The Timing of GM-CSF Expression Plasmid Administration Influences the Th1/Th2 Response Induced by an HIV-1-Specific DNA Vaccine

Animals

Six- to 10-wk-old BALB/c female mice were purchased from Japan SLC (Shizuoka, Japan).

Plasmids and reagents

The following expression plasmids were used: pCMV160IIIB, which encodes gp160 of HIV-1_IIIB, and pcREV-encoding HIV-1 rev (27); an IL-12 expression plasmid (pCAGGS IL-12), which encodes both the p40 and p35 subunits of IL-12 (17, 26), donated by Dr. J. Miyazaki (Osaka University); and IL-4 expression plasmid (pCAGGS IL-4), also donated by Dr. J. Miyazaki, which encodes IL-4 cDNA (17); an IL-2 expression plasmid (BCMGNeo-mIL-2) (28), kindly donated by Dr. H. Karasuyama (Department of Immunology, Tokyo Metropolitan Institute of Medical Science); a TNF-α expression plasmid, donated by Riken Gene Bank (Ibaraki, Japan); an IFN-γ expression plasmid, a gift from Dr. H. Uesaka, (Tokyo Dental College, Chiba); an GM-CSF expression plasmid (pGM-CSF), a kind donation from Dr. H. L. Davis (Loeb Medical Research Institute, Ottawa, Ontario, Canada) (29); and empty vector, which was a construct derived from pGM-CSF by removing the cytokine gene. For vaccine immunization, the HIV-1_IIIB-derived gag region plasmid, which was a combined construct of gag DNA and CMV promoter (J. Fukushima et al., unpublished observations) was used. The rat monoclonal anti-mouse GM-CSF Ab (05-169; Upstate Biotechnology, Lake Placid, NY) (anti-GM-CSF mAb) was purchased from Wako Life Sciences (Osaka, Japan), and rat anti-mouse IL-12 mAb were received from Dr. G. Trinchieri (The Wistar Institute, Philadelphia, PA). The rat monoclonal anti-mouse IL-4 Ab was purchased from PharMingen (San Diego, CA). The rabbit Ab for sperm whale myoglobin (Mb; Sigma, St. Louis, MO) was obtain by immunizing Mb with CFA three times (30), and the Ab titer of reciprocal log₂ was 15.3 using ELISA assay. This Ab was affinity purified using a Mb-conjugated column.

Immunization

The protocol used for i.m. immunization was previously described (27). Briefly, 100 μl of PBS containing 20 μg of the DNA vaccine plasmids (15 μg of pCMV160IIIB and 5 μg of pcREV, hereafter referred to DNA vaccine or pGP160) or 10 μg of adjuvant plasmid, or both, was inoculated directly into the gastrocnemius muscle of mice. The same procedure of immunization employing the same dose of immunogen was used for repeat immunizations on days 7 and 21. Five to 7 days after the last boost, immune responses were studied. To study the effect of GM-CSF plasmid on the immune activation induced by the DNA vaccine, 10 μg of pGM-CSF was administered i.m. into mice 3 days before or after DNA vaccination. In some experiments, pGM-CSF was injected into the gastrocnemius muscle of another foot. The mAbs were injected i.p. on two consecutive days 3 days after or before pGM-CSF administration. All cytokine expression plasmids except pGM-CSF were injected on the same day as the DNA vaccination.

Histology

The samples were fixed with 10% neutral-buffered formalin solution (Sigma) and embedded in paraffin. Slices (4 μm thick) were prepared and stained with hematoxylin-eosin. For immunohistochemical analysis, slices were deparafinized and rehydrated. These specimens were treated with 0.5% H₂O₂ solution for 15 min to block the endogenous peroxidase activity. These treated samples were incubated with a primary Ab using Histofine immunodetection system (Nichirei, Tokyo, Japan) according to the manufacturer’s protocol.

Analysis of CD8⁺ and CD11c⁺ cells in regional lymph nodes

Three days after pGM-CSF injection, regional lymph nodes were collected, and partial purification of DCs was conducted using a previously described method (31). As a control, nonimmune lymph nodes from mice, which have not been given pGM-CSF, were also collected and studied. Lymph node cells from three to five mice were pooled, suspended, and placed in a petri dish in RPMI 1640 medium supplemented with 2% heat-inactivated mouse serum plus 5 × 10⁻⁵ M 2-ME. After 2 h, nonadherent low-density cells were removed by gentle Paster pipetting, and adherent cells were cultured again with the same RPMI 1640 media at 37°C in a CO₂ incubator. After 12 h, the nonadherent cells were collected and stained with FITC-labeled anti-CD11c Ab (PharMingen) and PE-labeled anti-CD8 Ab (PharMingen). These stained cells were analyzed with a FACScan (Becton Dickinson, Franklin Lakes, NJ).

Purification of DCs and in vitro immunization

A detailed protocol of DC purification was previously described (32). Briefly, after removing all muscle tissues from the femur and tibia, both ends of the bones were cut and the marrow was flushed out using 2 ml of RPMI 1640 with a syringe and a 25-gauge needle. The tissue was suspended, passed through nylon mesh, and the RBC were lysed with ammonium chloride. Lymphocytes and class II-positive cells in the culture were removed with a mixture of mAbs and rabbit complement for 60 min at 37°C. The mixture of mAbs contains GK1.3 anti-CD4, HO2.2 anti-CD8, B21-2 anti-Ia, and RA3-3A1/6.1 anti-B220/CD45R (American Type Culture Collection, Manassas, VA). Then, the culture was incubated with 200 U/ml rGM-CSF and rIL-4 (20 ng/ml; Genzyme, Framingham, MA), and the medium was replaced with medium containing the same concentrations of cytokines every 2 days to enrich the loosely adherent proliferating DC aggregates. On day 8 of culture, the released mature, nonadherent cells with the typical morphological features of DCs were used for in vitro phenotypic and functional analysis as well as for the immunization of mice. The FACS analysis of these recovered cells revealed over 60% of both CD11c and CD86 Ag-positive cells.

In vitro immunization was performed using these in vitro-cultured DCs. The method of DNA transfection followed that previously reported (6, 33, 34). Briefly, 20 μg of DNA plasmids were mixed with 40 μg of Lipofectin in a polystyrene container. The solution was brought to a volume of 50 μl with PBS, mixed, and allowed to sit in a CO₂ incubator for 15 min. The DNA and Lipofectin complex was mixed with 3 ml of EX-cell/TM 400 serum-free medium (IRH Bioscience, Lenexa, KS) and added to a 25-cm² flask containing 1–3 × 10⁶ DCs. These cells were incubated at 37°C in an atmosphere containing 5% CO₂. After 6 h, these cells were washed and transferred into naive mice. The HIV-1-specific delayed-type hypersensitivity (DTH) response was assayed after 10 days. When the CTL and Ab responses were assayed, these cell transfers were repeated after 7 and 21 days, and the immune responses of these mice were tested.

Sample collection

Sera and fecal samples were prepared as described elsewhere (2). Briefly, sera were collected by retro-orbital puncture under anesthesia with diethyl ether and stored at 4°C until use. Fecal pellets (100 mg) were suspended in 1 ml of PBS. After centrifugation at 12,000 rpm, the supernatants were collected and stored at −20°C until use.

DTH response

The DTH response was assessed using a footpad swelling method as previously described (27). Briefly, 25 μl PBS containing 4 μg of an HIV-1_IIIB V3 peptide (RGPGRAFVTIGK) (35) was injected into mouse footpads. Control mice were injected with the same dose of sperm whale Mb peptide, ALVEADVA (30). As the other control Ag, HGP-30 peptide (YSVHQRIDVKVTKEALEKIEEEQNKSKKKA) (36) was also employed. After 24 h, the extent of footpad swelling was evaluated as the difference in thickness in units of 10⁻² mm between the preinjected and postinjected footpads.

CTL assay

Spleen and regional lymph node cells were collected around the third day after the last immunization (27). Approximately 1 × 10⁶ lymphoid cells from the immunized mice were restimulated in vitro with HIV-1 V3 peptide (RGPGRAFVTI)-pulsed syngeneic spleen cells. After culturing for 5 days, the cytotoxic activity of these spleen cells was measured by a 6-h ⁵¹Cr release assay using V3 peptide-pulsed target cells. The target cells were prepared using the same HIV-1 V3 peptide-pulsed P815 cells (H-2^d). The percentage of specific ⁵¹Cr release was calculated as 100 × (experimental release − spontaneous release)/(maximum release − spontaneous release). Target cells incubated in medium alone and with medium plus 5% Triton X-100 were used to determine spontaneous and maximum chromium release, respectively.

RT-PCR assay

Total RNA was isolated from about 0.1 g of cultured DCs or bone marrow cells using an RNAzol B kit (Biotecx Laboratories, Houston, TX). One microgram of total RNA was reverse transcribed by methods described elsewheres (37, 38). PCR primers for IL-4 and β-actin mRNA were constructed as the following sequence. For IL-4, the 5′ primer was TCG GCA TTT TGA ACG AGG TC and the 3′ primers were GAA AAG CCC GAA AGA GTC TC. For β-actin, the 5′ primer was TGGAATCCTGTGGCATCCATGAAAC and the 3′ primer was TAAAACGCAGCTCAG T AACAGTCCG.

ELISA

The titers of serum IgG, IgG1, IgG2a, and fecal IgA against HIV-1 were examined on days 14 and 28 after immunization using ELISA as described elsewhere (26, 27). Briefly, 96-well microtiter plates were coated with 5 mg/ml of HIV-1_IIIB V3 peptide (NNTRKSIRIQRGPGRAFVTIGKIGN) or a sperm whale Mb peptide, ALVEADVA. The wells were treated with PBS containing 1% BSA and incubated for 1 h at room temperature. Then they were treated with 100 μl of a 1-in-500 dilution of mouse serum and incubated for an additional hour at 37°C. The bound Ig was characterized using affinity-purified HRP-labeled anti-mouse IgG, IgG1, or IgG2a (Organon Teknika, West Chester, PA). For the estimation of secretory IgA Ab against the HIV-1_IIIB V3 peptide, rabbit anti-rat secretory component Ab (kindly provided by Dr. B. Underdown, McMaster University Medical Center, Hamilton, Ontario, Canada) was also used. Ab titers were expressed as the reciprocal log₂ value of the final detectable dilution, which gave an OD at 490 nm (OD₄₉₀) of >0.2 OD units above the preimmune control.

For quantification of IFN-γ and IL-4, freshly isolated splenic mononuclear cells were cultured in the presence of a V3 peptide. This peptide, RGPGRAFVTIGK, contains both a helper (39) and a CTL (40) epitope for HIV-1_IIIB. Culture media were collected 48 h after the initiation of cell culture, and the cell-free supernatants were stored at −80°C until use. Cytokine levels in these samples were measured with a commercial EIA kit (Cytoscreen; Biosource, Beverly, MA) according to the manufacturer’s instructions.

Cytokine enzyme-linked immunospot (ELISPOT) assay

Cytokine ELISPOT assay was performed as previously described (41). Lymphoid cells were isolated from popliteal and inguinal lymph nodes 7 days after the third immunization. Serial 3-fold dilutions of a single-cell suspension, starting with 5 × 10⁶ cells/well, were incubated at 5% CO₂, 37°C for 12 h with or without 10 μg/ml of V3 peptide. Detection kits for cytokines using alkaline phosphatase-labeled Abs (PharMingen) were used for detecting IL-4 and IFN-γ-producing cells. Spots were counted in each well, and the dilution was used to calculate the total number of cytokine-secreting cells/samples.

Data analysis

All values were expressed as means ± SE. Statistical analysis of the experimental data and controls was conducted by one-way factorial ANOVA, with the levels of significance defined as p < 0.05 and 0.01.

Temporal effects of pGM-CSF administration on the immune response to pGP160IIIB

BALB/c mice were immunized i.m. with 15 μg of pCMV160IIIB plus 5 μg of pcREV. We previously showed that this combination of plasmids induced the production of IgG anti-gp160 Abs (27). In an effort to boost this response, we examined the effect of coadministering pGM-CSF with pGP160 (Table I⇓).

pGM-CSF was injected either 3 days before, at the same time, or 3 days after pGP160. As seen in Table I⇑, pGM-CSF had a maximal effect on Ag-specific IgG levels when administered before pGP160, boosting serum titers 8-fold. We then analyzed the effect of pGM-CSF on the mucosal immune response of pGP160IIIB-vaccinated mice. HIV-1-specific mucosal IgA titers were significantly increased when pGM-CSF was administered 3 days before DNA vaccination (Table I⇑). The IgG2a Ab titer was enhanced, when pGM-CSF was injected 3 days after pGP120 injection. In the mouse injected with pGP160 and pGM-CSF, each into a different foot, the Ab production was not so effectively enhanced, which suggests the importance of the local accumulation effect of pGM-CSF. Both the mucosal and systemic rise in Ab titer were inhibited by anti-GM-CSF mAb. This type of enhancement was also observed using sperm whale Mb as an immunogen. As shown in Table I⇑, pGM-CSF inoculation also enhances Mb-specific Ab production when pGM-CSF was inoculated before 3 days of Mb immunization.

In contrast, pGM-CSF maximally increased the production of Ag-specific CTL when administered 3 days after pGP160 (Fig. 1⇓, A and B). The same effect on DTH was observed in assays of footpad swelling (Table II⇓). The same effect was also observed using Mb Ag. However, this enhancing effect was inhibited by injection of anti GM-CSF mAb. In the mouse injected with pGP160 and pGM-CSF, each into a different foot, the swelling response was not so effectively enhanced. To determine the basis of this differential effect, we examined cytokine production by lymphocytes from these mice. Spleen and lymph node cells were cultured in vitro with a peptide encoding the V3 region of gp160, and the production of IL-4 and IFN-γ was monitored by ELISA. As seen in Fig. 2⇓, IL-4 production by lymphoid cells from mice pretreated with pGM-CSF was significantly increased when compared with mice treated with pGP160 alone. In contrast, IL-4 levels in cultures from mice treated with pGM-CSF 3 days after pGP160 was rather reduced. An inverse effect on IFN-γ levels was observed in this experiment: mice treated with pGM-CSF 3 days before pGP160 had lower levels of IFN-γ, while those treated 3 days after had significantly increase levels of IFN-γ in culture. We further studied cytokine production using an ELISPOT assay with cells from immune regional lymph nodes. As shown in Table III⇓, the profile of the activation of cytokine production using in vitro V3 peptide-activated cells became clearer. Thus, the timing of pGM-CSF administration impacts on the Th1:Th2 cytokine balance, and this change of balance became clearer when we tested lymph node cells at the site of DNA vaccination.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Effect of GM-CSF expression plasmids on HIV-1-mediated CTL activity. The timing of pGM-CSF inoculation differed between groups. These injections were performed twice, and the activity was assayed using cells from regional lymph nodes and spleen. A, Data represent the means of the experiments. B, Mean values ± SE of CTL activities from individual immune mouse. ∗, Mean values significantly different from the pGP160IIIB (p < 0.05) group at the same E:T ratio (80:1).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Influence of other cytokine expression plasmids on IL-4 production induced by DNA vaccine and pGM-CSF. Some plasmids were inoculated i.m. into mice, and immune lymphoid cells, spleen, as well as lymph node cells were collected. Coculturing was performed for 3 days with 10 mg/ml gp160 protein. The culture supernatants were assayed using IL-4 ELISA kits. ∗, Statistically significant difference between pGP160 and IL-4; a, statistically significant difference between pGP160 and IFN-γ. Mean levels ± SE of cytokines were assayed. Data represent mean cytokine levels ± SE of five to seven mice. These data are representative of three other individual experiments.

Histological analysis of pGM-CSF-injected mice

The next series of experiments examined the mechanism underlying the Th2-type response elicited by pretreatment with pGM-CSF. We first examined the histology of the region injected with pGM-CSF. A cellular infiltrate was present within 24 h that peaked in magnitude by 2–3 days after injection (Fig. 3⇓a). Immunohistochemical analysis with anti-S-100 polyclonal Ab (Nichirei) identified many S-100 plus DCs infiltrating the site (Fig. 3⇓b). S-100 immunoreactivity is characteristic of mature DC cells that are effective in Ag presentation (42, 43, 44). We also observed the accumulation of S-100-stained cells among the infiltrated cells in the muscles, which had received pGP160 after 48 h. However, the accumulation of S-100-stained or infiltrating cells was not so remarkable when we studied the specimen immunized with pGP160 alone (Fig. 3⇓, c and d). These observations suggest that the infiltrating cells might have taken up or been activated by the GM-CSF produced by transfected cells and were playing a role in the immune response.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Accumulation of S-100 protein-positive cells among the infiltrated cells in the muscle. After 3 days of injection of pGM-CSF, the muscle was fixed and observed. a, Hematoxilin-eosin staining; b, S-100 protein immunohistochemistry. After 3 days of pGP160 injection, the muscle was fixed and observed. c, Hematoxilin-eosin staining; d, S-100 protein immunohistochemistry. Arrows indicate positively stained Schwann cells. All figures are ×100 by original magnification.

FACS analysis

The percentages of CD8⁺ and CD11c⁺ cells 3 days after pGM-CSF injection were analyzed using a FACS analyzer. In the present study, DCs were partially purified by a previously described method (31). As shown in Fig. 4⇓, the percentage of both CD8⁺ and CD11c⁺ cells was 3.21% in the enhanced cells from mice that had been injected with pGM-CSF. In the control, the percentage of these positive cells was 1.07%. The results of two other experiments showed that these double-positive cells after pGM-CSF injection were 3.02 and 2.96%, whereas these double-positive cells in the noninjected groups were 1.13 and 0.97%, respectively. These results suggest that both the CD8⁺ and CD11c⁺ cells in the regional lymph nodes increase when pGM-CSF is injected 3 days before of pGP160 immunization.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Expression of CD8 and CD11c Ags on partially enriched DCs in regional lymph nodes.

In vitro DNA vaccine immunization with IL-4 and GM-CSF-cultured DCs

Our histological findings combined with previous reports (17, 21, 22, 23, 45) suggested that DCs play an important role in GM-CSF-mediated immune responses. Therefore, we cultured purified DCs with IL-4 and GM-CSF. These cells were then cocultured for 6 h with HIV-1 plasmids in the presence of Lipofectin and then were transferred into naive mice. As shown in Table IV⇓, HIV-1-specific serum IgG, IgG1, IgG2a, and mucosal IgA Abs were markedly increased in mice when 1 × 10³ or more of DNA vaccine-pulsed DCs were transferred. An increased ratio of G1/G2a was also observed after this DNA-pulsed DC transfer. However, this DCs-mediated Ab response was significantly suppressed when either anti-GM-CSF mAb or anti-IL-4 mAb was i.p. injected. Neither anti-IL-12 mAb nor anti-Mb Ab suppressed this immune. This result suggests that both GM-CSF and IL-4 are playing important roles in HIV-1-specific Ab induction.

Transferring DNA-pulsed DCs also enhanced DTH response with the correspondent protein (Table V⇓). In this study, we observed a significantly suppressed HIV-1-specific DTH response only in anti-GM-CSF mAb. Compared with GM-CSF, IL-4 seems to have only a minor role in this DC-mediated DTH response, which might be due to the signal transudation by a shared receptor of IL-4 and IL-13 (46).

The type of cytokines activated by these DNA plasmid-pulsed DCs was then examined. The spleen cells from mice that had received plasmid-pulsed DCs were cocultured with gp160 Ag, and the cytokine levels were assayed using the supernatants. As shown in Fig. 5⇓, the pattern of cytokine production of lymphoid cells from recipients of plasmid-pulsed DCs was similar to those of lymphoid cells from mice inoculated with pGM-CSF 3 days before DNA vaccination. These results support the conclusion that DCs contribute to the process of immune activation of Th2-type responses induced by pGM-CSF injected 3 days before DNA vaccination.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

IL-4 and IFN-γ production lymphocytes of mice to which DNA-pulsed DCs were transferred. The source of the samples and the method of assay are the same as for Fig. 2⇑. These data represent the mean ± SE of five to seven mice. The data of two other experiments are almost the same.

We then examined whether these cultured DCs induced IL-4 production, because that cytokine can induce the maturation of Th0 into Th2 cells (47, 48). RNA was extracted from DCs cultured for 6 h in medium supplemented with IL-4 and/or IL-12. IL-4 mRNA was detected in IL-4-treated DC-enriched samples, but not in samples cultured with IL-12 (Fig. 6⇓).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Detection of IL-4 and β-actin transcripts using RT-PCR assay. A, IL-4 transcript. Lane 1, DCs cultured with IL-4; lane 2, DCs cultured without IL-4; lane 3, DCs cultured with IL-12; lane 4, bone marrow cells. B, β-actin transcript. Lane 1, DCs cultured with IL-4; lane 2, DCs cultured without IL-4; lane 3, DCs cultured with IL-12; lane 4, bone marrow cells.

Finally, we studied the level of IL-4 in the serum of the mice transferred with DCs. Although there was some tendency for increasing IL-4 levels in the serum of the DC-transferred group, no statistically significant difference was found between groups. This might be due to the poor sensitivity of this assay.

Effects of coadministering additional cytokine-encoding plasmids with pGM-CSF

We then examined whether coadministering other cytokine expression plasmids with pGM-CSF effected the immune response to pGP160. Given the complexity of these studies, all plasmids were injected simultaneously rather than at various periods before or after pGP160 administration. As seen in Table VI⇓, inclusion of pIL-4 improved the Ag-specific IgG and IgG1 response of vaccinated mice, as well as their mucosal IgA production. Plasmid-encoding IFN-γ selectively promoted IgG2a Ab production, consistent with its ability to induce isotype switching from IgM to IgG2a. Plasmid-encoding IL-2 had a suppressive effect on Ab production, particularly of the IgG1 isotype.

The coadministration of plasmids encoding IL-12 also significantly increased the DTH response of mice vaccinated with pGM-CSF plus pGP160 (Table VII⇓). However, the combination of GM-CSF with pIL-4 did not improve the DTH response.

We then examined whether these plasmid combinations impacted the generation of CTL. A significant increase in CTL activity was observed by adding plasmids encoding IL-12 with pGP160 (Fig. 7⇓). Significantly decreased CTL activity was observed when the DNA vaccine and pGM-CSF were injected in combination with anti-GM-CSF mAb or plasmid-encoding IL-4.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Comparison of adjuvant activity was using pGM-CSF and other cytokine expression plasmids. The experimental conditions were the same as described in Fig. 1⇑. A, Data are the means of the experiments. B, Mean values ± SE of CTL activities from individual immune mouse (E:T = 80:1). ∗, Significantly significant difference from the pGP160IIIB-inoculated group with other plasmid-inoculated groups (p < 0.05). a, Statistically significant difference between DNA vaccine plus pGM-CSF-inoculated and other experimental groups (E:T = 80:1).

Finally, we examined the effect of plasmid combinations on cytokine production. IL-4 production was increased when pGP160 was administered in combination with pGM-CSF or pGM-CSF plus the IL-4 expression plasmid (Fig. 8⇓). In contrast, IFN-γ synthesis was decreased when the IL-4 expression plasmid was coadministered with pGM-CSF and the DNA vaccine.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 8.

Influence of other cytokine expression plasmids on IFN-γ production induced by DNA vaccine and pGM-CSF. The same culture supernatants as for Fig. 2⇑ were assayed using ELISA kits. The data analysis and presentation are the same as for Fig. 2⇑. The results of two other experiment showed almost the same.