Skip to main content

Main menu

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
      • Neuroimmunology: To Sense and Protect
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons

User menu

  • Subscribe
  • My alerts
  • Log in
  • Log out

Search

  • Advanced search
The Journal of Immunology
  • Other Publications
    • American Association of Immunologists
    • ImmunoHorizons
  • Subscribe
  • My alerts
  • Log in
  • Log out
The Journal of Immunology

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Next in The JI
    • Archive
    • Brief Reviews
    • Pillars of Immunology
    • Translating Immunology
    • Most Read
    • Top Downloads
    • Annual Meeting Abstracts
  • COVID-19/SARS/MERS Articles
  • Info
    • About the Journal
    • For Authors
    • Journal Policies
    • Influence Statement
    • For Advertisers
  • Editors
  • Submit
    • Submit a Manuscript
    • Instructions for Authors
    • Journal Policies
  • Subscribe
    • Journal Subscriptions
    • Email Alerts
    • RSS Feeds
    • ImmunoCasts
  • More
    • Most Read
    • Most Cited
    • ImmunoCasts
    • AAI Disclaimer
    • Feedback
    • Help
    • Accessibility Statement
  • Follow The Journal of Immunology on Twitter
  • Follow The Journal of Immunology on RSS

Cutting Edge: Ectopic Expression of the Chemokine TCA4/SLC Is Sufficient to Trigger Lymphoid Neogenesis

Lian Fan, Christina R. Reilly, Yi Luo, Martin E. Dorf and David Lo
J Immunol April 15, 2000, 164 (8) 3955-3959; DOI: https://doi.org/10.4049/jimmunol.164.8.3955
Lian Fan
*Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christina R. Reilly
*Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yi Luo
†Department of Pathology, Harvard Medical School, Boston, MA 02115
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Martin E. Dorf
†Department of Pathology, Harvard Medical School, Boston, MA 02115
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
David Lo
*Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

To test whether accumulation of naive lymphocytes is sufficient to trigger lymphoid development, we generated mice with islet expression of the chemokine TCA4/SLC. This chemokine is specific for naive lymphocytes and mature dendritic cells (DC) which express the CCR7 receptor. Islets initially developed accumulations of T cells with DC, with scattered B cells at the perimeter. These infiltrates consolidated into organized lymphoid tissue, with high endothelial venules and stromal reticulum. Infiltrate lymphocytes showed a naive CD44low CD25− CD69− phenotype, though half were CD62L negative. When backcrossed to RAG-1 knockout, DC were not recruited. Interestingly, islet lymphoid tissue developed in backcrosses to Ikaros knockout mice despite the absence of normal peripheral nodes. Our results indicate that TCA4/SLC can induce the development and organization of lymphoid tissue through diffential recruitment of T and B lymphocytes and secondary effects on stromal cell development.

In autoimmune diabetes in mice, islet infiltrates organize spontaneously into T cell/dendritic cell (DC)3-dependent compartments and B cell-dependent compartments (1, 2), supported by the development of high endothelial venule (HEV) expressing mucosal addressin cell adhesion molecule-1 (MAdCAM-1) and peripheral lymph node addressin (PNAd) and stromal reticular cells (3, 4). Since this development of new lymphoid tissue (“lymphoid neogenesis,” see Refs. 5, 6) is initiated at an unconventional site at a time well after normal lymph node development, it is clear that tissues retain the potential to support lymphoid tissue development given the appropriate stimulation. Understanding the mechanisms behind this lymphoid neogenesis should also provide important clues to normal lymphoid organ development.

The chemokine TCA4/SLC (7, 8, 9, 10, 11, 12) is expressed predominantly in lymph node HEV, but it is also expressed by cells in the T cell-dependent regions of lymphoid tissue (7). In the thymus, it is expressed by cells in the medulla, including blood vessels and medullary epithelium, and may contribute to tissue organization. For example, in the thymus, thymocytes and DC acquire expression of the TCA4/SLC receptor CCR7 during development (13, 14); therefore, medullary expression of TCA4/SLC may induce migration of mature cells toward the medulla. Similarly, expression of TCA4/SLC by HEV may help organize the T cell/DC compartment around HEV, whereas an opposing gradient of the chemokine B-lymphocyte chemoattractant (BLC) produced by follicular DC draws B cells into the B cell follicles (15).

To assess the role of TCA4/SLC in lymphoid tissue development, we generated transgenic mice with islet β cell specific expression of TCA4/SLC. Interestingly, the recruitment of lymphocytes and DC to pancreatic islets appeared to be sufficient to trigger development of organized lymphoid tissue. Our results suggest that the spontaneous development and organization of lymphoid tissues, including stroma, can be triggered by the simple accumulation of lymphocytes in an Ag-independent manner and that the compartmentalization of T and B lymphocytes can be influenced directly by differential responses to the chemokine TCA4/SLC.

Materials and Methods

Mice

The Ins-TCA4 transgene construct was generated by using the 650-bp rat insulin II HindIII-XhoI promoter fragment containing a single intron in the 5′ untranslated region, attached to a 2.5-kb BstXI genomic clone of the mouse TCA4 gene isolated from a strain 129 genomic library (our unpublished data). Transgenic mice were generated by microinjection into (BALB/c × C57BL/6)F2 embryos and backcrossed to C57BL/6 mice. Two founders were generated, but only one contained one to two complete copies of the transgene. Expression of transgene mRNA was assayed using RT-PCR of mRNA from several tissues. Using a 5′ primer, specific for the insulin 5′ untranslated sequence upstream from the intron (CTAAGTGACCAGCTACAGTCG) and a 3′ primer, specific for the TCA4 mRNA (CTGGCTGTACTTAAGGCAGCA), PCR amplification of the transgene genomic DNA yielded a band of 375 bp, whereas the expressed mRNA/cDNA yielded a band of 250 bp. Mice were also backcrossed to RAG-1 (The Jackson Laboratory, Bar Harbor, ME) and Ikaros knockout mice (provided by K. Georgopoulos, Harvard Medical School, Charlestown, MA). All mice were housed in the vivarium at The Scripps Research Institute in accordance with institutional and National Institutes of Health guidelines.

TCA4 ELISA

Pancreas and lymph nodes (mesenteric, axillary, cervical, and inguinal) harvested from normal and transgenic mice (25 mg) were homogenized in 0.3 ml PBS containing 1 mM PMSF, 0.01 mg/ml leupeptin, and 0.01 mg/ml aprotinin. The extract was sonicated and centrifuged, and supernatants were removed for assay. TCA4 was detected by ELISA using immobilized mAb 4B1 for capture and biotinylated mAb 3D5 (both mAb developed by M. Dorf, see Ref. 7) followed by alkaline phosphatase-coupled avidin (Pierce, Rockford, IL) and 5 mM p-nitrophenyl phosphate (Sigma, St. Louis, MO) for detection. TCA4 concentrations were calculated from standard curves created by titrating recombinant TCA4 into similar tissues from TCA4-deficient plt/plt mice (16, 17).

Immunostaining and flow cytometry

For immunostaining of tissues, cryostat sections (6–10 μM) were fixed in ice-cold acetone and incubated with Abs listed below. For flow cytometry, fluorescent conjugates were used. In the case of lymphocytes isolated from islet infiltrates, pancreas was digested for 10–15 min at 37°C in collagenase/DNase I (Sigma), followed by manual picking of islets under a dissecting microscope. Cell suspensions were made for immediate staining, although in one experiment, a parallel set of cells was cultured at 37°C in RPMI 1640/10% FBS for 1 h before staining. Abs used was as follows: PE-conjugated anti-CD4, PE-conjugated anti-CD8, biotinylated anti-B220, biotinylated anti-MAdCAM-1, biotinylated anti-PNAd, biotinylated anti-CD11c, FITC-conjugated anti-CD44, biotinylated anti-CD62L, FITC-conjugated anti-CD25, and FITC-conjugated anti-CD69 (PharMingen, San Diego, CA), purified anti-F4/80, and anti-NLDC-145/DEC-205 (Serotec, Oxford, U.K.), anti-FDC-M1 (gift from Dr. M. Kosco-Vilbois, Glaxo Wellcome Geneva, Switzerland), and anti-ER-TR7 (Accurate Chemicals, Westbury NY). For histological studies, purified primary Abs were detected using biotinylated anti-Rat IgG and peroxidase-conjugated streptavidin (Jackson ImmunoResearch, West Grove, PA), using 3-amino-9-ethylcarbazole as a chromagen, and for FACS analysis, biotinylated Abs were detected using streptavidin-conjugated APC (PharMingen).

Results and Discussion

Accumulation of lymphocytes and DC in Ins-TCA4 islets

To assess the effects of localized expression of TCA4/SLC, we generated transgenic mice using the rat insulin II promoter and the structural gene for TCA4/SLC (Ins-TCA4). Expression of the transgene was specific to the pancreas by RT-PCR and was not detectable in lymph node, spleen, thymus, skin, kidney, and liver (data not shown). Nontransgenic pancreas analyzed by ELISA contained only 0.06 ± 0.07 ng/mg TCA4 (10 mice), whereas Ins-TCA4 pancreas contained 2.77 ± 0.65 ng/mg (8 mice), comparable to levels in normal lymph node (1.95 ± 0.3 ng/mg from nontransgenic axillary, cervical, and inguinal nodes (5 mice), 2.08 ± 0.39 ng/mg from transgenic nodes (8 mice)).

In young Ins-TCA4 transgenic mice (4–6 wk of age), pancreatic islets contained small focal mononuclear infiltrates near the centers of the islets containing CD4 (Fig. 1⇓A) and CD8 (data not shown) T cells, and CD11c+ F4/80− NLDC-145+ DC (Fig. 1⇓B). B cells were only found as scattered cells at the perimeter of the islets, not associated with T cell clusters (Fig. 1⇓C), suggesting that B cells respond differently to the chemokine. In older Ins-TCA4 animals (6 wk to 4 mo), larger islet infiltrates were evident, with two striking features: First, islet tissue appeared to be intact, but pushed to the margins of the infiltrates (Fig. 1⇓, E–I). Accordingly, Ins-TCA4 mice did not develop hyperglycemia even after several months. Second, the infiltrates resembled normal lymphoid tissue: Lymph node stromal reticulum development was evident, as ER-TR7 staining (18) detected a network of cells throughout the lymphoid tissue (Fig. 1⇓, D and E). MAdCAM-1 and PNAd were detectable on vascular endothelium, which showed morphology consistent with HEV (Fig. 1⇓, F and G). T cell/DC clusters merged with the collections of B cells, forming a lymph node-like structure with B cell follicles at the perimeter of the tissue (Fig. 1⇓, H and I). Within B cell follicles, weak staining for the follicular DC marker FDC-M1 (19) was detectable, although germinal center formation was absent (data not shown). Not all Ins-TCA4 islets developed organized lymphoid tissue, but nearly all islets contained at least some lymphocytes, and all transgenic animals showed at least some lymphoid tissues in islets. These islet lymphoid infiltrates were easily distinguished from normal lymph node by the presence of islet tissue and the absence of a connective tissue capsule.

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

Formation of lymphoid tissue in Ins-TCA4 islets. A, Accumulation of T cells (CD4 shown) as clusters in islets (I). B, T cell clusters always included NLDC-145+ DC (NLDC-145 staining shown). Islet tissue (I) remains intact at the perimeter. C, B220 staining shows B cells at the islet perimeter, separate from T cell clusters (T). D, Normal islet, stained for ER-TR7. E, infiltrates induce lymphoid stromal reticulum, staining positive for ER-TR7. Islet tissue (I) is pushed to the perimeter. F and G, many islet blood vessels develop a morphology resembling HEV and express high levels of MAdCAM-1 (F) and PNAd (G). H and I, serial sections stained for CD4 (H) and B220 (I). As infiltrates grow, T cell and B cell compartments fuse to resemble normal lymph node, except for the presence of islet tissue (I). Original magnification: A, ×400; B, C, E, and F, ×200, D, ×400; and G and H, ×100).

Islet-infiltrating lymphocytes resemble lymph node in expression of activation/memory markers

In studies on a transgenic model expressing lymphotoxin α in islets (RIP-LT), lymphoid neogenesis was also observed, but nearly all lymphocytes showed an activated CD44 high phenotype (6, 20). Indeed, in both the RIP-LT mice and in spontaneous autoimmune diabetes, lymphocyte activation is present, either as a nonspecific response to an inflammatory cytokine or as a specific response to islet Ag. Thus, from those results it could not be established whether lymphocyte activation is a prerequisite for lymphoid neogenesis. By contrast, lymphocytes isolated from Ins-TCA4 islets were similar to normal lymph node in the proportions of CD4/CD8 T cells and B cells and their expression of activation markers. Flow cytometry analysis showed that islet lymphocytes appeared to be predominantly naive cells, similar to peripheral nodes from the same mice. That is, lymphocytes were mostly small lymphocytes by forward light scatter (data not shown), CD44low (Fig. 2⇓A) and negative for CD25 and CD69 (data not shown).

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

FACS analysis of lymphocytes from Ins-TCA4 infiltrates. A, Peripheral lymph node, islet infiltrates, and spleen cells were stained for CD4, CD8, and activation/memory markers. Cells were gated for CD4 or CD8 expression and shown as a histogram for CD44 or CD62L expression. The proportion of cells with an activated/memory phenotype (CD44high, CD62Llow) is listed in the corner of each histogram. Lymph nodes have few CD4 and CD8 T cells that are CD44high and CD62Llow, whereas spleen has more cells with these phenotypes. Curiously, among Ins-TCA4 islet CD4 and CD8 T cells, only a few are CD44high, but a high proportion are CD62Llow. B, Three-color analysis of CD4 T cells shows that although CD44high cells tend to be found among the CD62Llow population, levels of CD44 are broadly distributed among both CD62L populations in lymph node, spleen, and islet infiltrates.

Curiously, islet T cells showed a high proportion of CD62Llow cells (Fig. 2⇑A). It was formally possible that the isolation procedure for islets caused shedding of CD62L from lymphocytes; therefore, we also cultured the lymphocytes for 1 h to allow for re-expression of CD62L. The proportion of CD62Llow cells was unchanged by this procedure (data not shown), and the fluorescence intensity of the CD62L-positive peak cells remained similar to that in normal peripheral nodes. Three-color analysis (Fig. 2⇑B, showing data on CD4 cells) showed that although CD44high cells were largely found among the CD62Llow population, the range of CD44 expression was broad among both CD62Lhigh and CD62Llow populations in lymph node, spleen, and islet infiltrates. Thus, the islet-infiltrating lymphocytes were not remarkable in any way apart from the increased proportion of CD62Llow cells. This unusual phenotype might be a direct consequence of high local expression of TCA4/SLC, including the possible increased recruitment of CD62Llow cells from lymphatics. Alternatively, the MAdCAM-1+ HEV in the islets may selectively recruit a CD62Llow population or induce shedding of CD62L during transit across the HEV.

Considering the ability of the transgene TCA4/SLC to drive new lymphoid tissue growth, it was possible that the chemokine may also expand the total lymphocyte pool. To test this, we counted lymph node and spleen cells from Ins-TCA4 mice and littermate controls (Table I⇓). There was no clear effect on the total numbers of lymphocytes in these tissues; however, since these counts do not include the islet infiltrates, there may be a significant overall increase in the total number of lymphocytes over time due to the increase in the total lymphoid tissue.

View this table:
  • View inline
  • View popup
Table I.

Peripheral lymphoid organ cell countsa

Histology of islet infiltrates in Ins-TCA4 mice backcrossed to RAG and Ikaros knockouts

It is possible that lymphoid tissue development in the fetus uses distinct mechanisms from those involved in lymphoid neogenesis in the adult. In this context, we began an analysis of Ins-TCA4 mice backcrossed to RAG-1 and Ikaros knockouts (Fig. 3⇓). In the case of RAG-1 knockout mice, normal lymph node stroma developed in the fetus despite the absence of lymphocytes, possibly due to a CD3−CD4+LTβ+ cell-driving stromal development (21, 22). In contrast, mice deficient in the transcription factor Ikaros fail to develop any peripheral lymph node tissue (23, 24). T lymphocyte development is delayed in these mice, but it is not clear whether this is responsible for the lymph node defect. Thus, backcrossing the Ins-TCA4 transgene to these knockouts may help distinguish between different mechanisms of lymphoid tissue development.

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

Histology of Ins-TCA4/RAG-1 knockout (A) and Ins-TCA4/Ikaros knockout (B–E) islets. A, Islets of Ins-TCA4/RAG-1 knockouts only contain a few NLDC-145+ DC (arrow). B, Ins-TCA4/Ikaros knockout islets accumulate CD4 and CD8 T cells and NLDC-145+ DC, but B220+ cells are not detectable (CD4 staining shown). C, An ER-TR7+ stromal network develops, but islet tissue is drawn out into “rivers” (arrows). MAdCAM-1 (D) and PNAd (E) are expressed in large structures resembling HEV. Original magnification: A–E, ×200).

Ins-TCA4 transgenic mice backcrossed to RAG-1 knockout did not develop lymphoid tissue or MAdCAM-1+ PNAd+ HEV in islets. Surprisingly, mature DC were also not recruited (Fig. 3⇑A), despite the fact that DC subsets are present in normal proportions in RAG-1 knockout spleen (25). It is possible that DC in RAG-1 knockouts do not express the CCR7 receptor or their persistence or development in islets may depend on T cells (26).

In Ikaros knockout mice, T cells but not B cells are generated late in mouse development due to late compensatory expression of the related gene Aiolos (24). In these studies, we used Ikaros “null” mice with a complete deficiency in Ikaros expression (23); as described for the Ikaros dominant negative mutant, these mice also fail to generate lymph nodes (data not shown). In mice with the Ins-TCA4 transgene on the Ikaros knockout background, lymphoid tissues still developed in islets: they contained CD4 (Fig. 3⇑B) and CD8 T cells and NLDC-145+ DC (data not shown), with development of ER-TR7+ stromal reticulum (Fig. 3⇑C), and MAdCAM-1+ PNAd+ HEV (Fig. 3⇑, D and E). Thus, although normal peripheral lymph nodes were not produced, recruitment of T cells (without B cells) to Ins-TCA4 islets was sufficient to trigger new lymphoid tissue development.

It has not yet been established whether Ikaros expression is required in lymphoid stroma. However, it is possible that while the absence of early Ikaros expression blocked normal lymph node development, inducible expression of Aiolos (or related molecule) in stromal cells may allow for the induction of lymphoid neogenesis in adult tissues. Assuming Ikaros null T cells are capable of expressing LT ligands, these may be sufficient to trigger this alternative mechanism of stromal cell development.

In summary, the expression of a TCA4/SLC transgene was sufficient to drive lymphoid neogenesis under conditions where the majority of recruited cells showed a naive phenotype. Induction of lymphoid stromal cell development (HEV, stromal reticular cells) occurs late and continues through adult life, probably through lymphotoxin-mediated signals (27). It will be of great interest to identify the specific signals involved, since studies on the role of LTα and LTβ in normal lymph node development had previously suggested that lymphoid tissue could only develop within an early developmental window in fetal life (28). Finally, the differential recruitment of B cells relative to T cells and DC suggests that the action of TCA4/SLC has a primary role in the segregation of lymphoid compartments. Maintenance of the lymphoid compartment segregation may then depend on subsequent B cell-mediated induction of follicular DC producing the B cell chemokine BLC (29, 30).

Acknowledgments

We acknowledge the excellent assistance of the Scripps Transgenic Mouse Facility, and we thank Dr. Monica Carson for helpful suggestions and discussions. We also thank Dr. Marie Kosco-Vilbois for providing the anti-FDC-M1 Ab and Dr. Katia Georgopoulos for providing the Ikaros knockout mice. This is manuscript number 12837-IMM from The Scripps Research Institute.

Footnotes

  • ↵1 This work was supported by National Institutes of Health Grants RO1-CA67416 (to M.E.D.) and RO1-AI38375 (to D.L.), a Juvenile Diabetes Foundation International grant (to D.L.), and a Human Frontier Science Program grant (to D.L.).

  • ↵2 Address correspondence and reprint requests to Dr. David Lo, Department of Immunology IMM-25, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: davidlo{at}scripps.edu

  • ↵3 Abbreviations used in this paper: DC, dendritic cell; HEV, high endothelial venule; MAdCAM-1, mucosal addressin cell adhesion molecule-1; PNAd, peripheral lymph node addressin.

  • Received November 23, 1999.
  • Accepted February 11, 2000.
  • Copyright © 2000 by The American Association of Immunologists

References

  1. ↵
    Lo, D., L. Feng, L. Li, M. J. Carson, M. Crowley, M. Pauza, A. Nguyen, C. Reilly. 1999. Integrating innate and adaptive immunity in the whole animal. Immunol. Rev. 169: 225
    OpenUrlCrossRefPubMed
  2. ↵
    Lo, D., C. R. Reilly, B. Scott, R. Liblau, H. O. McDevitt, L. C. Burkly. 1993. Antigen presenting cells in adoptively transferred and spontaneous diabetes. Eur. J. Immunol. 23: 1693
    OpenUrlCrossRefPubMed
  3. ↵
    Yang, X. D, H. K. Sytwu, H. O. McDevitt, S. A. Michie. 1997. Involvement of β7 integrin and mucosal addressin cell adhesion molecule-1 (MAdCAM-1) in the development of diabetes in nonobese diabetic mice. Diabetes 46: 1542
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Hanninen, A., C. Taylor, P. R. Streeter, L. S. Stark, J. M. Sarte, J. A. Shizuru, O. Simell, S. A. Michie. 1993. Vascular addressins are induced on islet vessels during insulitis in nonobese diabetic mice and are involved in lymphoid cell binding to islet endothelium. J. Clin. Invest. 92: 2509
    OpenUrlCrossRefPubMed
  5. ↵
    Ruddle, N. H.. 1999. Lymphoid neo-organogenesis: lymphotoxin’s role in inflammation and development. Immunol. Res. 19: 119
    OpenUrlCrossRefPubMed
  6. ↵
    Kratz, A., A. Campos-Neto, M. S. Hanson, N. H. Ruddle. 1996. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. J. Exp. Med. 183: 1461
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Tanabe, S., Z. Lu, Y. Luo, E. J. Quackenbush, M. A. Berman, L. A. Collins-Racie, S. Mi, C. Reilly, D. Lo, K. A. Jacobs, M. E. Dorf. 1997. Identification of a new mouse β-chemokine, TCA4, with activity on T lymphocytes and mesangial cells. J. Immunol. 159: 5671
    OpenUrlAbstract
  8. ↵
    Gunn, M. D., K. Tangemann, C. Tam, J. G. Cyster, S. D. Rosen, L. T. Williams. 1998. A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes. Proc. Natl. Acad. Sci. USA 95: 258
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Hedrick, J. A., A. Zlotnik. 1997. Identification and characterization of a novel β chemokine containing six conserved cysteines. J. Immunol. 159: 1589
    OpenUrlAbstract
  10. ↵
    Nagira, M., T. Imai, K. Hieshima, J. Kusuda, M. Ridanpaa, S. Takagi, M. Nishimura, M. Kakizaki, H. Nomiyama, O. Yoshie. 1997. Molecular cloning of a novel human CC chemokine secondary lymphoid-tissue chemokine that is a potent chemoattractant for lymphocytes and mapped to chromosome 9p13. J. Biol. Chem. 272: 19518
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Hromas, R., C. H. Kim, M. Klemsz, M. Krathwohl, K. Fife, S. Cooper, C. Schnizlein-Bick, H. E. Broxmeyer. 1997. Isolation and characterization of Exodus-2, a novel C-C chemokine with a unique 37-amino acid carboxyl-terminal extension. J. Immunol. 159: 2554
    OpenUrlAbstract
  12. ↵
    Campbell, J. J., E. P. Bowman, K. Murphy, K. R. Youngman, M. A. Siani, D. A. Thompson, L. Wu, A. Zlotnick, E. C. Butcher. 1998. 6-C-kine (SLC), a lymphocyte adhesion-triggering chemokine expressed by high endothelium, is an agonist for the MIP-3β receptor CCR7. J. Cell Biol. 141: 1053
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Suzuki, G., H. Sawa, Y. Kobayashi, Y. Nakata, K. Nakagawa, A. Uzawa, H. Sakiyama, S. Kakinuma, K. Iwabuchi, K. Nagashima. 1999. Pertussis toxin-sensitive signal controls the trafficking of thymocytes across the corticomedullary junction in the thymus. J. Immunol. 162: 5981
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Kellermann, S., S. Hudak, E. R. Oldham, Y. Liu, L. M. McEvoy. 1999. The CC chemokine receptor-7 ligands 6Ckine and macrophage inflammatory protein-3b are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162: 3859
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Gunn, M. D., V. N. Ngo, K. M. Ansel, E. H. Ekland, J. G. Cyster, L. T. Williams. 1998. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1. Nature 391: 799
    OpenUrlCrossRefPubMed
  16. ↵
    Nakano, H., T. Tamura, T. Yoshimoto, H. Yagita, M. Miasa, E. C. Butcher, H. Nariuchi, T. Kakiuchi, A. Matsuzawa. 1997. Genetic defect in T lymphocyte-specific homing into peripheral lymph nodes. Eur. J. Immunol. 27: 215
    OpenUrlCrossRefPubMed
  17. ↵
    Gunn, M. D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L. T. Williams, H. Nakano. 1999. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med. 189: 451
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Van Vliet, E., M. Melis, J. M. Foidart, W. Van Ewijk. 1986. Reticular fibroblasts in peripheral lymphoid organs identified by a monoclonal antibody. J. Histochem. Cytochem. 34: 883
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Kosco-Vilbois, M. H., J. Y. Bonnefoy, Y. Chvatchko. 1997. The physiology3 of murine germinal center reactions. Immunol. Rev. 156: 127
    OpenUrlCrossRefPubMed
  20. ↵
    Sacca, R., C. A. Cuff, W. Lesslauer, N. H. Ruddle. 1998. Differential activities of secreted lymphotoxin-α3 and membrane lymphotoxin-α1β2 in lymphotoxin-induced inflammation: critical role of TNF receptor 1 signaling. J. Immunol. 160: 485
    OpenUrlAbstract/FREE Full Text
  21. ↵
    Mebius, R. E., P. Rennert, I. L. Weissman. 1997. Developing lymph nodes collect CD4+CD3−LTβ+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7: 493
    OpenUrlCrossRefPubMed
  22. ↵
    Mebius, R. E., I. L. Schadee-Eestermans, I. L. Weissman. 1998. MAdCAM-1 dependent colonization of developing lymph nodes involves a unique subset of CD4+ CD3− hematolymphoid cells. Cell Adhes. Commun. 6: 97
    OpenUrlCrossRefPubMed
  23. ↵
    Wang, J., A. Nichogiannopooulou, L. Wu, L. Sun, A. H. Sharpe, M. Bigby, K. Georgopoulos. 1996. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity 5: 537
    OpenUrlCrossRefPubMed
  24. ↵
    Georgopoulos, K., S. Winandy, N. Avitahl. 1997. The role of the Ikaros gene in lymphocyte development and homeostasis. Annu. Rev. Immunol. 15: 155
    OpenUrlCrossRefPubMed
  25. ↵
    Crowley, M. T., C. R. Reilly, D. Lo. 1999. Influence of lymphocytes on the presence and organization of dendritic cell subsets in the spleen. J. Immunol. 163: 4894
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Shreedhar, V., A. M. Moodycliffe, S. E. Ullrich, C. Bucana, M. L. Kripke, I. Flores-Romo. 1999. Dendritic cells require T cells for functional maturation in vivo. Immunity 11: 625
    OpenUrlCrossRefPubMed
  27. ↵
    Rennert, P. D., D. James, F. Mackay, J. L. Browning, P. S. Hochman. 1998. Lymph node genesis is induced by signaling through the lymphotoxin β receptor. Immunity 9: 71
    OpenUrlCrossRefPubMed
  28. ↵
    Rennert, P. D., J. L. Browning, R. Mebius, F. Mackay, P. S. Hochman. 1996. Surface lymphotoxin α/β complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184: 1999
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Endres, R., M. B. Alimzhanov, T. Plitz, A. Futterer, M. H. Kosco-Vilbois, S. A. Nedospasov, K. Rajewsky, K. Pfeffer. 1999. Mature follicular dendritic cell networks depend on expression of lymphotoxin β receptor by radioresistant stromal cells and of lymphotoxin beta and tumor necrosis factor by B cells. J. Exp. Med. 189: 159
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. S. Riminton, M. D. Cooper, J. L. Browning, J. D. Sedgwick, J. G. Cyster. 1999. Lymphotoxin α/β and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189: 403
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top

In this issue

The Journal of Immunology: 164 (8)
The Journal of Immunology
Vol. 164, Issue 8
15 Apr 2000
  • Table of Contents
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word about The Journal of Immunology.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Cutting Edge: Ectopic Expression of the Chemokine TCA4/SLC Is Sufficient to Trigger Lymphoid Neogenesis
(Your Name) has forwarded a page to you from The Journal of Immunology
(Your Name) thought you would like to see this page from the The Journal of Immunology web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Cutting Edge: Ectopic Expression of the Chemokine TCA4/SLC Is Sufficient to Trigger Lymphoid Neogenesis
Lian Fan, Christina R. Reilly, Yi Luo, Martin E. Dorf, David Lo
The Journal of Immunology April 15, 2000, 164 (8) 3955-3959; DOI: 10.4049/jimmunol.164.8.3955

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Cutting Edge: Ectopic Expression of the Chemokine TCA4/SLC Is Sufficient to Trigger Lymphoid Neogenesis
Lian Fan, Christina R. Reilly, Yi Luo, Martin E. Dorf, David Lo
The Journal of Immunology April 15, 2000, 164 (8) 3955-3959; DOI: 10.4049/jimmunol.164.8.3955
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results and Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

More in this TOC Section

  • Cutting Edge: Hypoxia-Induced Ubc9 Promoter Hypermethylation Regulates IL-17 Expression in Ulcerative Colitis
  • Cutting Edge: Mouse SARS-CoV-2 Epitope Reveals Infection and Vaccine-Elicited CD8 T Cell Responses
  • Cutting Edge: Heterogeneity in Cell Age Contributes to Functional Diversity of NK Cells
Show more CUTTING EDGE

Similar Articles

Navigate

  • Home
  • Current Issue
  • Next in The JI
  • Archive
  • Brief Reviews
  • Pillars of Immunology
  • Translating Immunology

For Authors

  • Submit a Manuscript
  • Instructions for Authors
  • About the Journal
  • Journal Policies
  • Editors

General Information

  • Advertisers
  • Subscribers
  • Rights and Permissions
  • Accessibility Statement
  • Public Access
  • Privacy Policy
  • Disclaimer

Journal Services

  • Email Alerts
  • RSS Feeds
  • ImmunoCasts
  • Twitter

Copyright © 2021 by The American Association of Immunologists, Inc.

Print ISSN 0022-1767        Online ISSN 1550-6606