins that bind to regulatory elements that were found by mutagenesis experiments to be functionally important, we performed shift assays. For each binding site, we performed experiments using either wild-type or mutated synthetic oligonucleotides defined by the CR2 promoter (Table I⇑) and nuclear proteins extracted from Raji cells or primary human B cells. The mutations were the same as those used in the reporter experiments. Abs were also used in EMSA to detect the presence of candidate proteins.

Incubation of the −531/−509 oligonucleotide containing the predicted NF-κB site produced three or two shifted bands using Raji or primary B cell nuclear extracts, respectively (Fig. 2⇓, A and B). Excess unlabeled nonmutated oligonucleotide competed all protein-DNA complexes efficiently, indicating that all proteins bind to the −531/−509 oligonucleotide specifically. By using Raji cell nuclear extracts, we found that mutation of five nucleotides, which are part of the consensus NF-κB motif, abolished the formation of bands 1 and 2 but allowed formation of band 3, indicating that the mutated nucleotides affected interaction with proteins present in bands 1 and 2 but not in band 3 (Fig. 2⇓A, right sample). Both NF-κB p50 and p65 Ab strongly interfered with the formation of band 2, using nuclear extracts of both cell types, indicating that it is composed of the p50 and p65 subunits of NF-κB. We have not yet identified the proteins present in bands 1 and 3. c-Rel, Rel B, or p52-specific Ab had no effect on any of the protein-DNA complexes, indicating that these additional NF-κB family members do not bind.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

EMSA analysis of functionally important promoter elements demonstrates the interaction of several transcription factors. Nuclear extracts of Raji cells (A, C, E) or primary human B cells (B, D, F) were incubated with labeled wild-type or mutated (Mut) oligonucleotides, as indicated above each panel (see also Table I⇑), and analyzed by EMSA. In competition studies, 10-, 50-, or 100-fold molar excesses of unlabeled (cold) nonmutated oligonucleotides (oligo) were included in the reaction. In supershift assays, Abs specific for NF-κB p50, p65, c-Rel, RelB, p52, Jun, ATF1, hnRNP D, or RFX5 were included in the reaction. Arrows indicate the positions of the shifted and supershifted (ss) bands.

Incubation of the −495/−468 oligonucleotide containing the hnRNP D site produced one shifted band using both Raji and primary B cell nuclear extracts (Fig. 2⇑, C and D). Anti-hnRNP D Ab decreased the intensity of the shifted band, indicating that hnRNP D binds to the −495/−468 oligonucleotide.

Incubation of the −54/−32 oligonucleotide produced three or one shifted bands using Raji or primary B cell nuclear extracts, respectively (Fig. 2⇑, E and F). By using Raji cell nuclear extracts, we found that mutation of five central nucleotides abolished the formation of bands 1 and 2, but allowed formation of band 3, indicating that the mutated nucleotides only affect interaction with proteins present in bands 1 and 2. Nevertheless, we found by using excess unlabeled nonmutated oligonucleotide that all protein-DNA complexes were specific. Addition of an Ab specific for RFX5, which was shown to bind X boxes in promoters of MHC class II genes (31), diminished the intensity of band 2 (Fig. 2⇑E), indicating that RFX5 is present in the complex. Jun or ATF1 Ab, which we used as controls, did not alter the appearance of any of the bands. Unexpectedly, using nuclear extracts of both Raji and primary B cells, NF-κB p65 Ab interfered with the formation of band 1, whereas using Raji cell extracts p50 Ab resulted in disappearance of band 2, indicating that both the p50 and p65 subunits of NF-κB can bind to the −54/−32 oligonucleotide, in distinct protein complexes. Because the −54/−32 oligonucleotide does not define a recognized NF-κB-like site we speculate that NF-κB components may bind to this oligonucleotide indirectly through another DNA-binding protein.

Finally, the −64/−45 oligonucleotide containing a potential CREB/AP-1 half-site produced no shifted complexes in EMSA (data not shown), supporting the results of the reporter gene experiments where we found that mutagenesis of the CREB/AP-1 site did not alter promoter activity.

Overexpression of NF-κB p50 increases the transcriptional activity of the CR2 promoter

The mutagenesis and EMSA experiments suggested that NF-κB could play a role in regulating the activity of the CR2 promoter. To examine the functional role of NF-κB proteins in the transcriptional regulation of CR2 expression, we overexpressed p50 and p65 in Raji B cells and monitored the activity of the CR2 promoter that was cotransfected. Overexpression of p50 increased transcriptional activity of the wild-type CR2 promoter by ∼2-fold, whereas p65 increased it by ∼25% (Fig. 3⇓A). When the consensus NF-κB element was mutated in the promoter (mutation 1), overexpression of p50 or p65 failed to induce promoter activity. Similarly, mutation of the X box/E box (mutation 6), which also interacted with NF-κB in EMSA, rendered the CR2 promoter nonresponsive to p50 and p65. These results suggest that one or both of the NF-κB interaction sites are required for the promoter to respond to p50 and p65. However, both promoter sites that we mutagenized also interacted with proteins other than NF-κB in EMSA (Fig. 2⇑). Thus, it is possible that loss of binding of non-NF-κB proteins contribute to the observed disappearance of NF-κB responsiveness in the mutagenized promoter constructs.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

NF-κB regulates the activity of the human CR2 promoter. Raji cells (A), CA46 cells (B), or primary human B cells (C) were transiently cotransfected with CAT reporter plasmids driven by wild-type (WT) or mutagenized (MUT) (see Table I⇑) CR2 promoter, and NF-κB p50 or p65 expression plasmids or a control (abbreviated as C) plasmid. Cells were assayed for CAT activity 44–48 (A and B) or 15 (C) h after transfection. Values represent percentage of CAT activity, considering the activity of the empty vector zero and the activity of the wild-type CR2 promoter 100%. Means ± SEM are shown (n = 3–10). p50- and p65-transfected samples are compared with the control plasmid-transfected sample within groups transfected with the same reporter plasmid. ∗, p < 0.05, and ∗∗, p < 0.01, using ANOVA.

We also overexpressed p50 and p65 in the EBNA2-negative mature B cell line CA46. We found that overexpression of p50 increased the transcriptional activity of the wild-type CR2 promoter ∼2-fold (Fig. 3⇑B), similarly to what we found in Raji cells. When the consensus NF-κB element was mutated in the promoter, p50 failed to induce promoter activity. These findings strongly argue for a direct role of p50 in regulating CR2 promoter activity through the consensus NF-κB element. Overexpression of p65 inhibited the activity of the wild-type CR2 promoter in CA46 cells (Fig. 3⇑B). The inhibition by p65 was not dependent on the consensus NF-κB element, because the CR2 promoter with the consensus NF-κB site mutated was still subject to inhibition. Thus, in CA46 cells p50 and p65 have opposing effects on CR2 promoter activity, and only p50 seems to operate through the consensus NF-κB element.

We overexpressed p50 and p65 in resting primary B cells using a novel transfection protocol, to establish the role of NF-κB proteins in the regulation of the CR2 promoter activity in primary B cells. Overexpression of p50 enhanced the activity of the cotransfected wild-type CR2 promoter by ∼3.5-fold, whereas p65 increased it by 60% (Fig. 3⇑C).

ChIP assays reveal that NF-κB targets the genomic CR2 promoter in live Raji and primary B cells

To study whether NF-κB targeted the genomic CR2 promoter in vivo we performed ChIP assays (29). In addition to Raji cells, we studied primary human B cells. Live Raji or primary B cells were fixed with formaldehyde to produce covalent bonds between proteins and DNA that are in close proximity; then the cells were lysed, and the DNA was fragmented by sonication. The soluble, fragmented chromatin was immunoprecipitated with Abs specific to NF-κB p50, p65, or c-Rel under stringent conditions. As a control, we used an actin-specific Ab or no Ab. The cross-links were reversed, and the precipitated DNA recovered. We used only the 150- to 350-bp fractions of the recovered DNA in PCR to ensure that the desired resolution power of 350 bp was reached. We used three PCR primer pairs to test the presence of the corresponding genomic DNA fragments in the same immunoprecipitated samples. PCR primer pairs B and C (as marked in Fig. 4⇓) were designed to amplify segments of the promoter that were suspected to bind NF-κB. PCR primer pair A was chosen as an internal control because NF-κB was not expected to bind there. The location of the PCR primers and the 350-bp resolution were planned so that any given immunoprecipitated DNA fragment could be amplified by only one of the three primer pairs.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

NF-κB targets the genomic CR2 promoter in live B cells. Top, schematic representation of the human CR2 gene promoter region from −1250 to +75, relative to the transcription start site. Suspected NF-κB interaction sites are marked by objects. The positions of primer sets A, B, and C are indicated by inverted arrows. Raji B cells (A) or primary human B cells (B) were cross-linked with 1% formaldehyde. Soluble, fragmented chromatin was immunoprecipitated with Abs, as indicated above the samples. Specifically, the cells were lysed, and the DNA was fragmented by sonication. The lysates (from 5 × 10⁶ cells per immunoprecipitation) were immunoprecipitated with 1 μg of Ab specific to NF-κB p50, p65, or c-Rel or to actin. DNA was purified then size fractionated on agarose gel. DNA 150–350 bp long were cut out from the gel and recovered, and one-fifth of the sample was used in each PCR as template. The input contained fragmented DNA from prior immunoprecipitation reactions. All three PCR produced a single amplified product with the expected size (data not shown).

Using Raji cells, we found that Abs specific for both NF-κB p50 and p65 efficiently immunoprecipitated region B of the CR2 promoter, which covers the −531/−509 oligonucleotide containing the consensus NF-κB site, providing strong support for the binding of these proteins in vivo. The same Abs immunoprecipitated region C of the promoter, albeit less efficiently. It is unlikely that region C was amplified as a result of NF-κB binding around region B, because that would require the presence of DNA fragments that are at least 470 bp long. The finding that region A was not amplified from the same samples also argues against a potential contamination of the PCR with longer DNA fragments. The results of the ChIP assays strongly validate our EMSA data and greatly extend those by showing that the genomic CR2 promoter is targeted by NF-κB p50 and p65 in vivo.

Using primary B cells, we found that region B of the CR2 promoter was precipitated by Ab specific for p65 (Fig. 4⇑B). Ab specific to c-Rel, but not p50, also precipitated region B, suggesting that in primary B cells c-Rel, rather than p50, targets this segment of the CR2 promoter, in conjunction with p65. Region C of the promoter was not precipitated with any of the NF-κB Abs that we used, indicating that in primary B cells this promoter region is not targeted by NF-κB, or at least not in uninduced cells.

Activators of NF-κB enhance CR2 promoter activity and increase the number of the CR2 proteins on the surface of primary B cells

If NF-κB regulates the CR2 promoter, then stimuli that activate NF-κB should affect the promoter activity and CR2 gene expression. First, we monitored changes in CR2 promoter activity after stimulation of cells with a known NF-κB-inducing drug, PMA, and an established physiological inducer, LPS. We transfected resting primary B cells with the wild-type CR2 promoter using a novel transfection protocol (see Materials and Methods for details) that delivers the plasmid directly into the nucleus, stimulated the cells with PMA or LPS, and determined CAT activities 15 h later. This protocol resulted in transfection of ∼20% of B cells, as estimated by using a plasmid encoding green fluorescence protein (data not shown). We found that PMA enhanced CR2 promoter activity by ∼3-fold, whereas LPS enhanced it by 50% (Fig. 5⇓A). The signal intensities that we obtained in CAT reporter assays using primary B cells were quite strong, as illustrated by a representative experiment shown on top of Fig. 5⇓A. Next, we tested the effect of LPS stimulation of B cells on the expression of the endogenous CR2 gene. We detected 40–50% more CR2 (mean fluorescence intensity) on the surface of primary B cells 2.5 h after stimulation with LPS (Fig. 5⇓B). This modest but reproducible increase in CR2 expression returned to baseline by 3.5 h (data not shown), indicating a rapid and transient modulation of cell surface CR2 protein by LPS.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Activators of NF-κB stimulate CR2 promoter activity and CR2 surface protein expression. A, Primary human B cells were transiently transfected with CAT reporter plasmid driven by the wild-type CR2 promoter, or an empty vector and then stimulated with PMA or LPS, as indicated. After 15 h, cells were assayed for CAT activity. Top, radioactive image of a representative experiment with duplicate samples; bottom, relative CAT activities, considering the activity of the unstimulated CR2 promoter-transfected sample 1. Values are means ± SEM. The stimulated samples are compared with the unstimulated sample. ∗, p < 0.05, using ANOVA. B, Primary human B cells were stimulated with LPS for 2.5 h or left untreated and then stained with anti-CD21-PE Ab and analyzed by flow cytometry. A control sample was stained with isotypic control Ab (dotted line). The results of a representative experiment is shown.