Isotype-Dependent Inhibition of Tumor Growth In Vivo by Monoclonal Antibodies to Death Receptor 4

Generation of mAbs to human DR4

BALB/c mice were immunized 11 times with 0.5 μg of human DR4-IgG (14) resuspended in monophosphoryl lipid A/trehalose dicorynomycolate adjuvant (Ribi Immunochemicals, Hamilton, MT) into each hind foot pad at 3- to 4-day intervals. Three days after the final boost, popliteal lymph nodes were fused with myeloma cell line P3×63Ag.U.1 (15). Culture supernatants were initially screened for their ability to bind to hDR4-IgG but not to CD4-IgG in a capture ELISA as described previously (15). The selected mAbs were further tested for their ability to block ligand-receptor binding in a capture ELISA (16) and for their ability to recognize cell membrane receptors on 9D cells by flow cytometric analysis as described previously (16). After cloning the selected final hybridomas twice, their Ag specificity as well as their ability to induce apoptosis were determined.

To determine whether mAbs recognized overlapping or spatially distant epitopes, a competitive binding ELISA was performed using biotinylated mAbs as previously described (16). The affinities of these mAbs to DR4-IgG were determined using KinExA, an automated immunoassay system (Sapidyne Instruments, Boise, ID) as previously described (17), and the equilibrium constant was calculated using the software provided by the manufacturer.

Capture ELISA

The binding of mAbs to DR4 was initially determined using a capture ELISA as previously described (16). Briefly, microtiter plates were coated with 50 μl/well of 2 μg/ml of goat Abs specific to the Fc portion of human IgG (Cappel; ICN Pharmaceuticals, Costa Mesa, CA). After washing the plates, nonspecific binding sites were blocked with BSA, and 50 μl/well of 0.4 μg/ml of DR4-IgG was added to wells for 1 h. Plates were then incubated with 50 μl/well of 2 μg/ml of anti-DR4 mAbs (or hybridoma culture supernatants) for 1 h. The bound mAbs were then detected with 50 μl/well of HRP-goat anti-mouse IgG (Cappel), followed by addition of the substrate. Plates were then read at 490 nM with an ELISA plate reader.

Determination of blocking activities

Blocking activities of mAbs were determined in a capture ELISA as described above with a modification. Briefly, DR4-hIgG Fc was captured to goat anti-human IgG Fc Abs, and various concentrations of anti-DR4 mAbs were added. After washing 50 μl of 0.2 μg/ml of Apo2L was added. The Apo2L bound to DR4-IgG was detected by the addition of 50 μl of 1 μg/ml of biotinylated anti-Apo2L mAb 2E9, followed by the addition of HRP-goat anti-mouse IgG.

Determination of cell viability using crystal violet uptake

Adherent cells (4 × 10⁴ cells/100 μl/well) were incubated overnight with serial dilutions of mAbs with or without goat anti-mouse IgG Fc (10 μg/ml) or rabbit complement (RC; Cedarlane Laboratories, Ontario, Canada; final 1/8 dilution). Heat-inactivated rabbit complement was prepared by incubation of rabbit serum at 56°C for 30 min. Serial dilutions of Apo2L/TRAIL (9) prepared in a final volume of 100 μl were added to each plate as a positive control. Each dilution was performed in duplicate. After incubation overnight at 37°C, the medium was removed, and viable cells were stained using crystal violet as previously described (18). The plates were read on an ELISA plate reader at 540 nM.

Flow cytometric analysis of FITC-annexin V binding

Human B lymphoid 9D cells (5 × 10⁵ cells in 100 μl of complete RPMI 1640 medium) were plated in 48-well microplates and were incubated with 100 μl of mAb solution (10 μg/ml) for 15 min on ice. Complete RPMI 1640 medium (2 ml) plus 300 μl of RC (Microbiological Associates, Cedarlane, MD), human complement (Sigma, St. Louis, MO), or human C1q (80 μg/ml; Quidel, San Diego, CA) were added to the wells. After an overnight incubation at 37°C in 5% CO₂, cells were washed in PBS and resuspended in 200 μl of binding buffer (NeXins Research, Hoeven, The Netherlands). The cells were then incubated with 10 μl of 20 μg/ml FITC-annexin V (APOPTEST-FITC; NeXins Research) plus 10 μl of 50 μg/ml propidium iodide in the dark for 15 min at room temperature, washed, and analyzed by flow cytometry.

Poly(ADP-ribose) polymerase (PARP) assay

PARP assay was performed as previously described (19). PARP was detected using HRP-rabbit anti-PARP IgG Abs (BD Biosciences, San Diego, CA). Human B lymphoid 9D cells (5 × 10⁵ cells in 100 μl of complete medium) were treated with 100 μl of mAb solution (10 μg/ml) with or without complement as described above. The cells were harvested and washed in Tris-HCl buffer (50 mM Tris-HCl (pH 7.5), 0.15 M NaCl, 1 mM CaCl₂, and 1 mM MgCl₂) by microcentrifugation. The cells were then lysed in a solution containing 0.5% sodium deoxycholate, 1% Triton X-100, 5 mM EDTA, 10 μg/ml leupeptin, 10 μg/ml aprotinin, and 1 mM PMSF and mixed with an equal volume of 2× SDS buffer. After boiling, proteins were separated on 7.5% SDS-PAGE and transferred to immunoblot polyvinylidene difluoride membranes. The separated intact and cleaved polymerases were detected using HRP-rabbit anti-PARP IgG Abs (Roche, Indianapolis, IN). Bound rabbit anti-PARP IgG Abs were detected using HRP-goat anti-rabbit IgG Abs followed by the ECL detection method (15).

Generation of IgG2a isotype variant of IgG1-4H6 using Ab engineering technique

To determine the influence of different murine IgG isotypes on the anti-tumor activities of anti-DR4 mAbs, the V_H and V_L genes were isolated by PCR amplification of mRNA from the corresponding mAb 4H6 hybridoma as previously described (20) using Taq polymerase. N-terminal amino acid sequences of mAb 4H6 (IgG1) of the light and heavy chains were used to design the sense strand PCR primers, whereas the antisense PCR primers were based on consensus sequences of murine framework 4 of each chain. The 3′ light and heavy chain primers were TGCAGCCACGGWCCGWKT AKYTCCARYTTKGTSSC and GACCGATGGGCCCGTCGTTTTGGCTGM RGARACNGTGAS (W = A/T, K = G/T, B = G/T/C, Y = C/T, R = A/G, S = G/C, M = A/C, N = A/G/T/C), respectively. The 5′ light and heavy chain primers were GCTACAAATGCATACGCTGATATCCAGATGACACAG and GCTACAAACGCGTACGCTCAGGTGCAGCTGAAGGAG, respectively. Amplified DNA fragments were digested with restriction enzymes Nsi and RsrII for light chain and with MluI and ApaI for heavy chain. The variable domain cDNAs of light and heavy chains were separately assembled with the murine Ck and IgG2 CH1-CH2-CH3 domains in plasmid expression vectors. The light chain and heavy chain cDNA vectors were cotransfected into 293 cells for 7 days. Media were harvested, and the secreted IgG2a-4H6 was recovered by affinity purification using protein G.

In vivo analysis of anti-tumor activity

Experiments were conducted essentially as described previously (21). Colo 205 tumor cells were grown in DMEM/F-12 (50/50) medium supplemented with 10% FCS, 2 mM l-glutamine, and antibiotics. Female athymic nude mice (4–6 wk old, seven or eight mice per group) were injected s.c. with 5 × 10⁶ Colo 205 cells in 0.2 ml of HBBS in the dorsal areas. Once tumors reached 50–100 mm³, the mice were grouped randomly, and mAbs were given i.p. in a volume of 0.1 ml. Arrows in figures indicate the starting date of the first mAb treatment. Tumor sizes were determined until mice had to be sacrificed due to tumor necrosis in the control group. All experiments were performed in compliance with the laws and regulations stated in the animal welfare act and the Guide for the Care and Use of Laboratory Animals. Statistical analysis was performed using the nonparametric Wilcoxon test.

Histology

Athymic nude mice bearing Colo 205 xenografts were treated i.p. with 5 mg/kg of anti-DR4 mAbs or IgG1 control mAb 3 days before tumors were excised. Three mice were used for each treatment. The frozen tumor sections were stained with hematoxylin and eosin and examined under the microscope.

In vitro apoptotic activities of anti-DR4 mAbs

Murine mAbs to the CD95 death receptor, anti-Fas (22) and anti-Apo-1 (23, 24), show potent anti-tumor activity. The anti-Fas mAb is a murine IgM, whereas the anti-Apo-1 mAb is a murine IgG3 isotype that tends to aggregate. The multivalency of IgM and aggregated IgG3 may facilitate the oligomerization of CD95, thereby inducing apoptosis of tumor cells. However, these mAbs induce lethal liver toxicity in vivo, which limits their therapeutic potential (25).

To obtain agonistic anti-DR4 mAbs, we immunized mice with a soluble DR4-Fc fusion protein as previously described (16). We screened for IgM and IgG3 mAbs as well as for agonistic activity on human B lymphoma 9D cells, which express DR4 and DR5 (data not shown). None of our DR4-specific mAbs was of the IgM or IgG3 isotype. Some of the mAbs demonstrated weak intrinsic agonistic activity; in the presence of a cross-linking agent such as goat anti-mouse IgG, the agonistic activity was dramatically enhanced. For further studies we selected two anti-DR4 mAbs on the basis of Ig isotype and ability to block Apo2L/TRAIL activity. mAb 4H6 is an IgG1 and exhibits blocking activity, whereas mAb 4G7 is an IgG2a without blocking activity (Table I⇓). Both mAbs demonstrated high affinities to DR4, with K_d⁻¹ values in the range of 5–20 pM, as determined by a KinExA solution phase assay (Sapidyne Instruments) (Table I⇓).

We investigated the cytotoxic activity of these mAbs in vitro on human Colo 205 colon carcinoma cells by crystal violet staining (Fig. 1⇓). The mAb 4H6 alone demonstrated weak cytotoxic activity on Colo 205, whereas mAb 4G7 alone showed no cytotoxic activity (Fig. 1⇓A). However, in the presence of goat anti-mouse IgG-Fc, which can oligomerize murine IgG molecules, both mAbs demonstrated potent agonistic activities on Colo 205 cells (Fig. 1⇓B). Similar observations were made with other human tumor cell lines that express DR4, such as HCT116 colon carcinoma and SK-MES-1 lung carcinoma, but not with normal human microvascular and vascular endothelial cells, which also express DR4 (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Effect of anti-DR4 mAbs on viability of Colo 205 colon carcinoma cells. Tumor cells (4 × 10⁴ cells/well) were incubated overnight with serial dilutions of mAbs in the presence of goat anti-mouse IgG Fc (anti-Fc), RC, or heat-inactivated RC (HIC). Cells treated with Apo2L/TRAIL, anti-Fc Abs, RC, and HIC were also included as controls. After cells were incubated overnight at 37°C, the cell viability was determined using crystal violet staining as previously described (18 ). The plates were read on a plate reader at 540 nM. A, mAb alone; B, mAb plus anti-Fc Abs (10 μg/ml); C, mAb plus RC (1/8 final dilution); and D, mAb plus HIC (1/8 final dilution).

The finding that induction of potent cytotoxic activity by anti-DR4 mAbs in vitro required the cross-linking with goat anti-mouse IgG suggests that oligomerization of DR4 is required for signaling, consistent with the trimeric structure of TNF-related ligands and their complexes with cognate TNF receptor family members (26, 27). To identify a natural linker that could enhance the agonistic activity of the anti-DR4 mAbs without eliciting an Ab response, we explored the possibility of complement, especially, the first complement component, C1q (28, 29, 30), as a linker.

Because complement is known to function in a species-nonspecific manner, and RC is a very effective source of complement (31, 32), we tested the Ab cross-linking ability of commercially available RC. We incubated tumor cells with anti-DR4 mAbs for 30 min and then added complement-containing rabbit serum for an overnight incubation. RC enhanced the agonistic activity of IgG2a mAb 4G7, but not that of IgG1 mAb 4H6 (Fig. 1⇑C), as expected from a previous reports (33, 34) that murine IgG2 (mIgG2) is much more effective than mIgG1 in complement activation. In fact, most murine IgG1 Abs do not activate complement, as shown with mAb 4H6. The agonistic activity of mAb 4G7 was abolished when the rabbit serum was heat inactivated (Fig. 1⇑D), confirming that complement present in the rabbit serum was responsible for linking mAb 4G7. Because these experiments were performed using heterologous RC, we cannot completely rule out the possibility that homologous murine complement oligomerizes mAb 4H6 molecules. We attempted to address this question using mouse sera as a source of homologous complement. Because no good commercial source of mouse complement was available, we pooled fresh sera from several nude mice to use as a source of mouse complement in our experiments. Preliminary results obtained using such mouse sera were inconsistent (data not shown). This could be due to the variation among individual mice and needs further investigation.

To determine that the agonistic activity of mAb 4G7 in the presence of RC was due to apoptosis and not to complement-mediated cytolysis, we analyzed FITC-annexin V staining and cleavage of the caspase-3 substrate PARP in 9D cells (Fig. 2⇓). Approximately 70% of 9D cells treated with mAb 4G7 plus RC were FITC-annexin V positive, compared with 5% of 9D cells treated with control IgG2a plus RC (Fig. 2⇓A). Consistent with this evidence for apoptosis induction, we detected a significant level of the 85-kDa caspase-cleaved product of PARP (116 kDa) in 9D cells treated with mAb 4G7 plus RC, but not in 9D cells treated with mAb 4G7 plus heat-inactivated RC (Fig. 2⇓B). The maximal agonistic activity of mAb 4G7 in the presence of RC was ∼70% of the agonistic activity in the presence of goat anti-mouse IgG, and the difference between them is statistically significant (p < 0.01; Fig. 2⇓C). These results confirm that complement can oligomerize the IgG2a mAb 4G7 in vitro to mediate apoptosis. Our in vitro study demonstrates that complement components could enhance the apoptotic activity of mAb 4G7 (mIgG2a), but not mAb 4H6 (mIgG1), in agreement with the report by Sato et al. (30). They reported that mIgG2a, but not mIgG1 anti-Thy-1 mAb, induced apoptosis of neuronal cells in the presence of human C1q. We have also tested the effects of human complement (1/8 final dilution) and human C1q (10 μg/ml) on the apoptotic activity of mAb 4G7. The apoptotic activities detected with human complement and human C1q were 27 and 30% of the activity detected with RC, respectively (data not shown). Although the apoptosis-enhancing activities of human complement and human C1q were much weaker than that of RC, these results further suggest that C1q can induce the oligomerization of mAb 4G7.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Induction of apoptosis in human B cell lymphoma 9D cells by mAb 4G7 (IgG2a) in the presence of RC as determined by FITC-annexin-V staining and PARP assay. The 9D cells were incubated with mAb 4G7 for 15 min at 4°C, followed by the addition of RC or HIC. After cells were incubated overnight at 37°C, apoptotic cells were detected by staining with FITC-annexin V and propidium iodide (A and C). As further evidence for apoptosis, cells were lysed, proteins were separated using 7.5% SDS-PAGE, and caspase-cleaved product of PARP (85 kDa) was detected using HRP-rabbit anti-PARP IgG Abs (B). In the experiments shown in A and B, 2 μg/ml of mAb 4G7 was used, whereas various concentrations of mAb 4G7 were tested in the experiment shown in C. The degree of apoptosis was determined based on the apoptosis induced by Apo2L/TRAIL (2 μg/ml) as 100%. Cells treated with mAb 4G7 plus anti-Fc Abs (10 μg/ml) were included as positive controls.

Previously, rabbit sera were reported to contain high levels of natural Abs reacting to human tumor cells (35). The results in Fig. 2⇑ demonstrated that the level of apoptosis of 9D cells incubated with IgG plus RC was similar to that in cells incubated with mAb 4G7 alone. Thus, the potent apoptotic activity of mAb 4G7 in the presence of RC does not appear to be due to the presence of natural anti-tumor Abs in the RC. At present, it is not clear why RC exhibited much higher apoptosis-enhancing activity than human complement. It is possible that human tumor cell membranes express species-specific, complement inhibitory proteins that bind to human C1q; the binding of several such inhibitory proteins to other complement components has been described (31).

Anti-tumor activity of anti-DR4 mAb in a xenograft nude mouse model

The C1q level in mouse serum is in the range of 70 μg/ml (28). We therefore reasoned that murine complement could augment the agonistic activities of anti-DR4 mAbs in vivo, especially mAb 4G7 of the IgG2a isotype, bypassing the requirement for a linker. To explore this possibility, we investigated the effect of anti-DR4 mAbs on the growth of human Colo 205 tumor xenografts in athymic nude mice (Fig. 3⇓). The mice were inoculated s.c. with tumor cells and treated with mAbs i.p. when tumor size reached 50–100 mm³, as previously described (21). At the end of a 2-wk treatment with 1–10 mg/kg mAb three times per week, mAb 4G7 inhibited tumor growth by 60% compared with that in the isotype-matched control (Fig. 3⇓A). The maximum effective dose of mAb 4G7 was ≥2.5 mg/kg (p = 0.02 compared with the IgG2a control group). Despite its weaker agonistic activity upon cross-linking with RC in vitro, mAb 4H6 (IgG1) was much more active than mAb 4G7 (IgG2a) in vivo, causing complete Colo 205 tumor regression under the same experimental protocol. Tumor regression was achieved with as little as 1.25 mg/kg of mAb 4H6 three times per week (Fig. 3⇓B; p < 0.001 compared with the control group). Treatment with mAb 4H6 at 5 mg/kg once per week was as effective as three times per week treatment (Fig. 3⇓C). Some tumors reappeared after administration of mAb 4H6 was stopped, suggesting that tumor cells were not completely eliminated during treatment. A similar, although less potent, anti-tumor activity of mAb 4H6 was observed with another colon carcinoma model, HCT 116 (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Inhibition of human Colo 205 tumor growth in nude mice by anti-DR4 mAbs. Experiments were conducted as described previously (21 ). Female athymic nude mice (4–6 wk old, seven or eight mice per group) were injected s.c. with 5 × 10⁶ Colo 205 cells in the dorsal areas. Once the tumor size reached 50–100 mm³, mice were grouped randomly, and mAbs were administered i.p. using 0.1 ml/injection. ▾, The starting date of the first mAb treatment. Tumor sizes were measured until mice had to be sacrificed due to tumor necrosis in the control group. Each group comprised seven or eight mice. Data points represent the mean ± SEM. A, Dose effect of mAb 4G7 (IgG2a) treatment on the growth of Colo 205 tumors. Various concentrations of mAbs were given three times per week. The mAb 4G7 at 2.5 mg/kg was the most effective (p = 0.028 compared with the control group). B, Dose effect of mAb 4H6 (IgG1) treatment on the growth of Colo 205 xenografts. Various concentrations of mAbs were given three times per week. There were significant tumor growth inhibitions by all doses of mAb 4H6 treatment (p < 0.001 compared with the control group). C, Effect of mAb 4H6 treatment frequency on the growth of Colo 205 xenografts. Mice were treated with 5 mg/kg of mAb one, two, and three times per week. There were significant tumor growth inhibitions at all frequencies of mAb 4H6 treatment (p < 0.001 compared with the control group).

These in vivo results demonstrate that anti-DR4 mAbs administered in the absence of exogenous linkers or molecular modification can be active as anti-tumor agents. In contrast to our in vitro study using complement and to previous reports of IgG2a being the most effective murine Ig isotype for anti-tumor study in mice (36, 37, 38), IgG1 mAb 4H6 was much more effective at inhibiting tumor growth in vivo than was IgG2a mAb 4G7.

Potential mechanisms of the anti-tumor activity of mAb 4H6

The differences in relative activity of mAb 4G7 and mAb 4H6 in vitro and in vivo could be due to several factors, including their different isotypes and recognition of distinct epitopes. To investigate the importance of the IgG1 isotype for anti-tumor activity of mAb 4H6, we generated a murine IgG2a isotype switch variant of this Ab using protein-engineering techniques and compared its in vitro and in vivo activities with those of the parent molecule. In vitro, the two mAb 4H6 isotypes, which had similar affinities to DR4 (Table II⇓), showed similar agonistic activity upon cross-linking with goat anti-mouse IgG (Fig. 4⇓A). In contrast, in vivo, there was a significant difference in the results obtained with IgG1 and IgG2a of mAb 4H6 (p < 0.001; Fig. 4⇓B). At a dose of 2.5 mg/kg twice per week, IgG1-4H6 showed 96% Colo 205 tumor growth inhibition (p < 0.001 compared with the control group), whereas IgG2a-4H6 demonstrated 23% growth inhibition (p = NS) by day 21. The anti-tumor activity of IgG2a-4G7 was very similar to that of IgG2a-4H6. Thus, at least for these anti-DR4 mAbs, the isotype is more important than the target epitope for in vivo anti-tumor activity.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Comparison of the effects of murine Ig isotypes (IgG1 vs IgG2a) on the anti-tumor activity of mAb 4H6. The IgG2a isotype variant of the parent IgG1-4H6 was generated using Ab-engineering techniques, expressed by transfecting 293 mammalian cells transiently and purified using protein G. A, Comparison of the in vitro apoptotic activities of murine IgG1-4H6, IgG2a-4H6, and IgG2a-4G7. The apoptosis-inducing ability on Colo 205 cells by these Abs was determined in the presence of goat anti-mouse IgG-Fc Abs, and the cell viability was determined using crystal violet staining as described in Fig. 1⇑. B, Comparison of the in vivo anti-tumor activities of anti-DR4 mAbs. The experiment was conducted as described in Fig. 3⇑. Athymic nude mice bearing Colo 205 tumors were treated with mAbs at a dose of 2.5 mg/kg twice per week. The growth inhibitory activities of IgG2a-4H6 and IgG2a-4G7 were much weaker (p = NS compared with the control group) compared with that of IgG1-4H6 (p < 0.001 compared with the control group).

The growth rate of the Colo 205 tumor shown in Fig. 4⇑B was much slower than that in Fig. 3⇑C. The Colo 205 tumor cells used in Fig. 4⇑B were in culture for a brief time, whereas the tumor cells used in Fig. 3⇑C were grown in culture for a long time. We postulate that the in vitro propagation of Colo 205 tumor cells may select a population of tumor cells growing much faster in vivo.

To investigate further the importance of IgG1 isotype in the anti-tumor activity in vivo, we compared the in vitro and in vivo activities of several anti-DR4 mAbs (three IgG1 mAbs: 3G1, 4E7, and 4H6; two IgG2a mAbs: 1H5 and 4G7) that demonstrated different blocking activities (Table II⇑). In vitro, upon cross-linking with anti-IgG-Fc, all mAbs except 3G1 showed similarly strong agonistic activity on SK-MES-1 cells. In vivo, all IgG1 mAbs, 3G1, 4E7, and 4H6, demonstrated stronger anti-tumor activity than the IgG2a mAbs, 1H5 and 4G7; the ranges of tumor growth inhibition by IgG1 mAbs and IgG2a mAbs were 42–99 and 27–30%, respectively. Despite weak agonistic activity upon cross-linking in vitro, mAb 3G1 inhibited the growth of Colo 205 tumor by 42% in vivo. It should also be pointed out that mAb 1H5, which is an IgG2a isotype and binds to the overlapping epitope recognized by mAb 4H6 with a similar affinity, has a significantly lower anti-tumor activity in vivo compared with mAb 4H6 (p < 0.001). These results further support the hypothesis that mIgG1 is a much more effective isotype than mIgG2a in mediating anti-tumor activity through a death receptor, DR4.

Both IgG1 mAbs, 4H6 and 4E7, showed similarly high affinities for DR4, with K_d⁻¹ values of 5 pM and 2 pM, respectively. However, mAb 4H6, which blocked Apo2L/TRAIL binding to DR4-IgG, demonstrated a more potent anti-tumor activity than mAb 4E7, which did not block ligand binding. The degree of the anti-tumor activity by mAb 4E7 was 76% of the activity by mAb 4H6 (Table II⇑). The anti-tumor effects of mAb 4H6 and mAb 4E7 are not statistically different (p = 0.2). Thus, these results suggest that recognition of a unique epitope that overlaps with the Apo2L/TRAIL binding site, such as in the case of mAb 4H6, is not essential for anti-tumor activity. We postulate that the receptor oligomerization by high affinity IgG1 mAbs would be sufficient to mediate the death signal, resulting in tumor growth inhibition. However, the anti-tumor activity of IgG1 mAb would be further enhanced by binding to the same or an overlapping epitope recognized by the Apo2L/TRAIL, mimicking the ligand’s agonistic activity. The potent anti-tumor activity of mAb 4H6 is thought to be due to the combination of its high affinity, the IgG1 isotype structure, and its unique binding epitope.

To gain further insight into the mechanism of anti-tumor action by mAb 4H6, we examined histological sections of Colo 205 tumors 3 days after a single i. p. injection of 5 mg/kg of mAb 4H6. We observed widespread necrosis of tumor cells in mAb 4H6-treated mice, whereas tumors from mice treated with mAb 4G7 or control mAb showed very little necrosis (Fig. 5⇓). These findings suggest that mAb 4H6 exerts its anti-tumor activity through direct induction of apoptosis in tumor cells, rather than indirectly through recruiting immune effector functions. However, this requires further investigation.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Histology of Colo 205 tumors after one injection of mAb 4H6. Athymic nude mice bearing Colo 205 were treated i.p. once with 5 mg/kg of mAb 4H6 or with control IgG1 mAb 3 days before tumors were excised. The frozen tumor sections were stained with hematoxylin and eosin. Magnification: upper panel, ×200; lower panel, ×400.