Skip to main content

Main menu

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons

User menu

  • Subscribe
  • Log in

Search

  • Advanced search
The Journal of Immunology
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons
  • Subscribe
  • Log in
The Journal of Immunology

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Follow The Journal of Immunology on Twitter
  • Follow The Journal of Immunology on RSS

A Clonal Culture System Demonstrates That IL-4 Induces a Subpopulation of Noncytolytic T Cells with Low CD8, Perforin, and Granzyme Expression

Norbert Kienzle, Kathy Buttigieg, Penny Groves, Tom Kawula and Anne Kelso
J Immunol February 15, 2002, 168 (4) 1672-1681; DOI: https://doi.org/10.4049/jimmunol.168.4.1672
Norbert Kienzle
*Queensland Institute of Medical Research, Brisbane, Queensland, Australia;
†Joint Experimental Oncology Program, Brisbane, Queensland, Australia;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kathy Buttigieg
*Queensland Institute of Medical Research, Brisbane, Queensland, Australia;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Penny Groves
*Queensland Institute of Medical Research, Brisbane, Queensland, Australia;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tom Kawula
§Department of Microbiology and Immunology, University of North Carolina, Chapel Hill, NC 27599
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anne Kelso
*Queensland Institute of Medical Research, Brisbane, Queensland, Australia;
‡Joint Transplantation Biology Program and Cooperative Research Centre for Vaccine Technology, Brisbane, Queensland, Australia; and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Immune deviation of cytolytic T cell function, induced by type 2 cytokines like IL-4, is an attractive concept to explain failure of the immune system in some diseases. However, this concept is challenged by previous conflicting results on whether type 2 cytokine-producing CD8+ T cells are cytolytic. Therefore, we have analyzed the relationship between cytolytic activity and cytokine production among large numbers of primary CD8+ T cell clones. Single murine CD8+ T cells of naive phenotype were activated at high efficiency with immobilized Abs to CD3, CD8, and CD11a in the presence of IL-2 (neutral conditions) or IL-2, IL-4, and anti-IFN-γ Ab (type 2-polarizing conditions) for 8–9 days. Under neutral conditions, most clones produced IFN-γ without IL-4 and were cytolytic. Under type 2-polarizing conditions, most clones produced IFN-γ and IL-4 but displayed variable cytolytic activity and CD8 expression. Separation on the basis of surface CD8 levels revealed that, compared with CD8high cells from the same cultures, CD8low cells were poorly cytolytic and expressed low levels of perforin mRNA and protein and granzyme A, B, and C mRNA. A similar, smaller population of noncytolytic CD8low cells was identified among CD8+ T cells activated in mixed lymphocyte reaction with IL-4. Variable efficiency of generation of the noncytolytic cells may account for the differing results of earlier studies. We conclude that IL-4 promotes the development of a noncytolytic CD8low T cell phenotype that might be important in tumor- or pathogen-induced immune deviation.

Cytokines influence the differentiation of naive T cells into effector cells with diverse functions during the primary response to Ag. This cytokine-driven specialization is illustrated by the polarization of newly activated CD4+ T cells to type 1 (IFN-γ and IL-2) cytokine synthesis in the presence of IL-12, IL-18, or IFN-γ and to type 2 (IL-4, IL-5, IL-6, IL-10, and IL-13) cytokine synthesis in the presence of IL-4 (1, 2). A similar phenomenon occurs in CD8+ T cells. Although CD8+ cells are generally predisposed to the production of IFN-γ even in the absence of polarizing cytokines, they can be readily induced to synthesize type 2 cytokines in vitro by exposure to IL-4 during early activation (3, 4, 5, 6). Preferential production of IFN-γ or IL-4 by in vivo-activated human CD8+ T cells has also been observed in some disease states (7, 8).

Although IL-4 unequivocally promotes de novo expression of type 2 cytokines by CD8+ T cells, the evidence for an effect on development of cytolytic function is conflicting. IL-4 has been reported to enhance, reduce, or exert no effect on CD8+ T cell cytolysis and Ag clearance in models of viral and tumor immunity (9, 10, 11, 12, 13, 14, 15, 16, 17, 18). These variable results might reflect differences among the immune mechanisms invoked in each model or distinct effects of IL-4 on APCs and T cells that are difficult to dissect in vivo. In contrast, contradictory results have also been reported in experiments studying the effects of IL-4 on the differentiation of naive CD8+ T cells in vitro. Early studies showed that IL-4 enhanced the cytolytic activity of CD8+ T cells in several systems (19, 20, 21, 22). Erard et al. (4) subsequently described the development of noncytolytic CD8−CD4− populations from naive CD8+ T cells in short-term cultures activated in the presence of IL-4 either with the pharmacologic agents PMA and ionomycin or with allogeneic cells. These populations displayed a type 2 cytokine profile and low expression of perforin mRNA. Cronin et al. (23) established long-term alloreactive CD8+ T cell clones that secreted IL-4 and failed to lyse allogeneic target cells but that were lytic in a redirected cytolytic assay. In contrast, several groups reported that CD8+ T cell populations and clones generated in the presence of IL-4 retained CD8 expression, produced type 2 cytokines, and displayed strong cytolytic activity against Ag-bearing target cells (5, 24, 25, 26). The reasons for these differences between similar experimental systems are not clear.

Therefore, we have examined the relationship between the induction of IL-4 synthesis and the development of cytolytic function in a clonal system, which allows us to screen large numbers of individual primary T cell clones for multiple functions. This analysis has revealed marked heterogeneity in the functional response to IL-4 when CD8+ T cells of naive phenotype were activated with anti-receptor Abs or allogeneic cells. Variable proportions of cells displayed reduced expression of surface CD8, and this in turn was strongly associated with high IL-4 production, low cytolytic activity, and low expression of perforin and several granzymes. By contrast, other cells retained CD8 expression and displayed substantial cytolytic activity and expression of perforin and granzymes. We conclude that IL-4 promotes the development of a noncytolytic CD8low T cell phenotype. Differences between systems in the frequency of these CD8low T cell cells and their masking in heterogeneous cultures provide a means to reconcile the conflicting results of previous studies. Activation of these cells might be one mechanism by which some pathogens and tumors avoid immune destruction.

Materials and Methods

Abs and FACS analysis

The following Abs were obtained: PE- or FITC-conjugated rat anti-mouse CD8α Ab (53.6; BD PharMingen, San Diego, CA); biotinylated anti-mouse CD44 Ab (IM7.81; BD PharMingen); Tri-Color-, FITC-, or PE-conjugated streptavidin (Caltag, Burlingame, CA); FITC-conjugated goat anti-rat Ig (BD PharMingen); FITC-conjugated goat anti-hamster IgG (Kirkegaard & Perry Laboratories, Gaithersburg, MA); rat anti-mouse IFN-γ Abs R4-6A2 and biotinylated XMG1.2 (BD PharMingen); HRP-conjugated rabbit anti-rat Ig (DAKO, Glostrup, Denmark); HRP-conjugated sheep anti-mouse IgG (SILENUS Labs, Boronia, Australia); rat anti-mouse perforin Ab (KM585 P1-8; Kamiya Biomedical, Seattle, WA); mouse anti-actin Ab (AC-40; Sigma-Aldrich, St. Louis, MO); hamster anti-mouse Fas ligand (FasL)3/CD95 ligand (BD PharMingen); and biotinylated mouse anti-hamster IgG (BD PharMingen). The following mAbs were protein G-purified from cell supernatant: hamster anti-mouse CD3ε (145-2C11), rat anti-mouse CD8α (53.6), rat anti-mouse CD11a (I21/7.7), rat anti-mouse IFN-γ (XMG1.2), and rat anti-mouse IL-4 Abs BVD4-1D11 and biotinylated BVD6-24G2. The rat anti-mouse CD3ε Ab (KT3-1.1) and rat anti-mouse L-selectin/CD62L Ab (Mel-14) were used as diluted hybridoma supernatant. Cells (≤106) were incubated with 20 μl of diluted Ab for 30 min on ice, washed, and resuspended in balanced salt solution supplemented with 5% heat-inactivated FCS (CSL, Parkville, Victoria, Australia) and 1 μg/ml propidium iodide (Calbiochem, San Diego, CA). Cell surface expression was analyzed by FACS (FACSCalibur flow cytometer using CELLQuest V3.1f software, BD Biosciences, San Jose, CA).

T cell preparation

Specific pathogen-free female C57BL/6 mice were obtained from the Animal Resources Center (Perth, Western Australia) and used at 6–9 wk of age. Cell suspensions from brachial, axillary, inguinal, and lumbar lymph nodes were prepared by passing through stainless steel mesh followed by Ficoll-Paque (Amersham Pharmacia Biotech, Sydney, Australia) separation. Cells were stained for fluorescence-activated cell sorting with PE- or FITC-conjugated anti-CD8α Ab and biotinylated anti-CD44 Ab, followed by FITC- or PE-conjugated streptavidin, respectively. For some experiments, cells were stained with anti-CD62L Ab, followed by FITC-conjugated goat anti-rat Ig Ab, followed by PE-conjugated anti-CD8α Ab and biotinylated anti-CD44 Ab, and finally followed by Tri-Color-conjugated streptavidin. Viable naive cells were sorted using a FACS Vantage with Lysis II software (BD Biosciences) for CD8+ and CD44low (bottom 30%) expression with >97% CD8+ purity. For clonal analysis, individual cells were deposited in 96-well round-bottom plates (Falcon, BD Biosciences) using an automated cell deposition unit attached to the FACS. For purification of activated CD8high and CD8low cells, viable T cells were FACS sorted for high (mean fluorescence intensity, >200) and low (mean fluorescence intensity, <20) CD8 expression.

Activation of CD8+ T cells

Ab-driven stimulation.

Naive CD8+ T cells were stimulated in an accessory cell-free system as outlined in detail previously (27, 28) using immobilized anti-CD3 (2C11), anti-CD8, and anti-CD11a Abs. Briefly, 96-well or 24-well plates (Falcon) were incubated overnight with 40 μl or 250 μl, respectively, of the Ab mix in PBS (anti-CD3 and anti-CD8 Abs, 10 μg/ml; anti-CD11a Ab, 5 μg/ml) and then washed three times in PBS. Single or 500-1000 CD8+CD44low T cells were cultured in 200 μl (per 96-well) or in 2 ml (per 24-well) of growth medium (modified DMEM supplemented with 50 μM 2-ME, 216 mg/L l-glutamine and 10% heat-inactivated FCS) containing human rIL-2 (120 IU/ml; Cetus, Emeryville, CA) in the absence or presence of anti-IFN-γ Ab (XMG1.2, 1 μg/ml) and mouse rIL-4 (3.3 U/ml, supernatant of Sf9 insect cells infected with murine IL-4 cDNA-encoding baculovirus (29)). One unit per milliliter of IL-4 activity was defined as the amount stimulating half-maximal proliferation of the IL-4-dependent cell line CT.4S (29), and 1 U/ml of baculovirus-derived IL-4 was equivalent to 7.7 ng/ml of rIL-4 (Sigma-Aldrich). For clonal analysis, clone size was assessed microscopically after 8 days of culture using the following scales: 0, no cells; 1, 1–102 cells; 2, 102–103 cells; 3, 103–104 cells; and 4, >104 cells. Clones were then washed three times in situ in Dulbecco’s balanced salt solution with 2% FCS and once in growth medium and incubated in the same wells (containing the immobilized anti-CD3/8/11a Abs) overnight with 200 μl of growth medium containing 120 IU/ml IL-2. After 18–22 h, culture supernatants were harvested for cytokine analysis, and clones were assayed for cytolysis and cell surface receptor expression. Bulk cultures were harvested after 7 or 8 days of culture for analysis.

MLR.

CD8+CD44low T cells (15 to 20) from C57BL/6 mice were incubated with 5–8 × 105 allogeneic spleen cells (gamma-irradiated with 2000 rad) from DBA/2 mice in 200 μl of growth medium supplemented with 300 IU/ml IL-2 (this concentration provided optimal cell growth in the MLR) and with or without 3.3 U/ml IL-4 in 96-well round-bottom plates. After 8 days of culture, activated T cells were purified by Ficoll-Paque separation and analyzed.

Cytokine induction assays

For clonal assays, cytokine induction was induced overnight by the plate-bound anti-CD3/8/11a Abs, and 50 μl of supernatant per well was spot tested without further dilution. To reduce stimulus-independent cytokine synthesis (Fig. 7⇓B), the anti-CD3/8/11a Ab-stimulated T cells were rested in growth medium and IL-2 for at least 4 days after primary activation before the cells were stimulated for cytokine induction. T cell populations (5 × 104) were incubated for 22–24 h in 200 μl of growth medium containing 120 U/ml IL-2 with the following stimuli: 1) plate-bound anti-CD3/8/11a Abs; 2) allogeneic P815 cells (5 × 104) with or without soluble anti-CD3 Ab 2C11 (1 μg/ml); and 3) no stimulus. IL-4 and IFN-γ were assayed in duplicate serial titrations of supernatant (50 μl, pooled from at least three replicate samples) by ELISA using the anti-IL-4 Abs BVD4 and biotinylated BVD6 (30) or the anti-IFN-γ Abs R4-6A2 and biotinylated XMG1.2, respectively. In some experiments, IFN-γ was measured by the growth inhibition of the IFN-γ-sensitive cell line WEHI-279, as described previously (31). Measured IL-4 and IFN-γ activities were standardized by reference to titrations of baculovirus-derived murine IL-4 or purified murine rIFN-γ (Sigma-Aldrich).

CTL assay

Cells of the H-2d FcR+ mastocytoma line P815 were labeled with Na51CrO4 (Amersham Pharmacia Biotech) for 60 min at 37°C and then washed twice in growth medium. Labeled target cells (5 × 103) were incubated for 4–5 h at 37°C with T cells in 200 μl in round-bottom 96-well plates. In the case of anti-CD3/8/11a-stimulated T cells, anti-CD3 Ab (2C11; 1–3 μg/ml) was added to bridge T cells with target cells (redirected 51Cr release assay). Pooled clones or cells from bulk cultures were serially diluted for addition to target cells. In clonal assays, half of each T cell clone was spot tested without further dilution. Harvested supernatant was dried onto 96-well solid Lumaplates (Packard Instrument, Meriden, CT) before the radioactivity was counted in a Topcount microplate scintillation counter (Packard Instrument). For perforin inhibition experiments, T cells (110 μl) were preincubated with 91 ng/ml concanamycin A (Sigma-Aldrich; stock dissolved in DMSO at 100 μg/ml) or the DMSO diluent control for 2–3 h at 37°C before addition to the target cells. Spontaneous lysis of target cells was typically <12%, and differences in sample release, performed in duplicate, were within 5%. Total 51Cr release from target cells was obtained by lysis in 1% SDS. The percentage specific lysis was calculated by the following formula: 100 × [(sample cpm − spontaneous release cpm)/(total release cpm − spontaneous release cpm)].

Immunoblot analysis

Western blot analysis was performed essentially as described (32). Briefly, cells were washed in PBS and lysed in protein sample buffer (2% SDS; 5% α-monothioglycerol (Sigma-Aldrich); 10% glycerol; 60 mM Tris-HCl (pH 6.8); 0.001% bromophenol blue) with sonication and then boiling for 5 min. Total protein samples of 3 × 105 cells and a protein standard mix (Kaleidoscope; Bio-Rad, Hercules, CA) were subjected to 10% SDS-PAGE and electro-transferred onto ECL-nitrocellulose filters (Amersham Pharmacia Biotech) using a minigel system (Bio-Rad). Filters were stained with Ponceau S (Sigma-Aldrich) to reveal total protein and were then preincubated for 1 h in Blotto buffer (PBS, 0.1% Tween 20, 5% skim milk) at room temperature. Filters were incubated with anti-perforin Ab (10 μg/ml, diluted in Blotto) for 3 h, then washed three times for 10 min each in PBS-0.1% Tween 20, and finally incubated for 1 h with HRP-conjugated anti-IgG at a 1/1000 dilution. The filters were washed as outlined above,and the reactions were visualized using the ECL Western blotting detection system (Amersham Pharmacia Biotech). For detection of actin, the same filters were restained with anti-actin Ab (0.5 μg/ml), followed by an HRP-conjugated anti-IgG Ab (1/1000).

RT-PCR and quantitative competitive (QC)-PCR analysis

The detailed protocols for mRNA preparation, cDNA conversion, and amplification were published previously (33, 34). Briefly, RNA was extracted by Nonidet P-40 hypotonic lysis of 1000 cells, and cDNA was prepared using avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI), oligo(dT) primers, and RNase inhibitors. For expression analysis of CD8α and the housekeeping gene β2-microglobulin (β2m), serial dilutions of cDNA (pooled from three replicate preparations) were amplified by PCR using Red Hot polymerase (Advanced Biotechnologies, Leatherhead, U.K.), dNTPs, and the cDNA-specific primer pair CD8α-F2 (5′-TCCTTCAGAAAGTGAACTCTAC), CD8α-R2 (5′-AGATGTAAATATCACAGGCG), or mβ2M-F (5′-TGACCGGCTTGTATGCTATC), mβ2M-R (5′- CAGTGTGAGCCAGGATATAG), respectively. PCR products were analyzed by agarose gel electrophoresis and sequenced. QC-PCR of three replicate cDNA samples was performed with Red Hot polymerase, dNTPs, competitor plasmid, and one of the primer pairs specific for cDNA of perforin (In-F, 5′-CAAGCAGAAGCACAAGTTCGT; In-R, 5′-CGTGATAAAGTGCGTGCCATA), granzyme A (In-F, CTCAAGACCGTATATGGCTCT; In-R, 5′-CCTGCACAAATCATGTTTAGT), granzyme B (In-F, 5′-ACTTTCGATCAAGGATCAGCA; In-R, 5′-ACTGTCAGCTCAACCTCTTGT), granzyme C (In-F, 5′-GGCTCACAACATCAAGGCTAA; In-R, 5′-AACTTCGTGCAGTGTTTTTGG), and FasL (In-F, 5′-GTTTTTCCCTGTCCATCTTG; In-R, 5′-TCCAGAGATCAGAGCGGTTC), with the reverse primers being biotinylated at their 5′ ends. Each of the competitor plasmids encoded the corresponding PCR product sequence with a small deletion and was tested in 5-fold dilutions against a fixed amount of cDNA. PCR products were captured on streptavidin-coated plates, hybridized with FITC-labeled probes specific for either the cDNA or competitor product, and quantitated with an alkaline phosphatase-conjugated anti-FITC Ab and 4-nitrophenylphosphate (Boehringer Mannheim, Indianapolis, IN). PCR amplification (25-μl assay in 96-well plates) was performed using an Omnigene thermal cycler (Thermo Hybaid, Middlesex, U.K.) and the following conditions: one cycle of 96°C for 4 min then 60°C for 1 min and 72°C for 1.5 min, followed by 39 cycles of 94°C for 0.5 min then 60°C for 1 min and 72°C for 1.5 min. For CD8α amplification, the annealing temperature was reduced to 56°C.

Results

IL-4 depresses cytolytic function in developing CD8+ T cell clones

We investigated how IL-4 influences cytolytic activity and production of IFN-γ and IL-4 during the development of clones from individual CD8+ T cells of naive phenotype. An accessory cell-free culture system was used to limit the influence of endogenous cytokines on cell differentiation. Single CD8+CD44low T cells purified from lymph nodes of normal C57BL/6 mice were stimulated with IL-2 and immobilized Abs to CD3, CD8, and CD11a, either in the absence of other cytokines (neutral conditions) or in the presence of IL-4 and neutralizing anti-IFN-γ Ab (type 2-polarizing conditions). After 8 days, cultures were scored microscopically for clone size, washed in situ to remove exogenous IL-4 and soluble Ab, and then incubated for another day in medium containing IL-2 to allow the secretion of cytokines in response to the immobilized anti-receptor Ab. At day 9, supernatants were harvested for cytokine assay, and cytolytic activity was measured by transferring clones into a redirected 51Cr release assay with the FcR+ tumor P815 cells to which bridging anti-CD3 Ab was added to bypass the requirement for peptide/MHC recognition.

Fig. 1⇓A shows the relationship between clone size and each of the three measured functions. In this and other experiments, cloning efficiencies were routinely in the range 86–97%, and most clones contained at least 1000 cells and therefore had undergone at least 11 divisions at the time of assay. Cytolytic activity and IL-4 and IFN-γ production were generally undetectable in clones of fewer than 100 cells. Both the frequencies of positive clones and their mean activities in each assay rose with clone size above this 100-cell threshold.

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

Effect of IL-4 on primary CD8 T cell clones. Single T cells (CD8+CD44low) from C57BL/6 mice were stimulated in 96-well plates with IL-2 and immobilized anti-CD3/8/11a Abs in the absence or presence of IL-4 and a neutralizing IFN-γ Ab as indicated. After 8 days, cells were washed in situ and incubated in the same wells in medium with IL-2 only for 1 day. Cytolytic function of the T cell clones was spot tested in a redirected 51Cr release assay using P815 target cells and bridging anti-CD3 Ab. IL-4 secretion was measured by spot test ELISA, and IFN-γ production was measured in a growth inhibition assay using WEHI-279 cells. Each cell clone is represented by a single dot and the threshold for positive assay readings is illustrated by a broken line. A, The relationship between clone size (0, no cells; 1, 1–102 cells; 2, 102–103 cells; 3, 103–104 cells; 4, >104 cells) and cytolysis or cytokine production is shown. The percentage of clones (n = 93–96) positive for the indicated function is given. B, The relationship between cytolysis and cytokine production is shown for clones of size 1–4. Frequencies in each quadrant are given in percentages.

The majority of clones that developed in neutral conditions were cytolytic and secreted IFN-γ; very few secreted IL-4. These cytolytic clones and the rare IL-4-producing clones were contained within the IFN-γ-secreting group (Fig. 1⇑B). By contrast, most clones that developed in type 2-polarizing conditions produced IL-4. Preliminary experiments in which IL-4 was included at concentrations from 0.033 to 33 U/ml established that the frequency of IL-4-producing clones was highest when IL-4 was added at 0.33–3.3 U/ml, whereas cloning efficiency was not significantly affected at any dose tested; therefore, 3.3 U/ml was used in all experiments reported here. In general, initial clone growth was slower under type 2-polarized conditions. However, by day 9, there was no significant difference in average clone size between the neutral and type 2-polarizing culture conditions. Addition of a neutralizing anti-IL-4 Ab (BVD4, 10 μg/ml) to such cultures at day 0 completely inhibited the induction of IL-4 synthesis (data not shown). The frequency and mean activity of IFN-γ-producing clones in type 2-polarizing conditions were slightly reduced compared with clones generated in neutral conditions (Fig. 1⇑A). In contrast, both the frequency and mean activity of cytolytic clones were markedly lower in type 2-polarizing than in neutral conditions, especially among IL-4-producing clones. Clones obtained in type 2-polarizing conditions fell into three main groups, ranked by frequency: IFN-γ+IL-4+CTL−, IFN-γ+IL-4+CTL+, and IFN-γ−IL-4+CTL− (Fig. 1⇑B).

Table I⇓ summarizes the functions of 871 T cell clones derived from CD8+CD44low cells in four independent experiments. The type 2-polarizing conditions always significantly reduced the frequency of cytolytic T cell clones and increased the frequency of IL-4 producers compared with neutral conditions. In contrast, the reduction in IFN-γ-producing clones was only statistically significant in two of four experiments. Experiment 4 further showed that the effect of type 2-polarizing conditions on both IL-4 production and cytolytic activity was mainly due to the exogenous IL-4, not the anti-IFN-γ Ab.

View this table:
  • View inline
  • View popup
Table I.

Effect of IL-4 on primary CD8 T cell clones

To confirm the naive status of the responding cells in this system, CD44lowCD8+ T cells were further sorted for high expression of CD62L (L-selectin) before cloning. Approximately 98% of CD44lowCD8+ T cells were CD62Lhigh. The effects of IL-4 on IL-4 production and cytolytic activity were similar for CD44low and CD44lowCD62LhighCD8+ T cells (data not shown).

To investigate the mechanisms underlying the effect of IL-4 on cytolytic function, we compared the surface phenotypes of pooled clones grown in neutral and type 2-polarizing conditions (Fig. 2⇓). Whereas CD3 and CD11a expression levels were similar in the two cell populations, many cells in the type 2-polarized population displayed markedly reduced levels of surface CD8α. No significant difference in the viability of pooled clones from the two culture conditions was detected by analysis of propidium iodide uptake or expression of the early apoptotic marker annexin V. In addition, CD44 expression was up-regulated on all cells, regardless of CD8 levels (data not shown). The partial loss of surface CD8 was consistently observed in pooled clones and polyclonal cultures of CD8+ T cells activated with anti-receptor Ab under type 2-polarizing conditions and was detectable as early as day 5 of stimulation. CD8 down-regulation was also seen when anti-IFN-γ Ab or immobilized anti-CD8 Ab were omitted from the cloning cultures and when the usual rIL-4 source was replaced with commercial purified rIL-4 (data not shown).

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

IL-4 induces down-regulation of surface CD8α protein. Individual CD8+CD44low T cells were stimulated with anti-CD3/8/11a Abs in the absence (——) or presence of IL-4 and anti-IFN-γ Ab (– – – –). After 8 days, cells were washed in situ and reincubated as in Fig. 1⇑. Cell clones of sizes 3 and 4 were pooled and analyzed by FACS for cell surface expression of CD8α, CD3ε, and CD11a as indicated. ·····, Unlabeled cells (CD8α) or cells stained with secondary Ab only (CD3ε, CD11a). FL1-H, Fluorescence.

Loss of surface CD8α in type 2-polarized clones correlates with their low cytolytic activity

To determine whether the variation in surface CD8α levels among pooled type 2-polarized clones shown in Fig. 2⇑ was due to differences between clones, we analyzed a series of randomly picked clones of similar size (Fig. 3⇓). The majority of clones grown in neutral conditions were CD8high cells. Most of these clones were cytolytic and produced little or no IL-4. The remaining four clones showed lower CD8 expression, low cytolytic activity, and negligible IL-4 production. In contrast, most clones grown in type 2-polarizing conditions displayed some reduction in CD8 expression. The profiles of individual clones were extremely variable, ranging from 4 to 98% CD8high. There was a broad correlation among loss of CD8 expression, low cytolytic activity, and IL-4 secretion. However, the finding that four of the 42 IL-4-producing clones expressed intermediate CD8 levels (between 48 and 65% CD8high cells per clone) but showed good cytolytic activity (>28% specific lysis) and two other clones expressed high (>89%) CD8 levels but were noncytolytic (<6.7%) indicated that CD8 expression was not the only parameter affecting cytolytic function. It is noteworthy that there was no difference between CD8 T cells originating from the CD44lowCD62Lhigh and CD44low naive phenotype (Fig. 3⇓B, compare squares with circles).

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

IL-4-induced loss of CD8 correlates with lack of cytolysis in clonal populations. Individual CD8+ T cells of naive phenotype were stimulated with anti-CD3/8/11a Abs in the absence or presence of IL-4 and anti-IFN-γ Ab. After 8 days, cells were washed in situ and reincubated as in Fig. 1⇑. Randomly picked clones of size 3 or 4 were analyzed separately for the percentage of CD8high cells and T cell function. A, FACS histograms for CD8α expression of eight clones of CD44low origin that were generated in neutral (left) or type 2-polarizing conditions (right). The percentage of CD8high cells per clone is given above the bar markers. B, Thirty-two clones of CD44low origin (•) and 10 clones of CD44lowCD62Lhigh origin (▪) were generated in neutralizing conditions; 33 clones of CD44low origin (○) and 10 clones of CD44lowCD62Lhigh origin (□) were generated in type 2-polarizing conditions. The relationship between CD8 expression and cytolytic function (top) or IL-4 secretion (bottom) is illustrated. Cytolysis was spot tested in a redirected 51Cr release assay using P815 target cells and anti-CD3 Ab. IL-4 production was spot tested by ELISA and standardized by reference to titrated rIL-4. – – – –, Threshold for positive assay readings. Data are pooled from three separate experiments.

To directly test the correlation between surface CD8 expression and cytolytic activity, pooled clones generated in neutral or type 2-polarizing conditions were sorted for high or low CD8 expression before assay. Fig. 4⇓A shows that CD8low cells from type 2-polarized cultures were at least 25-fold less cytolytic per cell than CD8high cells from the same or neutral cultures, confirming a strong association between CD8 levels and cytolytic activity.

FIGURE 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 4.

Cytolysis is reduced in CD8low cells and by concanamycin A. CD8+CD44low T cells were stimulated for 8 days with anti-CD3/8/11a Abs in the absence or presence of IL-4 and anti-IFN-γ Ab and assayed in a redirected 51Cr release assay using P815 target cells and bridging anti-CD3 Ab. A, Activated T cells from bulk cultures were FACS sorted for CD8 expression before assay. CD8high cells activated without IL-4 (▴); CD8high cells (•) and CD8low cells (○) activated with IL-4 and anti-IFN-γ Ab. B, Clones were stimulated under neutral (top) or type 2-polarizing conditions (bottom). A mixture of size 1–4 cell clones were pooled and pretreated with concanamycin A (▴), medium (•), or DMSO diluent (▪) before assay. The cytolysis of medium-treated T cells was also assayed in the absence of the bridging anti-CD3 Ab (×).

The quantitative effect of exogenous IL-4 on development of cytolytic function was also seen when clones were pooled and titrated in a redirected 51Cr release assay without prior separation into CD8high and CD8low cells. Cytolysis required the bridging anti-CD3 Ab, regardless of culture conditions. Based on lytic units per 106 cells, clones obtained in type 2-polarizing conditions were 4.5-fold less lytic per cell than clones grown in neutral conditions (Fig. 4⇑B, compare upper panel and lower panel). This observation was confirmed over a wide range of E:T ratios in several experiments, which showed that clonal development in the presence of IL-4 and anti-IFN-γ Ab reduced lytic activity by 2.5- to 30-fold (data not shown).

Loss of CD8α expression is accompanied by low expression of perforin and granzymes

The lytic activity of CD8+ T cells stimulated in neutral or type 2-polarizing conditions was markedly reduced (to background or at least 21-fold compared with controls) when the T cells were preincubated with concanamycin A before addition to the redirected 51Cr release assay (Fig. 4⇑B), indicating that lysis was mediated by the perforin pathway (35). Therefore, we analyzed CD8high and CD8low T cells from neutral and type 2-polarized cultures for their expression of perforin and the three most prominent granzymes found in activated murine T cells, granzymes A, B, and C (36). The ∼70-kDa perforin protein complex was readily detected by immunoblot analysis in the CD8high populations purified from neutral and type 2-polarized cultures but was not detected in the CD8low cells from type 2-polarized cultures or in control P815 cells (Fig. 5⇓A). Subsequent staining with anti-actin Ab showed that protein loading was comparable in all lanes.

FIGURE 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 5.

Reduced perforin, granzyme, and CD8α expression in noncytolytic CD8low T cells. CD8+CD44low T cells were activated for 7–8 days in bulk cultures with anti-CD3/8/11a Abs in the absence or presence of IL-4 and anti-IFN-α Ab and then FACS sorted for CD8 expression. A, Total protein expression of the sorted cell populations and the negative control cell line P815 was analyzed by immunoblot using an anti-perforin Ab. The blot was subsequently restained with an anti-actin Ab. The molecular mass (kDa) and the positions of perforin and actin are indicated. B, The numbers of perforin and granzyme (granz) A, B, and C mRNA molecules of the sorted cell populations were analyzed by QC-PCR. Shown are average results and SDs obtained from three replicate samples of the equivalent of 10 cells: CD8high cells activated in neutral conditions (▪); CD8high cells (□) and CD8low cells (▦) activated in type 2-polarizing conditions. C, RT-PCR was performed for CD8α and the housekeeping gene β2m using 4-fold serial dilutions of the cDNAs (left to right) from the sorted cell populations.

Levels of perforin and granzyme A, B, and C mRNA expression were determined by QC-PCR (Fig. 5⇑B). Expression of each product was markedly lower in CD8low cells than in CD8high cells from type 2-polarized cultures: 2.8-fold for perforin (p < 0.03, t test), 4.7-fold for granzyme A (p < 0.07), 8.9-fold for granzyme B (p < 0.04), and 81-fold for granzyme C (p < 0.006). Comparable results were obtained in three independent experiments. Although the product ratios between the three populations varied from experiment to experiment, CD8low cells were consistently found to express lower levels of perforin and granzyme A, B, and C mRNAs than CD8high cells from the same type 2-polarized cultures. This down-regulation of gene expression was selective for perforin and granzymes because levels of β2m mRNA were similar in all three populations and IL-4 mRNA levels were 1.7-fold increased in the CD8low population (data not shown).

To investigate whether the reduction in surface CD8 protein levels was reflected at the mRNA level, expression of CD8α and the control gene β2m was analyzed by RT-PCR (Fig. 5⇑C). CD8α mRNA levels were at least 16-fold lower in the sorted CD8low population from type 2-polarized cultures than in the CD8high populations obtained from these cultures or under neutral conditions. Sequencing of the PCR products confirmed their identity (data not shown). The IL-4-dependent reduction in surface CD8 levels therefore was likely to be due at least partly to lower transcription and/or higher turnover of CD8α mRNA.

We also analyzed mRNA and cell surface protein expression of FasL/CD95 ligand by QC-PCR and FACS, respectively. To amplify the FasL signal detected by FACS, a combination of anti-FasL Ab, biotinylated anti-hamster IgG, and PE-conjugated streptavidin was used. However, FasL mRNA and protein expression was very low in the CD8high and CD8low cell populations, regardless of the culture conditions (data not shown). This result and the data in Fig. 4⇑B were consistent with a previous report indicating that the perforin/granzyme pathway, rather than FasL-Fas interaction, is the major mechanism by which P815 target cells are lysed by activated CD8+ T cells (37). Taken together, the data suggest that the effect of IL-4 on the cytolytic function of primary CD8+ T cell clones is mediated, at least in part, at the level of perforin and granzyme expression.

The effect of IL-4 on cytolytic function is also observed in allogeneic MLR

To examine whether IL-4 also affected CD8 expression and cytolytic function in Ag-stimulated T cells, CD8+CD44low T cells from lymph nodes of untreated C57BL/6 (H-2b) mice were stimulated in an MLR with irradiated DBA/2 (H-2d) spleen cells and IL-2 with or without IL-4 for 7 days. When the unfractionated populations were then assayed for cytolytic activity in a 51Cr release assay with P815 (H-2d) target cells, no difference was observed between cells grown in the presence or absence of IL-4 (Fig. 6⇓A), in contrast to results presented above for cells activated with anti-receptor Ab. However, FACS analysis revealed significant down-regulation of surface CD8 expression on a proportion of cells (18%) from type 2-polarized cultures (Fig. 6⇓B). CD8low and CD8high cells were therefore purified from neutral and type 2-polarized cultures and assayed for cytolytic activity against P815 target cells. Fig. 6⇓C shows that the lytic activity of the CD8low population generated with IL-4 was ∼10-fold lower than that of either of the two CD8high populations. From this and three other experiments, it was concluded that IL-4 down-regulated surface CD8 expression and depressed cytolytic function in a subpopulation of CD8 T cells activated in the MLR.

FIGURE 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 6.

Effects of IL-4 on CD8 T cells activated by MLR. CD8+CD44low T cells (H-2b) were stimulated for 8 days with allogeneic (H-2d) γ-irradiated APCs and IL-2 in an MLR in the absence or presence of IL-4. Activated cells were then assayed for cytolysis and cell surface expression. A, T cells activated without (▴) or with (•) IL-4 were assayed for cytolysis of 51Cr-labeled allogeneic P815 target cells. B, FACS analysis of CD8α expression of T cells activated without (——) or with (– – – –) IL-4. C, Activated T cells were FACS sorted for CD8 expression before assay with 51Cr-labeled allogeneic P815 target cells: CD8high cells activated without IL-4 (▴); CD8high cells (•) and CD8low cells (○) activated with IL-4.

CD8low cells can synthesize cytokines in response to target cells

Because IL-4-induced CD8low cells displayed reduced lysis of P815 target cells via bridging anti-CD3 Ab or alloantigens, we analyzed whether these cells were also impaired in their ability to respond to target cells by producing cytokines. CD8+CD44low T cells were activated with anti-receptor Ab or allogeneic cells in the presence or absence of IL-4, then sorted for high or low CD8 expression. The sorted populations were restimulated with P815 cells in the presence or absence of bridging anti-CD3 Ab or with immobilized Ab to CD3, CD8, and CD11a for 24 h. As shown in Fig. 7⇓, all populations produced substantial titers of IFN-γ in response to both P815 and immobilized Ab; CD8low cells produced 5- to 6-fold lower titers than CD8high cells from the same cultures in response to each type of stimulus. Significant IL-4 secretion, in contrast, was only detected in supernatants of cells that had been exposed to exogenous IL-4 during priming and was generally higher in cultures of CD8low cells than in the corresponding CD8high cells. The reciprocal relationship between IL-4 and IFN-γ production by CD8low and CD8high cells was observed in four different experiments. The results show that the IL-4-induced CD8low populations generated in response to anti-receptor Ab or allogeneic cells retained the capacity to produce cytokines in response to target cells against which they displayed a reduced lytic activity.

FIGURE 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 7.

Cytokine profiles in activated CD8high and CD8low T cells. A, CD8+CD44low T cells were activated in MLR as outlined in Fig. 6⇑ in the absence (▪) or presence of IL-4, and the IL-4-treated cells were subsequently FACS sorted for high (□) and low (▦) CD8 expression. Cytokines were induced for 24 h using allogeneic P815 cells, plate-bound anti-CD3/8/11a Abs, or medium control, as indicated on the x-axis. Secreted cytokines were measured by ELISA; – – – –, Detection limits of the assays. B, CD8+CD44low T cells were activated with anti-CD3/8/11a Abs as outlined in Fig. 5⇑ and then FACS sorted for CD8 expression: CD8high cells activated without IL-4 (▪); CD8high cells (□) and CD8low cells (▦) activated with IL-4 and anti-IFN-γ Ab. Cytokines were induced for 24 h using P815 cells and bridging anti-CD3 Ab, plate-bound anti-CD3/8/11a Abs, or medium control, as indicated on the x-axis.

Discussion

Here we show that exposure to IL-4 during primary activation promotes the development of a subpopulation of CD8+ T cells that down-regulate CD8α, have minimal cytolytic activity, and synthesize both IL-4 and IFN-γ. Cells of this phenotype were identified in cultures activated with Abs to CD3, CD8, and CD11a or with alloantigens. However, the coexistence of variable proportions of CD8high, cytolytic IFN-γ+IL-4+ T cells in the same cultures, and even within the same clones, often led to masking of the noncytolytic phenotype and may explain why some previous studies did not detect these cells. The finding that the noncytolytic phenotype was associated with low expression of surface CD8 protein and of perforin and granzyme mRNAs suggests that the poor cytolytic activity of these cells in 51Cr release assays reflected the dual impairment of target cell recognition and the lethal hit.

Most of the experiments reported here were performed in clonal cultures stimulated with anti-receptor mAb and IL-2 in which the great majority of single CD8+CD44low T cells give rise to clones over ∼8 days. When IL-2 was the only cytokine added, most clones were cytolytic and produced IFN-γ without IL-4. Inclusion of IL-4 with or without anti-IFN-γ mAb in these cultures from day 0 did not interfere with clonal expansion but resulted in the formation of clones of variable functional phenotype. Separation of cells from pooled IL-4-exposed clones based on their surface CD8α levels showed that this marker distinguished a noncytolytic CD8low fraction from the typical cytolytic CD8high population, with both populations secreting IL-4. Similar cells could be identified in bulk cultures stimulated with anti-receptor mAb and in one-way MLR established with purified CD8+CD44low responder cells.

Erard et al. (4) previously found that exposure to IL-4 during activation of murine CD8+ T cells with either PMA and ionomycin or with alloantigens led to the development of CD8− cells with low cytolytic activity, perforin expression, and IFN-γ production and elevated production of type 2 cytokines. However, other groups reported no differences in the cytolytic activity or CD8 levels expressed by CD8+ T cells activated in the presence or absence of IL-4 in various Ag-driven systems, although IL-4 did induce IL-4 synthesis (5, 24, 25, 26). The CD8 marker appears to offer a key to explaining these conflicting results. Data shown in two of these reports reveal some loss of surface CD8 expression, by up to 22% of cells activated in MLR in the study of Sad et al. (24) and a small unspecified number in the study of Carter and Dutton (25). In our hands, the percentage of CD8low cells was affected by several parameters, including the duration of culture and the initial ratio of responder to stimulator cells in MLR (CD8 down-regulation increased with time and lower ratio; data not shown). Later work by Erard et al. (38) showing that TGF-β antagonized the effect of IL-4 on cytolysis and CD8 expression suggests another factor that might contribute to the lesser effect of IL-4 in MLR and other APC-dependent systems compared with the APC-free anti-receptor mAb system used here. We observed in different MLR and anti-CD3/8/11a Ab stimulation experiments (by varying culture time) that the effect of IL-4 on cytolytic activity was generally undetectable in cultures where fewer than ∼25% of cells had down-regulated CD8 (data not shown). In these cases, FACS purification of the CD8low cells was necessary to demonstrate the presence of a noncytolytic population. Therefore, the presence of such cells might not have been detected in some earlier studies.

Others have also reported that type 2-polarized CD8 T cells could provide B cell help (4, 23, 24). In our hands, the noncytolytic CD8low fraction induced ∼10-fold higher levels of IgM and IgG1 when irradiated and cocultured with splenic B cells in the presence of immobilized anti-CD3 Ab, compared with CD8high cells derived from the same type 2-polarized culture (N.K., unpublished observations).

The noncytolytic CD8low subpopulations we identified in anti-receptor mAb-activated cultures and MLR secreted IFN-γ as well as IL-4, although average IFN-γ titers were lower than in type 2-polarized cultures of CD8high cells. This finding calls into question the value of IFN-γ as a surrogate marker for CTL in systems where IL-4 may be present. In the absence of a single-cell assay for cytolytic activity, ELISpot and FACS analysis of intracellular IFN-γ are widely used to count CD8+ effector cells, based on the strong positive correlation between IFN-γ titers and cytolytic activity observed at the population level in many responses. The results obtained here indicate that such methods would overestimate CTL numbers if they detected cells of the IFN-γ-producing noncytolytic phenotype described here.

Isolation of CD8low cells from IL-4-exposed cultures identified a poorly cytolytic population with significantly lower levels of mRNA for perforin and granzymes A, B, and C than the cytolytic CD8high fraction obtained from the same cultures or from cultures activated under neutral conditions. This suggests at least two mechanisms by which IL-4 may have reduced cytolytic activity.

The first is reduction of target cell recognition due to low CD8 coreceptor expression. Early work showing that cytolytic activity of T cells activated in MLR can be reduced by blocking surface CD8 with soluble Abs or by selective removal of CD8 with trypsin led to the suggestion that CD8 stabilizes low-affinity interactions between TCR and class I MHC complexes (39). Subsequent studies have shown that CD8 reduces the off-rate of this interaction, indicating that it is an active participant in the recognition complex (40). The mechanism of the effect of IL-4 on CD8 levels is not known. We show here that CD8α expression was down-regulated at both the mRNA and surface protein levels, suggesting effects on transcription rate and/or mRNA turnover. Given the role of the GATA-3 transcription factor in promoting IL-4 and IL-5 gene transcription and potentiating type 2 T cell polarization (41, 42), it is notable that the murine CD8α promoter contains three functional GATA-3 binding sites (43). The loss of surface CD8 expression did not depend on CD8 ligation because it was observed in the anti-receptor Ab-driven system when anti-CD8 Ab was omitted, and it persisted for at least 6 days when cells were transferred into IL-4-free medium, with or without immobilized anti-CD3/8/11a Abs, after a week of IL-4 exposure (data not shown). Therefore, the data we have to date suggest that the CD8low characteristic is a stable differentiated phenotype, rather than a transient response to IL-4 exposure or CD8 ligation.

The second candidate mechanism for the effect of IL-4 on cytolytic activity is a reduction of granule cytotoxicity due to low perforin and granzyme synthesis. Erard et al. (4) previously showed a correlation between low cytolysis and low perforin mRNA levels by Northern analysis. In the present study, analysis of perforin expression by RT-PCR and immunoblot demonstrated that this mediator was markedly lower at both the mRNA and protein levels in CD8low cells than in the CD8high fraction. Although granzyme expression could only be assessed at the mRNA level because of lack of reagents for protein detection, the data presented here suggest a substantial effect of IL-4 on the expression of three of these proteases, granzymes A, B, and C. This effect was most profound for granzyme C. Perforin is known to play a crucial role in the granule exocytic pathway of cytotoxicity (36, 44, 45), whereas granzyme B contributes to the rapid apoptotic death detected in 51Cr release assays (46, 47) and granzyme A has been proposed to act independently of granzyme B (48). The function of granzyme C, however, is enigmatic, and only one report has attributed any role to this mediator in lymphocyte cytotoxicity (49). For the moment, the significance of its inhibition by IL-4 is obscure.

The negligible expression of perforin and granzymes in the CD8low population was not due to failed activation because these cells secreted substantial titers of both IFN-γ and IL-4 in response to anti-CD3 Ab or Ag stimulation, and they expressed high levels of the activation marker CD44. It is difficult to ascertain whether the loss of surface CD8 impaired their recognition of stimulator cells for cytokine production, but it is notable that the opposite IFN-γ/IL-4 ratios produced by CD8low and CD8high cells were observed in response to both types of stimulus, suggesting that this reversal was intrinsic to the producing cells rather than a differential response to different stimuli.

Whereas it is clear that IL-4 actively down-regulated expression of CD8 (because this coreceptor was expressed on all starting cells), it is not clear whether it prevented the initial onset of perforin and granzyme expression in newly activated CD8+ T cells (for example, by counteracting signals that make these genes available for transcription through demethylation or other processes) or whether it down-regulated the expression of these genes after they had been activated. Experiments are in progress to attempt to track this pathway in developing clones. Similarly, it remains to be determined whether there is a tight linkage between the loss of CD8 expression and low or absent perforin and granzyme expression. Such a linkage is supported, however, by a study using β2m-deficient mice that found that failed CD8-TCR engagement resulted in down-regulation of CD8 and granzyme B mRNA in CD8+ T cells; CD8α expression was silenced by promoter methylation (50). The fact that IL-4 was expressed by both CD8low and CD8high cells indicates that the IL-4-induced loss of CD8 expression was not tightly linked to the induction of IL-4 synthesis.

There are several previous studies that show the signature of IL-4-induced CD8 T cell immune deviation in vivo. For example, human CD8 T cells from HIV-infected patients produce IL-4 (8), and during HIV infection there is a switch of cytolytic type 1-polarized CD8 T cells to cells that make type 2 cytokines and lack cytolysis and/or CD8 expression (8, 51). In some viral immunity models in mice, expression of IL-4 down-regulates cytolytic T cell function with subsequent delay or even breakdown of virus clearance in the challenged animal (11, 12, 15, 17, 18). In light of the results reported here, further investigation on the linkage among CD8 expression, type 2 cytokine expression, and cytolytic function should lead to a deeper understanding of immune deviation of CD8 T cell responses in vivo.

Acknowledgments

We thank Paula Hall and Grace Chojnowski for their skillful assistance with FACS; Marion Buck, Leanne Morrison, and Stuart Olver for technical help; and Dr. Eugene Maraskovsky for generously providing Abs.

Footnotes

  • ↵1 This work was supported by the National Health and Medical Research Council of Australia, the Queensland Cancer Fund (Australia), and the National Institutes of Health (Grant F06 TWO2333, to T.K.).

  • ↵2 Address correspondence and reprint requests to Dr. Norbert Kienzle, Queensland Institute of Medical Research, Post Office, Royal Brisbane Hospital, Qld 4029, Australia. E-mail address: norbertK{at}qimr.edu.au

  • 3 Abbreviations used in this paper: FasL, Fas ligand; QC, quantitative competitive; β2m, β2-microglobulin.

  • Received August 20, 2001.
  • Accepted December 6, 2001.
  • Copyright © 2002 by The American Association of Immunologists

References

  1. ↵
    Mosmann, T. R., R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7: 145
    OpenUrlCrossRefPubMed
  2. ↵
    Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787
    OpenUrlCrossRefPubMed
  3. ↵
    Seder, R. A., J. L. Boulay, F. Finkelman, S. Barbier, S. Z. Ben Sasson, G. Le Gros, W. E. Paul. 1992. CD8+ T cells can be primed in vitro to produce IL-4. J. Immunol. 148: 1652
    OpenUrlAbstract
  4. ↵
    Erard, F., M. T. Wild, J. A. Garcia-Sanz, G. Le Gros. 1993. Switch of CD8 T cells to noncytolytic CD8−CD4− cells that make TH2 cytokines and help B cells. Science 260: 1802
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Croft, M., L. Carter, S. L. Swain, R. W. Dutton. 1994. Generation of polarized antigen-specific CD8 effector populations: reciprocal action of interleukin (IL)-4 and IL-12 in promoting type 2 versus type 1 cytokine profiles. J. Exp. Med. 180: 1715
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Kelso, A., P. Groves. 1997. A single peripheral CD8+ T cell can give rise to progeny expressing type 1 and/or type 2 cytokine genes and can retain its multipotentiality through many cell divisions. Proc. Natl. Acad. Sci. USA 94: 8070
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Salgame, P., J. S. Abrams, C. Clayberger, H. Goldstein, J. Convit, R. L. Modlin, B. R. Bloom. 1991. Differing lymphokine profiles of functional subsets of human CD4 and CD8 T cell clones. Science 254: 279
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Maggi, E., M. G. Giudizi, R. Biagiotti, F. Annunziato, R. Manetti, M. P. Piccinni, P. Parronchi, S. Sampognaro, L. Giannarini, G. Zuccati. 1994. Th2-like CD8+ T cells showing B cell helper function and reduced cytolytic activity in human immunodeficiency virus type 1 infection. J. Exp. Med. 180: 489
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Golumbek, P. T., A. J. Lazenby, H. I. Levitsky, L. M. Jaffee, H. Karasuyama, M. Baker, D. M. Pardoll. 1991. Treatment of established renal cancer by tumor cells engineered to secrete interleukin-4. Science 254: 713
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Bachmann, M. F., H. Schorle, R. Kuhn, W. Muller, H. Hengartner, R. M. Zinkernagel, I. Horak. 1995. Antiviral immune responses in mice deficient for both interleukin-2 and interleukin-4. J. Virol. 69: 4842
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Moran, T. M., H. Isobe, A. Fernandez-Sesma, J. L. Schulman. 1996. Interleukin-4 causes delayed virus clearance in influenza virus-infected mice. J. Virol. 70: 5230
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Sharma, D. P., A. J. Ramsay, D. J. Maguire, M. S. Rolph, I. A. Ramshaw. 1996. Interleukin-4 mediates down regulation of antiviral cytokine expression and cytotoxic T-lymphocyte responses and exacerbates vaccinia virus infection in vivo. J. Virol. 70: 7103
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Bembridge, G. P., J. A. Lopez, R. Cook, J. A. Melero, G. Taylor. 1998. Recombinant vaccinia virus coexpressing the F protein of respiratory syncytial virus (RSV) and interleukin-4 (IL-4) does not inhibit the development of RSV-specific memory cytotoxic T lymphocytes, whereas priming is diminished in the presence of high levels of IL-2 or gamma interferon. J. Virol. 72: 4080
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Schüler, T., Z. Qin, S. Ibe, N. Noben-Trauth, T. Blankenstein. 1999. T helper cell type 1-associated and cytotoxic T lymphocyte-mediated tumor immunity is impaired in interleukin 4-deficient mice. J. Exp. Med. 189: 803
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Aung, S., Y. W. Tang, B. S. Graham. 1999. Interleukin-4 diminishes CD8+ respiratory syncytial virus-specific cytotoxic T-lymphocyte activity in vivo. J. Virol. 73: 8944
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Villacres, M. C., C. C. Bergmann. 1999. Enhanced cytotoxic T cell activity in IL-4-deficient mice. J. Immunol. 162: 2663
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Kaji, M., M. Kobayashi, R. B. Pollard, F. Suzuki. 2000. Influence of type 2 T cell responses on the severity of encephalitis associated with influenza virus infection. J. Leukocyte Biol. 68: 180
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Jackson, R. J., A. J. Ramsay, C. D. Christensen, S. Beaton, D. F. Hall, I. A. Ramshaw. 2001. Expression of mouse interleukin-4 by a recombinant ectromelia virus suppresses cytolytic lymphocyte responses and overcomes genetic resistance to mousepox. J. Virol. 75: 1205
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Widmer, M. B., K. H. Grabstein. 1987. Regulation of cytolytic T-lymphocyte generation by B-cell stimulatory factor. Nature 326: 795
    OpenUrlCrossRefPubMed
  20. ↵
    Pfeifer, J. D., D. T. McKenzie, S. L. Swain, R. W. Dutton. 1987. B cell stimulatory factor 1 (interleukin 4) is sufficient for the proliferation and differentiation of lectin-stimulated cytolytic T lymphocyte precursors. J. Exp. Med. 166: 1464
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Horohov, D. W., J. A. Crim, P. L. Smith, J. P. Siegel. 1988. IL-4 (B cell-stimulatory factor 1) regulates multiple aspects of influenza virus-specific cell-mediated immunity. J. Immunol. 141: 4217
    OpenUrlAbstract
  22. ↵
    Trenn, G., H. Takayama, J. Hu-Li, W. E. Paul, M. V. Sitkovsky. 1988. B cell stimulatory factor 1 (IL-4) enhances the development of cytotoxic T cells from Lyt-2+ resting murine T lymphocytes. J. Immunol. 140: 1101
    OpenUrlAbstract
  23. ↵
    Cronin, D. C., R. Stack, F. W. Fitch. 1995. IL-4-producing CD8+ T cell clones can provide B cell help. J. Immunol. 154: 3118
    OpenUrlAbstract
  24. ↵
    Sad, S., R. Marcotte, T. R. Mosmann. 1995. Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity 2: 271
    OpenUrlCrossRefPubMed
  25. ↵
    Carter, L. L., R. W. Dutton. 1995. Relative perforin- and Fas-mediated lysis in T1 and T2 CD8 effector populations. J. Immunol. 155: 1028
    OpenUrlAbstract
  26. ↵
    Cerwenka, A., L. L. Carter, J. B. Reome, S. L. Swain, R. W. Dutton. 1998. In vivo persistence of CD8 polarized T cell subsets producing type 1 or type 2 cytokines. J. Immunol. 161: 97
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Maraskovsky, E., A. B. Troutt, A. Kelso. 1992. Co-engagement of CD3 with LFA-1 or ICAM-1 adhesion molecules enhances the frequency of activation of single murine CD4+ and CD8+ T cells and induces synthesis of IL-3 and IFN-γ but not IL-4 or IL-6. Int. Immunol. 4: 475
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Fitzpatrick, D. R., A. Kelso. 1995. Dissociated expression of granulocyte-macrophage CSF and IL-3 in short-term T cell clones from normal mice. J. Immunol. 155: 5140
    OpenUrlAbstract
  29. ↵
    Groves, P. L., M. H. Pech, A. B. Troutt, A. Kelso. 1994. Limiting dilution analysis reveals the precursors of interleukin-4-producing CD4+ cells induced by protein immunization. Immunology 83: 25
    OpenUrlPubMed
  30. ↵
    Doyle, A. G., L. Ramm, A. Kelso. 1998. The CD4+ T-cell response to protein immunization is independent of accompanying IFN-γ-producing CD8+ T cells. Immunology 93: 341
    OpenUrlCrossRefPubMed
  31. ↵
    Kelso, A., P. Groves, A. B. Troutt, M. H. Pech. 1994. Rapid establishment of a stable IL-4/IFN-γ production profile in the antigen-specific CD4+ T cell response to protein immunization. Int. Immunol. 6: 1515
    OpenUrlAbstract/FREE Full Text
  32. ↵
    Kienzle, N., D. B. Young, D. Liaskou, M. Buck, S. Greco, T. B. Sculley. 1999. Intron retention may regulate expression of Epstein-Barr virus nuclear antigen 3 family genes. J. Virol. 73: 1195
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Fitzpatrick, D. R., K. M. Shirley, L. E. McDonald, H. Bielefeldt-Ohmann, G. F. Kay, A. Kelso. 1998. Distinct methylation of the interferon γ (IFN-γ) and interleukin 3 (IL-3) genes in newly activated primary CD8+ T lymphocytes: regional IFN-γ promoter demethylation and mRNA expression are heritable in CD44high CD8+ T cells. J. Exp. Med. 188: 103
    OpenUrlAbstract/FREE Full Text
  34. ↵
    Doyle, A. G., K. Buttigieg, P. Groves, B. J. Johnson, A. Kelso. 1999. The activated type 1-polarized CD8+ T cell population isolated from an effector site contains cells with flexible cytokine profiles. J. Exp. Med. 190: 1081
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Kataoka, T., K. Takaku, J. Magae, N. Shinohara, H. Takayama, S. Kondo, K. Nagai. 1994. Acidification is essential for maintaining the structure and function of lytic granules of CTL: effect of concanamycin A, an inhibitor of vacuolar type H(+)-ATPase, on CTL-mediated cytotoxicity. J. Immunol. 153: 3938
    OpenUrlAbstract
  36. ↵
    Smyth, M. J., J. A. Trapani. 1995. Granzymes: exogenous proteinases that induce target cell apoptosis. Immunol. Today 16: 202
    OpenUrlCrossRefPubMed
  37. ↵
    Lee, R. K., J. Spielman, E. R. Podack. 1996. Bcl-2 protects against Fas-based but not perforin-based T cell-mediated cytolysis. Int. Immunol. 8: 991
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Erard, F., J. A. Garcia-Sanz, R. Moriggl, M. T. Wild. 1999. Presence or absence of TGF-β determines IL-4-induced generation of type 1 or type 2 CD8 T cell subsets. J. Immunol. 162: 209
    OpenUrlAbstract/FREE Full Text
  39. ↵
    MacDonald, H. R., A. L. Glasebrook, C. Bron, A. Kelso, J. C. Cerottini. 1982. Clonal heterogeneity in the functional requirement for Lyt-2/3 molecules on cytolytic T lymphocytes (CTL): possible implications for the affinity of CTL antigen receptors. Immunol. Rev. 68: 89
    OpenUrlCrossRefPubMed
  40. ↵
    Garcia, K. C., C. A. Scott, A. Brunmark, F. R. Carbone, P. A. Peterson, I. A. Wilson, L. Teyton. 1996. CD8 enhances formation of stable T-cell receptor/MHC class I molecule complexes. Nature 384: 577
    OpenUrlCrossRefPubMed
  41. ↵
    Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, M. Afkarian, T. L. Murphy. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18: 451
    OpenUrlCrossRefPubMed
  42. ↵
    Ray, A., L. Cohn. 1999. Th2 cells and GATA-3 in asthma: new insights into the regulation of airway inflammation. J. Clin. Invest. 104: 985
    OpenUrlCrossRefPubMed
  43. ↵
    Landry, D. B., J. D. Engel, R. Sen. 1993. Functional GATA-3 binding sites within murine CD8α upstream regulatory sequences. J. Exp. Med. 178: 941
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Kägi, D., B. Ledermann, K. Bürki, P. Seiler, B. Odermatt, K. J. Olsen, E. R. Podack, R. M. Zinkernagel, H. Hengartner. 1994. Cytotoxicity mediated by T cells and natural killer cells is greatly impaired in perforin-deficient mice. Nature 369: 31
    OpenUrlCrossRefPubMed
  45. ↵
    Lowin, B., F. Beermann, A. Schmidt, J. Tschopp. 1994. A null mutation in the perforin gene impairs cytolytic T lymphocyte- and natural killer cell-mediated cytotoxicity. Proc. Natl. Acad. Sci. USA 91: 11571
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Simon, M. M., M. Hausmann, T. Tran, K. Ebnet, J. Tschopp, R. ThaHla, A. Mullbacher. 1997. In vitro- and ex vivo-derived cytolytic leukocytes from granzyme A × B double knockout mice are defective in granule-mediated apoptosis but not lysis of target cells. J. Exp. Med. 186: 1781
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Talanian, R. V., X. Yang, J. Turbov, P. Seth, T. Ghayur, C. A. Casiano, K. Orth, C. J. Froelich. 1997. Granule-mediated killing: pathways for granzyme B-initiated apoptosis. J. Exp. Med. 186: 1323
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Shresta, S., T. A. Graubert, D. A. Thomas, S. Z. Raptis, T. J. Ley. 1999. Granzyme A initiates an alternative pathway for granule-mediated apoptosis. Immunity 10: 595
    OpenUrlCrossRefPubMed
  49. ↵
    Bailey, N. C., C. J. Kelly. 1997. Nephritogenic T cells use granzyme C as a cytotoxic mediator. Eur. J. Immunol. 27: 2302
    OpenUrlCrossRefPubMed
  50. ↵
    Pestano, G. A., Y. Zhou, L. A. Trimble, J. Daley, G. F. Weber, H. Cantor. 1999. Inactivation of misselected CD8 T cells by CD8 gene methylation and cell death. Science 284: 1187
    OpenUrlAbstract/FREE Full Text
  51. ↵
    Schmitz, J. E., M. A. Forman, M. A. Lifton, O. Concepcion, K. A. Reimann, Jr, C. S. Crumpacker, J. F. Daley, R. S. Gelman, N. L. Letvin. 1998. Expression of the CD8α β-heterodimer on CD8+ T lymphocytes in peripheral blood lymphocytes of human immunodeficiency virus− and human immunodeficiency virus+ individuals. Blood 92: 198
    OpenUrlAbstract/FREE Full Text
View Abstract
PreviousNext
Back to top

In this issue

The Journal of Immunology: 168 (4)
The Journal of Immunology
Vol. 168, Issue 4
15 Feb 2002
  • Table of Contents
  • About the Cover
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word about The Journal of Immunology.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
A Clonal Culture System Demonstrates That IL-4 Induces a Subpopulation of Noncytolytic T Cells with Low CD8, Perforin, and Granzyme Expression
(Your Name) has forwarded a page to you from The Journal of Immunology
(Your Name) thought you would like to see this page from the The Journal of Immunology web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
A Clonal Culture System Demonstrates That IL-4 Induces a Subpopulation of Noncytolytic T Cells with Low CD8, Perforin, and Granzyme Expression
Norbert Kienzle, Kathy Buttigieg, Penny Groves, Tom Kawula, Anne Kelso
The Journal of Immunology February 15, 2002, 168 (4) 1672-1681; DOI: 10.4049/jimmunol.168.4.1672

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
A Clonal Culture System Demonstrates That IL-4 Induces a Subpopulation of Noncytolytic T Cells with Low CD8, Perforin, and Granzyme Expression
Norbert Kienzle, Kathy Buttigieg, Penny Groves, Tom Kawula, Anne Kelso
The Journal of Immunology February 15, 2002, 168 (4) 1672-1681; DOI: 10.4049/jimmunol.168.4.1672
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

More in this TOC Section

  • Innate Immunity Together with Duration of Antigen Persistence Regulate Effector T Cell Induction
  • Regulatory Roles of IL-2 and IL-4 in H4/Inducible Costimulator Expression on Activated CD4+ T Cells During Th Cell Development
  • Induction of CD4+ T Cell Apoptosis as a Consequence of Impaired Cytoskeletal Rearrangement in UVB-Irradiated Dendritic Cells
Show more CELLULAR IMMUNOLOGY AND IMMUNE REGULATION

Similar Articles

Navigate

  • Home
  • Current Issue
  • Next in The JI
  • Archive
  • Brief Reviews
  • Pillars of Immunology
  • Translating Immunology

For Authors

  • Submit a Manuscript
  • Instructions for Authors
  • About the Journal
  • Journal Policies
  • Editors

General Information

  • Advertisers
  • Subscribers
  • Rights and Permissions
  • Accessibility Statement
  • Public Access
  • Privacy Policy
  • Disclaimer

Journal Services

  • Email Alerts
  • RSS Feeds
  • ImmunoCasts
  • Twitter

Copyright © 2021 by The American Association of Immunologists, Inc.

Print ISSN 0022-1767        Online ISSN 1550-6606