Resistance to Metastatic Disease in STAT6-Deficient Mice Requires Hemopoietic and Nonhemopoietic Cells and Is IFN-γ Dependent

Mice, cells, and tumor inoculations

BALB/c, BALB/c STAT6^−/− (henceforth called STAT6^−/−), and BALB/c CD1^−/− (henceforth called CD1^−/−) mice were bred in the University of Maryland Biology Department animal facility from breeding pairs obtained from The Jackson Laboratory (Bar Harbor, ME), M. Grusby (Dana-Farber Cancer Institute, Boston, MA), and L. van Kaer (Washington University, St. Louis, MO), respectively. BALB/c IL-4Rα-deficient (henceforth called IL-4Rα^−/−) mice were purchased from The Jackson Laboratory. STAT6^−/− and CD1^−/− mice were originally made by targeted disruption of the STAT6 and CD1 genes, respectively, in 129 ES cells. Offspring were backcrossed to BALB/c mice (10 backcross generations for STAT6^−/−; 9 backcross generations for CD1^−/−) (17, 18, 19). Female mice of 8–16 wk were used for all studies.

STAT6^−/−IFN-γ^−/− mice were generated by crossing STAT6^−/− mice with IFN-γ^−/− BALB/c mice. Heterozygous offspring were intercrossed, and the F₂ were screened by PCR for homozygosity for STAT6^−/− and IFN-γ^−/−. Ear punch tissue of individual mice was placed in a 0.5-ml microfuge tube, and 20 μl of 50 mM Tris-HCl (pH 8.0), 2 mM NaCl, 10 mM EDTA, 1% SDS, and 1 μl of 20 mg/ml proteinase K (Boehringer Mannheim, Indianapolis, IN) were added. Tubes were incubated at 55°C for 20 min, and after vigorous vortexing for 2 min, the mixture was incubated for an additional 20 min at 55°C. Sterile distilled water was then added to each tube to a final total volume of 200 μl, and the tubes were heated at 100°C for 5 min. The following primers were used: STAT6, 5′ primer, TGAGGTGGGGACCAGCCGG; STAT6, 3′ primer, GTGACCAGGACACACAGCGG; Neo-STAT6, primer, GCTACCCGTGATATTGCTGAAGAG; IFN-γ, 5′ primer, AGAAGTAAGTGGAAGGGCCCAGAAG; IFN-γ, 3′ primer, AGGGAAACTGGGAGAGGAGAAATAT; IFN-γ Neo, 5′ primer, TCAGCGCAGGGGCGCCCGGTTCTTT; IFN-γ Neo, 3′ primer, ATCGACAAGACCGGCTTCCATCCGA. PCR conditions for both IFN-γ and STAT6 genes were: denature at 94°C for 5 min, denature at 94°C for 1 min, anneal at 59°C for 1 min, extend at 72°C for 1.3 min, repeat the last three steps 34 times, extend at 72^o for 9 min. PCR products were electrophoresed on 2% agarose gels. The wild-type STAT6 and STAT6-deletion genes produce 100- and 250-kb bands, respectively (17). The wild-type IFN-γ and IFN-γ-deletion genes produce 220- and 375-bp bands, respectively (www.jax.org/resources/documents/imr/protocols/Ifng_KO.html).

The 4T1 mammary carcinoma cells were maintained in culture and inoculated into the abdominal mammary gland, and mice were followed for survival, as described (12, 13). Primary tumors were measured using an electronic calipers. Reported measurements are the square root of the product of two perpendicular diameters. Numbers of metastatic cells in lung, liver, bone marrow, and brain were determined using the clonogenic metastasis assay in which dissociated organ cells were cultured in medium supplemented with 6-thioguanine (12, 13, 14).

Surgical removal of primary mammary tumors

BALB/c, STAT6^−/−, CD1^−/−, and chimeric mice were inoculated in the abdominal gland with 7000 4T1 cells, and primary, solid tumors were surgically removed, as described (13, 20), with the following modifications: primary tumors were removed 16–21 days after 4T1 inoculation when they were between 2 and 9 mm in diameter and well vascularized. More than 95% of mice survived surgery. Postsurgery mice were followed for metastasis development and/or survival. Mice in which primary tumors recurred at the site of the original tumor inoculation were omitted from the study. These mice were less than 5% of operated mice.

Bone marrow chimeras

STAT6^−/− mice containing BALB/c bone marrow (BALB/c→STAT6^−/−), BALB/c mice containing STAT6^−/− bone marrow (STAT6^−/−→BALB/c), STAT6^−/− mice containing CD1^−/− bone marrow (CD1^−/−→STAT6^−/−), and CD1^−/− mice containing STAT6^−/− bone marrow (STAT6^−/−→CD1^−/−) were constructed as follows using aseptic conditions. Donor mice were asphyxiated with CO₂ and immersed in 70% ethanol, and their hind legs were removed at the hip. Femurs were dissected away from the surrounding tissue, their ends were cut off, and the remaining bone was flushed three times with sterile PBS using a 30-ml syringe fitted with a 27-gauge needle. Bone marrow cells were collected in petri dishes and transferred to 15-ml conical tubes, and the aggregated material was allowed to gravity settle and was discarded. The remaining bone marrow cells were washed twice with PBS and resuspended in medium (RPMI, 1% penicillin, 1% streptomycin, 1% fungizone) at 200 μl per donor mouse. Recipient mice were taken off food the evening before bone marrow transfer. Between 0 and 2 h before bone marrow reconstitution, recipient mice were lethally irradiated (8.75 Gy, Cs-137 source, Gammator B; Kewaunee Scientific, Statesville, NC). Bone marrow was inoculated into recipient mice through the tail vein using a 1-ml syringe fitted with a 27-gauge needle. Each recipient received 100 μl of donor cells (bone marrow from one donor femur). Reconstituted mice received daily injections of gentamicin sulfate i.p. (100 μl of 5 mg/ml) for 7 days beginning 1 day before bone marrow reconstitution. Reconstituted mice were maintained on 2% tetracycline water starting 1–2 wk before bone marrow transfer and continuing for 6–8 wk after reconstitution. Eight to 12 wk after bone marrow reconstitution, chimeras were bled from the tail vein, and the blood was tested by PCR to ascertain hemopoietic genotype and reconstitution.

All animal procedures have been reviewed and approved by the University of Maryland or National Cancer Institute Institutional Animal Care and Use Committee, and comply with National Institutes of Health guidelines for the humane treatment of laboratory animals.

Treatment with soluble IL-13Rα2-Fc

BALB/c mice were inoculated with 7000 4T1 cells in the abdominal mammary gland on day 0 and given soluble IL-13Rα2-Fc (sIL-13Rα2-Fc)³ (0.2 mg/200 μl/dose) every other day from day 0 to 14. Control mice were treated with human IgG having the same Fc as the Fc of the IL-13 inhibitor.

CTL assays

BALB/c, STAT6^−/−, and bone marrow chimeric mice were immunized with 50 Gy-irradiated 4T1 cells (1 × 10⁶ cells i.p.) once every ∼14 days for three to five immunizations. Splenocytes of immunized mice were harvested 5 days after the last immunization and used as effector cells in overnight (∼16-h) assays. CTL assays were performed as described (3). Percent specific activity is the percentage of cytotoxicity against 4T1 targets minus percentage of cytotoxicity against B16 targets.

Flow cytometry

Mouse splenocytes were characterized by flow cytometry using the following mAbs: CD3 FITC, CD4 PE, B220 PE, Mac-1 FITC (Caltag, Burlingame, CA), as described (3).

CD4⁺CD25⁺ T cell depletions

The hybridoma PC61 secreting anti-CD25 mAb (IL-2Rα-specific, rat IgG1) (21) was obtained from American Type Culture Collection (Manassas, VA) and was purified by protein G affinity column from culture supernatants, as previously described (12). For in vivo depletions, mice were given 800 μg in 100 μl PBS i.p., as described (8), on day −4 and were inoculated on day 0 with 7000 4T1 cells in the abdominal mammary gland. For experiments monitoring survival after surgery, mice were given 800 μg PC6-5.3 in 100 μl PBS i.p. on day −4 after inoculation of 7000 4T1 cells; primary tumor was surgically removed on day 20; and mice were followed for survival. Efficiency of mAb depletion of CD4⁺CD25⁺ T cells was ascertained by double-staining splenocytes of treated mice with directly coupled CD25-specific mAb (CD25 FITC; BD PharMingen, San Diego, CA) and CD4-specific mAb (GK1.5 PE; BD PharMingen) 3 days and 1 wk after inoculation of mAb PC6-5.3. Undepleted mice showed ∼10% of the splenocytes as CD4⁺CD25⁺; depleted mice had 1–2% of their cells as CD4⁺CD25⁺.

Cytokine production

Naive or surgery-survivor mice were inoculated in an abdominal mammary gland and/or i.p. with 10⁵ or 10⁶ live or irradiated 4T1 cells. Draining lymph nodes or spleens were removed 5 days later, and 1 × 10⁶ lymphocytes were cocultured with 3 × 10⁵ 80 Gy-irradiated 4T1/B7.1 or B16 melF10 stimulator cells in a total volume of 1 ml in 24-well plates (RPMI, 10% FCS, 5 × 10⁻⁵ M 2-ME, 1% penicillin, 1% streptomycin). Supernatants were harvested 48 h later and tested in triplicate by ELISA for IL-2, IL-4, and IFN-γ, according to the manufacturer’s directions (Pierce/Endogen, Rockford, IL). Specific cytokine release was determined by subtracting nonspecific release (B16 melF10 stimulators) from 4T1-stimulated release.

Statistical analyses

Data were analyzed using unpaired Student’s t tests (Microsoft Excell, Redmond, WA).

Following surgical removal of primary tumor, STAT6^−/− mice reject lung, liver, and bone marrow metastasis and survive

To assess the potency of the STAT6 antitumor effect against established metastatic tumor, BALB/c and STAT6^−/− mice were inoculated with 4T1 cells, and followed for development of metastasis and survival after surgical removal of primary tumor. Groups of BALB/c and STAT6^−/− mice were inoculated in the abdominal mammary gland with 7000 4T1 tumor cells, and the tumors were allowed to grow progressively. Although primary tumors in STAT6^−/− mice grow more slowly than primary tumors in BALB/c mice (3), most tumors were 2–9 mm in diameter within 2–3 wk of 4T1 inoculation. Previous studies demonstrated that mice with primary tumors >2 mm in diameter have established metastatic disease (13). Surgical removal of primary tumors was completed over a 7-day period so that sizes of primary tumors between the BALB/c and STAT6^−/− groups could be matched. Because metastasis is not reliably established when primary tumors are smaller than 2 mm in diameter (13), mice with tumors <2 mm in diameter were omitted from the experiment. Three to four weeks after surgery (42–45 days post-4T1 inoculation), mice were sacrificed, and the lungs, liver, and bone marrow were isolated. The number of metastatic cells in each organ was determined using the clonogenic assay (12).

As shown in Table I⇓, ≥60% of postsurgery STAT6^−/− mice (12 of 20) do not have detectable metastasis in the lungs, liver, or bone marrow, while only 7.5% of intact BALB/c mice (1 of 13) are free of metastasis. Those STAT6^−/− mice that have organ metastases have fewer metastatic cells per organ than BALB/c mice (a maximum of 3383 metastatic cells/organ in STAT6^−/− mice vs 2.8 × 10⁵ in BALB/c mice). Therefore, the majority of STAT6^−/− mice are resistant to the outgrowth and development of 4T1 metastasis if the primary mammary tumor is surgically removed.

To determine whether the reduced number of metastatic cells in STAT6^−/− mice translates into increased survival time, additional groups of BALB/c and STAT6^−/− mice were inoculated with 4T1 cells in the mammary gland, and primary tumors were surgically removed as per the experiment of Table I⇑. The resulting mice were observed for survival. As shown in Fig. 1⇓A, 67% of STAT6^−/− mice (12 of 18) survived >175 days, while only 8.3% of BALB/c mice (1 of 12) survived. Many postsurgery STAT6^−/− mice, therefore, appear to have completely rejected or inhibited the growth of their metastatic tumors.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

A majority of STAT6^−/− mice survive metastatic mammary carcinoma following surgical removal of primary tumor. STAT6^−/− and BALB/c mice were inoculated in the abdominal mammary gland with 7000 4T1 cells. Later (2–2.5 wk), primary tumors were surgically removed and mice were followed for survival. A, Average primary TD ± SD (mm) at the time of surgery were STAT6^−/−, 4.51 ± 1.27; BALB/c, 4.87 ± 1.62. Values in parentheses are the number of mice per group. B, Survival time plotted as a function of TD at the time of surgery. Data are pooled from three independent experiments. Each BALB/c or STAT6^−/− group in each individual experiment contained 7–18 mice, for a total of 36 BALB/c and 38 STAT6^−/− mice.

In earlier studies, it was noted that mice with larger primary tumors at the time of surgery tended to have more metastatic cells in their lungs, livers, and brains. To test whether the resistance of STAT6^−/− mice is limited by the size of the primary tumor, we examined survival time in days vs tumor diameter (TD) at the time of surgery. The data shown in Fig. 1⇑B are the pooled results of three independent experiments in which BALB/c and STAT6^−/− mice, respectively, were inoculated in the mammary gland with 7000 4T1 cells, and primary tumors were surgically removed at 2.5–3 wk. In this aggregate group, 63% (24 of 38) of STAT6^−/− mice survived indefinitely (>150 days), vs only 6% (2 of 36) of BALB/c mice. Survival of STAT6^−/− mice did not correlate with size of primary tumor at the time of surgery, indicating that resistance in STAT6^−/− mice is independent of primary tumor size. A large percentage of STAT6^−/− mice, therefore, is resistant to spontaneous metastatic mammary carcinoma if the primary tumor is removed, regardless of the size of the primary tumor, while most wild-type BALB/c mice are highly susceptible.

STAT6^−/− mice that have survived an initial 4T1 challenge are immune to subsequent spontaneous metastatic disease

In earlier studies, CD8⁺ T cells were shown to be required for limiting tumor growth in STAT6^−/− mice, indicating that tumor resistance is immune mediated (3). In these earlier experiments, primary tumors remained in place, and all mice eventually died from tumor, even though metastatic disease developed more slowly in STAT6^−/− mice than in BALB/c mice. However, many STAT6^−/− mice with established metastasis survive indefinitely if their primary tumor is surgically removed (Fig. 1⇑A). To determine whether these survivors have enhanced immunity and long-term memory, they were rechallenged with 4T1 tumor. STAT6^−/− mice whose primary tumors were removed and who survived ≥185 days (STAT6^−/− surgery survivors from the experiment shown in Fig. 1⇑A) were rechallenged in the mammary gland with 7000 4T1 cells and followed for primary tumor development and survival. The single BALB/c surgery survivor from Fig. 1⇑A was also rechallenged, as were naive BALB/c and STAT6^−/− mice. A control group of STAT6^−/− mice whose primary tumor was recently removed, but which had not as yet gone through long-term survival and was not reinoculated with 4T1 (STAT6^−/− surgery group), was also included.

As shown in Fig. 2⇓, the BALB/c surgery survivor and naive BALB/c mice are dead by day 50, while naive STAT6^−/− mice die more slowly, but 100% are dead by day 88. In contrast, 75% of the STAT6^−/− long-term surgery survivors survive >350 days after their second 4T1 challenge, whereas only 45% of STAT6^−/− surgery mice survived long term. Surgical removal of primary tumor, therefore, results in induction of long-term antitumor immunity in up to 75% of STAT6^−/− mice, or selects for animals that are more inherently resistant.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

STAT6^−/− survivor mice are immune to subsequent inoculations of 4T1 tumor. STAT6^−/− and BALB/c survivor mice from Fig. 1⇑A were reinoculated in the abdominal mammary gland with 7000 4T1 cells and followed for survival. Control and comparison groups included BALB/c and STAT6^−/− mice whose primary tumors were not surgically removed (naive BALB/c and naive STAT6^−/−), and STAT6^−/− mice whose primary tumors were removed, but not reinoculated with 4T1 (STAT6^−/− surgery). Values in parentheses are the number of mice per group.

Enhanced tumor immunity requires both hemopoietic and nonhemopoietic components

We originally hypothesized that deletion of the STAT6 gene resulted in skewing of the CD4⁺ T cell population toward a Th1 phenotype, thereby enhancing CD8-mediated tumor immunity. However, Ab depletion experiments demonstrated that although CD8⁺ T cells are involved, CD4⁺ T cells are not required (3). Deletion of the STAT6 gene, therefore, results in enhanced tumor immunity via a mechanism independent of Th1 CD4⁺ T cells. To understand the mechanism of enhanced immunity in STAT6^−/− mice, we need to identify the cells that must be STAT6 deficient. Because CD8⁺ T cells are the effector cells against 4T1 tumor (3), we asked whether it was sufficient that CD8⁺ T cells be knocked out for the STAT6 gene. To test this hypothesis, BALB/c mice with STAT6^−/− bone marrow were prepared. Experimental chimeras (STAT6^−/− bone marrow into lethally irradiated BALB/c mice; STAT6^−/−→BALB/c), control chimeras (BALB/c bone marrow into lethally irradiated STAT6^−/− mice; BALB/c→STAT6^−/−), and control naive STAT6^−/− and BALB/c mice were inoculated in the abdominal mammary gland with 7000 4T1 cells. Onset and progression of primary tumors did not significantly differ between the groups. Primary tumors were surgically removed 15–21 days later when they measured between 2.8 and 7 mm in diameter and when metastatic disease was firmly established. The mice were then followed for survival. As shown in Fig. 3⇓A, the chimeras and control BALB/c mice are dead by day 45 post-4T1 inoculation, while 46% of the STAT6^−/− mice survive >350 days. STAT6^−/− hemopoietic derived cells, therefore, are not sufficient for enhanced tumor immunity, suggesting that STAT6^−/− nonhemopoietic derived cells or both hemopoietic and nonhemopoietic STAT6^−/− cells are required.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Enhanced immunity requires hemopoietic and nonhemopoietic components. Chimeric mice and untreated control BALB/c and STAT6^−/− mice were inoculated in the abdominal mammary gland with 7000 4T1 tumor cells, and primary tumors were surgically removed 15–21 days later. Values in parentheses are the number of mice per group. A, Allogeneic chimeras. Average primary TD ± SD (mm) at the time of surgery were BALB/c, 5.41 ± 0.76; STAT6^−/−, 4.61 ± 1.51; BALB/c→STAT6^−/−, 4.68 ± 0.79; STAT6^−/−→BALB/c, 5.3 ± 0.9. B, Autologous chimeras. Average primary TD ± SD (mm) at the time of surgery were BALB/c, 5.13 ± 0.7; STAT6^−/−, 4.12 ± 0.52; BALB/c→BALB/c, 4.59 ± 0.74; STAT6^−/−→STAT6^−/−, 4.93 ± 0.47. C, STAT6^−/−, but not BALB/c, STAT6^−/−→BALB/c, or BALB/c→STAT6^−/− chimeric mice contain CTL to 4T1 tumor cells. Chimeras, BALB/c, and STAT6^−/− mice were multiply immunized i.p. with 10⁶ irradiated 4T1 cells. Five days after the last immunization, splenocytes were removed and tested for cytotoxic activity against Cr-51-labeled 4T1 and B16 melanoma targets.

To test this hypothesis and to assure that lethal irradiation did not destroy an essential component for antitumor immunity, autologous bone marrow chimeras were prepared. BALB/c and STAT6^−/− mice were lethally irradiated and reconstituted with syngeneic bone marrow (BALB/c bone marrow into BALB/c mice, BALB/c→BALB/c; and STAT6^−/− bone marrow into STAT6^−/− mice, STAT6^−/−→STAT6^−/−). These chimeras along with control naive BALB/c and STAT6^−/− mice were inoculated with 7000 4T1 cells in the abdominal mammary gland. Primary mammary tumors were surgically removed at 2–3 wk when tumors were 3–6 mm in diameter, and the mice were followed for survival. As shown in Fig. 3⇑B, 100% of the control naive BALB/c and 89.9% of the BALB/c→BALB/c chimeras died by day 47 post-4T1 inoculation. In contrast, 57.1% of the STAT6^−/− mice and 75% of the STAT6^−/−→STAT6^−/− chimeras survive ≥100 days. Enhanced immunity, therefore, requires cells and/or components derived from both hemopoietic and nonhemopoietic compartments.

Earlier in vivo depletion studies demonstrated that CD8⁺ T cells are required for enhanced immunity to 4T1 mammary carcinoma in STAT6^−/− mice. In vitro assays using splenocytes from BALB/c and STAT6^−/− mice immunized with 4T1 showed a strong correlation between tumor rejection and the development of tumor-specific CD8⁺ CTL (3). To further test whether CTL activity reflects antitumor activity, bone marrow chimeric mice were immunized with irradiated 4T1 tumor cells, and splenocytes were tested for CTL activity against 4T1 and irrelevant B16 melanoma target cells. As shown in Fig. 3⇑C, 4T1-immunized STAT6^−/−mice have specific CTL activity, while STAT6^−/−→BALB/c, BALB/c→STAT6^−/−, and BALB/c mice do not. Splenocyte in vitro cytotoxic activity to tumor, therefore, correlates with in vivo tumor rejection, and STAT6^−/− bone marrow reconstitution alone is not sufficient to generate tumor-specific cytotoxic activity.

CD1-deficient mice have enhanced immunity to metastatic mammary carcinoma, but not to primary mammary carcinoma

Earlier studies identified NKT cells and IL-13 as potential inhibitors of tumor immunity to the HIV gp160-transfected 15-12RM 11 fibrosarcoma (1). To determine whether NKT cells and IL-13 also inhibit immunity to metastatic 4T1 tumor, NKT cell-deficient and IL-13-deficient CD1^−/− mice were tested. CD1^−/− mice were inoculated in the abdominal mammary gland with 7000 4T1 cells. Primary tumors were removed from the CD1^−/− and control BALB/c and STAT6^−/− mice at 2–3 wk, and the mice were followed for survival. As shown in Fig. 4⇓A, 100% of control BALB/c mice were dead by day 52, while 80 and 60% of CD1^−/− and STAT6^−/− mice, respectively, survived >100 days. Elimination of NKT cells and accompanying reduction in IL-13, therefore, produce resistance to 4T1 metastasis.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

CD1^−/− mice have enhanced immunity to 4T1 metastatic disease; however, CD1^−/− and STAT6^−/− bone marrow chimeras do not. A, CD1^−/−, STAT6^−/−, and BALB/c mice were inoculated in the abdominal mammary gland with 7000 4T1 cells. Two to three weeks later, primary tumors were surgically removed and mice were followed for survival. Average primary TD ± SD (mm) at the time of surgery were BALB/c, 4.26 ± 0.86; STAT6^−/−, 4.43 ± 1.13; CD1^−/−, 4.95 ± 0.64. B, Eight weeks after bone marrow reconstitution, mice were inoculated in the abdominal mammary gland with 7000 4T1 tumor cells. Primary tumors were surgically removed on days 18–26. Average primary TD ± SD (mm) at the time of surgery were BALB/c, 4.93 ± 0.98; STAT6^−/−, 4.47 ± 1.17; CD1^−/−→STAT6^−/−, 4.75 ± 0.65; STAT6^−/−→CD1^−/−, 4.52 ± 0.8; CD1^−/−, 4.9 ± 1.2. Values in parentheses are the number of mice per group.

To ascertain whether primary tumor growth is affected by NKT and IL-13 deficiency, the 4T1 solid tumors of the mice in Fig. 4⇑ were measured at the time of surgery. As shown in Table II⇓, 100% of CD1^−/− and BALB/c mice develop primary tumors at the inoculation site (abdominal mammary gland) within 2 wk of inoculation of 7000 4T1 cells. The primary tumors in the CD1^−/− mice are slightly larger than tumors in the BALB/c group (p < 0.05). In contrast, only 50% of STAT6^−/− mice develop tumors. Therefore, primary 4T1 tumor growth in NKT-deficient mice is not reduced relative to primary tumor growth in BALB/c mice, indicating that deletion of NKT cells does not enhance immunity to primary mammary carcinoma.

Chimeric mice of STAT6^−/− bone marrow in CD1^−/− recipients, and vice versa, do not have enhanced tumor immunity to mammary carcinoma metastasis

As seen in the experiments of Fig. 3⇑, enhanced immunity in STAT6^−/− mice requires hemopoietic and nonhemopoietic derived cells. If STAT6^−/− and CD1^−/− mice share a common mechanism underlying their enhanced immunity, then chimeras of STAT6^−/− or CD1^−/− bone marrow and recipients may have enhanced immunity. To test this hypothesis, STAT6^−/− recipients were reconstituted with CD1^−/− bone marrow (CD1^−/−→STAT6^−/− chimeras), and CD1^−/− recipients were reconstituted with STAT6^−/− bone marrow (STAT6^−/−→CD1^−/−). The chimeras, along with control STAT6^−/−, CD1^−/−, and wild-type BALB/c mice, were challenged with 7000 4T1 cells in the abdominal mammary gland, their primary tumors were removed 2–3 wk later, and the mice were followed for survival time. As shown in Fig. 4⇑B, 70% of STAT6^−/− and 100% of CD1^−/− mice survived >150 days, while 100% of both chimeras died within 53 days. Therefore, STAT6^−/− and CD1^−/− hemopoietic derived cells are not equivalent in terms of tumor immunity, and it is likely that enhanced immunity in STAT6^−/− and CD1^−/− mice is mediated by different mechanisms, or that they have defects in distinct steps of the relevant regulatory pathway.

Inhibition of IL-13 in BALB/c mice does not facilitate tumor immunity to primary or metastatic 4T1 mammary carcinoma

As demonstrated by earlier studies, mice treated with an inhibitor for IL-13 (sIL-13Rα2-Fc) are resistant to recurrence of the 15-12RM gp160-transfected fibrosarcoma (1). This result, coupled with the observation that NKT-deficient CD1^−/− mice, as well as IL-13-nonresponsive STAT6^−/− mice, and IL-4Rα^−/− mice are also resistant to 15-12RM (1), supports the hypothesis that IL-13 produced by NKT cells blocks activation of CD8⁺ T cells. Inhibition of IL-13 by sIL-13Rα2 therefore blocks IL-13 activity, and allows tumor-specific CD8⁺ T cells to differentiate (1). To determine whether enhanced immunity to 4T1 in STAT6^−/− mice is due to nonresponsiveness to IL-13, BALB/c mice were treated with the IL-13 inhibitor, sIL-13Rα2-Fc, and inoculated with 4T1. Groups of BALB/c mice were either treated with sIL-13Rα2-Fc or a control human IgG starting on day 0, and inoculated in the abdominal mammary gland with 7000 4T1 cells. Inhibitor or control IgG treatment was continued for the first 2 wk of tumor growth. On day 26, primary tumors were surgically removed, and the mice were followed for survival. As shown in Fig. 5⇓, neither primary tumor progression (Fig. 5⇓A) nor survival following surgical removal of primary tumor (Fig. 5⇓B) is altered by sIL-13Rα2-Fc treatment, suggesting that inhibition of IL-13 does not yield enhanced tumor immunity to the 4T1 mammary carcinoma.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Inhibition of IL-13 with the sIL-13Rα2-Fc does not alter primary tumor growth or metastatic disease. BALB/c mice were inoculated on day 0 with 7000 4T1 cells and treated with sIL-13Rα2-Fc or a control Ig every other day from day 0 to 14. A, Primary tumor growth. B, Survival following surgical removal of primary tumor on day 26. Average primary TD ± SD (mm) at the time of surgery were: IL-13-inhibitor treated, 5.14 ± 0.79; control IgG treated, 6.38 ± 0.37. The numbers in parentheses are the number of mice per group.

Depletion of CD4⁺CD25⁺ T cells in BALB/c mice does not enhance immunity to primary or metastatic 4T1 mammary carcinoma

CD4⁺CD25⁺ T cells have also been shown to inhibit the activation of CD8⁺ T cytotoxic cells (8, 9, 11). To determine whether CD4⁺CD25⁺ T regulatory cells inhibit activation of 4T1-specific CD8⁺ T cells, BALB/c mice were depleted for CD4⁺CD25⁺ T cells before inoculation with 4T1 mammary carcinoma. BALB/c mice were either untreated or given CD25 mAb starting on day −4, and inoculated with 7000 4T1 cells in the abdominal mammary gland on day 0. In one group of mice, progression of primary tumors was followed. In a second group of mice, primary tumors were surgically excised on day 21, and the mice were followed for survival. Depletion of CD4⁺CD25⁺ T cells does not alter growth of primary 4T1 (Fig. 6⇓A) nor survival (Fig. 6⇓B). Therefore, inactivation of CD4⁺CD25⁺ T regulatory cells is not responsible for enhanced immunity to 4T1 primary tumor or metastatic disease in STAT6^−/− mice.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Depletion of CD25⁺ cells does not alter primary tumor growth or metastatic disease. BALB/c mice were treated or not treated on day −4 with mAb PC61 to CD25 and inoculated on day 0 with 7000 4T1 cells. A, Primary tumor growth. B, Survival following surgical removal of primary tumor on day 21. Average primary TD ± SD (mm) at the time of surgery were CD25 depleted, 6.42 ± 1.33; not depleted, 5.21 ± 1.39. The numbers in parentheses are the number of mice per group.

IFN-γ is essential for tumor resistance in STAT6^−/− mice

To determine whether tumor resistance correlated with differential cytokine production, draining lymph node cells of STAT6^−/− and BALB/c mice were assayed. Mice were inoculated in an abdominal mammary gland with 4T1 cells, and 5 days later draining inguinal lymph nodes were removed and cocultured with irradiated 4T1/B7.1 or irrelevant stimulators. A total of 21 STAT6^−/− and 17 BALB/c mice were tested in seven separate experiments. Fig. 7⇓A shows the pooled results of these experiments. STAT6^−/−, but not BALB/c mice produce high levels of IFN-γ, while BALB/c mice produce more IL-4 than STAT6^−/− mice. Both strains produce low levels of IL-2. If 100 pg/ml of IFN-γ is used as a cutoff for responders, then 62% of the STAT6^−/− mice produce IFN-γ, which is approximately equal to the percentage of STAT6^−/− mice that survive in a typical surgery experiment.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Tumor resistance in STAT6^−/− mice is dependent on IFN-γ. A, STAT6^−/− (cross-hatched bars) and BALB/c (filled bars) mice were inoculated with 4T1 cells. Draining lymph nodes were removed 5 days later and cocultured with irradiated 4T1/B7.1 or irrelevant B16 melF10 cells. Supernatants were harvested 2 days later and tested by ELISA for IL-2, IL-4, and IFN-γ. These data are the pooled results of 21 STAT6^−/− and 17 BALB/c mice. B, STAT6^−/−IFN-γ^−/− mice were inoculated in the abdominal mammary gland with 7000 4T1 cells. Primary tumors were removed on day 21, and mice were followed for survival. Average primary TD ± SD (mm) at the time of surgery were STAT6^−/−, 5.59 ± 0.7; IFN-γ^−/−, 5.93 ± 0.81; STAT6^−/−IFN-γ^−/−, 6.25 ± 1.62. The numbers in parentheses are the number of mice per group.

To ascertain whether IFN-γ production is essential for enhanced tumor resistance in STAT6^−/− mice, double knockout STAT6^−/−IFN-γ^−/− mice were inoculated in the abdominal mammary gland with 4T1 cells, and followed for survival after surgical removal of primary tumor. As shown in Fig. 7⇑B, 100% of STAT6^−/−IFN-γ^−/− and IFN-γ^−/− mice die by day 62, while 87% of the STAT6^−/− mice survive. Therefore, IFN-γ is essential for enhanced tumor resistance in STAT6^−/− mice.