A Tailless Fas-FADD Death-Effector Domain Chimera Is Sufficient to Execute Fas Function in T Cells But Not B Cells of MRL-lpr/lpr Mice

Plasmids

The DNA encoding the extracellular portion of mouse Fas was derived from the XbaI fragment of pEFBOS-Fas 3, 21 . The FasΔCT was constructed by inserting this XbaI fragment into the XhoI site of pCI plasmid (Promega, Madison, WI). The Fas-FADD truncation chimeras were generated in two steps. Plasmids encoding fusion proteins with FADD 1–96, 19–96, 1–82, and 1–67 were derived by PCR using oligonucleotides based on the mouse FADD cDNA sequence 9, 22 . The oligonucleotides have XbaI/MluI linkers on the ends. Fragments were then subcloned into the XbaI/MluI site of pCI-FasΔCT. For the full-length FADD chimera, the XbaI fragment of pEFBOS-Fas was first cloned into the SmaI site of pEV3S 23 . The NcoI/XhoI fragment of the mouse FADD cDNA was then cloned into the Asp318 site of the pEV3S-FasΔCT clone. The insert of the resulting plasmid was cut out with EcoRI/XbaI and subcloned into pCI vector (Promega).

For stable transfections, the XhoI/SalI fragment of pCI-FasΔCT was subcloned into the BamHI/HindIII sites of pHβApr-1-neo plasmid 24 . For transfection of the Fas-FADD 1–96 chimera, the pCI-Fas-FADD 1–96(1–96) plasmid was linearized with SalI and was cotransfected in a 1:3 molar ratio with the linearized pHβApr-1-neo plasmid (cut with NdeI).

The transgenic construct was cloned in two steps. The BamHI/EcoRI fragment of p1017 25, 26 encoding the human growth hormone exons was inserted into the EcoRV site of pSP72-Vα11.1 plasmid containing a 600-bp XbaI fragment of the TCR Vα11.1 promoter fragment from pTCR1700 27 . This generates the pVα11-GH plasmid. The XhoI/SalI fragment from pCI-Fas-FADD 1–96(1–96) was then inserted into the BamHI site of pVα11-GH. The resulting plasmid was linearized with SphI and was coinjected in an equimolar ratio with the SalI/ClaI 9.5-kb fragment of pLCRc plasmid 28 , which contains the TCRα locus control region 29 .

Antibodies

Anti-poly (ADP ribose) polymerase (PARP) (C2–10) for Western blot analyses was purchased from PharMingen (San Diego, CA). Anti-FADD was used as previously described 9 . The secondary Abs for Western blot analysis were either sheep anti-mouse Abs (whole IgG) from Amersham (Arlington Heights, IL) or goat anti-rabbit IgG (heavy and light chain) from Caltag (South San Francisco, CA). For in vitro assays, anti-Fas (Jo2) was purchased from PharMingen with no azide and low endotoxin. For flow cytometric analysis CD16/CD32 (2.4G2), Thy1.2 (53-2.1) FITC, Jo2 FITC, and Annexin V FITC were purchased from PharMingen, and B220-PE (RA3-6B2), CD4-PE (CT-CD4), CD8α-TC (CT-CD8a), TCRαβ-PE (H57-597) were purchased from Caltag. Anti-CD3 (500A2) and anti-CD28 (37.51) ascites were produced in house. Both were titrated for effective concentration and were used at 1 μg/ml and 5 μg/ml, respectively, unless otherwise noted.

Transgenic mice

MRL/Mpj Fas^lpr mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Transgenic mice were generated by microinjection of DNA into the pronucleus of (C57BlXCBA) F₁ fertilized mouse eggs, and transferred to pseudo-pregnant CD1 foster mothers. Founders were identified by Southern blot analysis and PCR typing. Each line was then backcrossed for a minimum of two generations to obtain transgenic and homozygous lpr/lpr mice.

Mouse typing

Tail DNA was tested for two alleles. First, the transgenic allele (Tg) PCR primers and conditions are as follows: 5′-CCCTTGAGCCATGCACAGC and 3′-CGCCTCGAAGTCGTCCAGG for 1 min at 95°C, 1 min at 59°C, 1 min at 72°C for 29 cycles, 5 min at 72°C, and soak at 4°C. The Tg allele is a 436-bp fragment. Lastly, the lpr allele PCR primers and conditions are as follows (as described by Drs. Hui-Chen Hsu and John Mountz, unpublished observations): Three primers are F₁ GTAAATAATTGTGCTTCGTCAG (Fas intron 2), R1 TAGAAAGGTGCACGGGTGTG (corresponds to the sequence of the viral insertion in the lpr locus), and R2 CAAATCTAGGCATTAACAGTG (Fas intron 2) for 1 min at 94°C, 45 s at 50°C, 45 s at 74°C for 30 cycles, 7 min at 74°C, and soak at 4°C. The wild-type allele is 184 bp and the lpr allele is 212 bp.

Flow cytometry

Cell suspensions were prepared from lymphoid organs of mice 6–16 wk of age. Briefly, thymocytes, lymph node cells, and splenocytes were depleted of erythrocytes by treatment for 5 min at room temperature with Red Blood Cell Lysis Buffer (Sigma, St. Louis, MO). Cells were filtered, washed, and resuspended in PBS, 4% FCS, and 1 mM NaN₃ for analysis. One million peripheral lymphoid cells were incubated with anti-FcγRII/III Ab (2.4G2; PharMingen) and normal rabbit serum for 10 min at 4°C before cell surface staining. Cell surface staining was conducted for an additional 20 min in staining buffer with the appropriate Abs. Cells were washed twice, and analysis was performed on the Beckman-Coulter (Fullerton, CA) EPICS XL-MCL.

Western blot and in vitro translation

For PARP western blot, transfected cells were collected and lysed in 62.5 mM Tris (pH 6.8), 6 M urea, 10% glycerol, 2% SDS, and 5% 2-ME and briefly sonicated. Lysate was then heated to 65°C before loading onto 8.5% SDS-PAGE. Gels were transferred to Optitran membrane (Schleicher & Schuell, Keene, NH), blocked for 2 h at room temperature, and incubated with primary Ab (C2–10) overnight at 4°C. The next day, the blot was washed and probed with horseradish peroxidase (HRP) anti-mouse Abs (Amersham). Chemiluminescence was conducted using Renaissance Western blot chemiluminescence reagent (New England Nuclear, Boston, MA). For FADD Western blot analysis, a cell pellet of 2.5 × 10⁷ cells was lysed in 0.5% Nonidet P-40, 150 mM NaCl, 1 mM EDTA, 50 mM Tris (pH 7.5), 1 mM DTT, 0.1 M NaF, 1 mM Na₃V0₄, and 1 mM PMSF. Five million cells were loaded per lane onto a 12% SDS-PAGE. The transfer and blotting were done as before using the appropriate Abs. For in vitro translation all pCI constructs were linearized with NotI and were transcribed with T7 polymerase (NEB, Beverly, MA). In vitro translation was conducted using the rabbit reticulocyte lysate system (Promega) as per manufacturer’s protocol.

Apoptotic assays

TUNEL assay 30 was conducted using the in situ cell death detection kit, fluoroscein (Boehringer Mannheim, Indianapolis, IN) per manufacturer’s protocols. Briefly, 10⁶ stably transfected cells with and without anti-Fas treatment were aliquoted into a 96-U-well plate and fixed in 4% paraformaldehyde and PBS at room temperature for 30 min. Cells were subsequently washed with 1% BSA and PBS and permeabilized on ice for 2 min with 0.1% Triton X-100 in 0.1% sodium citrate. Cells were washed twice and incubated with TUNEL reaction mixture for 1 h at 37°C. Cells were washed and analyzed by flow cytometry.

ELISA

Sera were prepared from mice between 16 and 17 wk of age. Serum isotypes were quantified using the clonotyping system/HRP and the mouse Ig standard panel (Southern Biotechnology Associates, Birmingham, AL). All concentrations were calculated from the appropriate standard curve and the appropriate dilutions. Serum levels of anti-dsDNA Abs were quantified using the Hemagen DNA kit (Hemagen, Waltham, MA), per manufacturer’s protocol. A change to the protocol includes the use of an alternate secondary Ab, goat anti-mouse IgG HRP (Southern Biotechnology Associates).

Cell culture and proliferation assay

Jurkat T cells were grown in RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% FCS, 2 mM glutamine, 1 mM sodium pyruvate, 100 U/ml of penicillin/streptomycin, 10 mM HEPES, and 80 μM 2-ME. Twenty million cells per construct were electroporated at the following settings: 250 volts, 750 μF. Cells were allowed to recover from transfection for 8 h, after which dead cells were removed by Ficoll gradient (Sigma). Live cells were recovered from the gradient, washed, and cultured overnight. Treatments to the cells were conducted the next day. YAC-1 cells were grown and transfected as described above. Twenty-four hours posttransfection, dead cells were removed by Ficoll gradient and the live cells were put under selection conditions, 1 mg/ml G418 (Life Technologies). Selection medium was replenished every 48 h. Colonies were picked after 7 days, expanded and checked for expression by flow cytometry, and confirmed by Western blot analysis. Lymph node cells were harvested in complete RPMI 1640 and depleted of RBC as described. B cells were depleted using Dynabeads mouse pan B (B220) (Dynal, Great Neck, NY). One hundred thousand T cells (>97% purity) were triplicate cultured in round-bottom 96-well plates, previously coated with 1 μg/ml of anti-CD3 (500A2). Anti-CD28 (37.51) was added in solution at a final concentration of 5 μg/ml. [³H]thymidine (1 μCi; NEN) was added per well. Cells were harvested, and ³H incorporation was measured at the times indicated.

Characterization of the Fas-FADD chimeras in T cell tumors

We generated the Fas-FADD chimeric molecules by fusing the first 183 amino acids of the mouse Fas protein encoding the extracellular and transmembrane domain (FasΔCT) to the full-length FADD or various truncations of the FADD death-effector domain (amino acids 1–96, 19–96, 1–67, and 1–82; Fig. 1⇓). They were cloned into an eukaryotic expression plasmid and shown to produce proteins of expected size as assessed by in vitro translation (Fig. 2⇓A). To evaluate their apoptotic function, the Fas-FADD constructs were transiently transfected into human Jurkat T cells, and their ability to induce apoptosis was measured by PARP cleavage 31 . Apoptosis was initiated by addition of anti-mouse Fas Abs, which do not recognize the endogenous human Fas protein. As shown in Fig. 2⇓B, the truncated Fas did not induce PARP cleavage by itself nor when stimulated by anti-Fas Abs. In contrast, the Fas-FADD chimera containing the full-length 1–96 or 1–82 regions of FADD induced PARP cleavage when cross-linked by anti-Fas Abs (Fig. 2⇓B). Deletion of the first 18 amino acids of the FADD death-effector domain or its C-terminal region abolished their ability to induce PARP cleavage (Fig. 2⇓B). These data are consistent with the proposed role of FADD death-effector domain to recruit caspase-8 to the membrane 2, 5, 6 . Fas-FADD 1–96(1–96) was further chosen for analysis in stable transfection experiments. For this purpose, we used a subclone of the mouse T cell tumor YAC-1 that had been selected for low Fas cell surface expression by cell sorting. Stable transfectants were obtained with either tailless Fas (FasΔCT) or Fas-FADD 1–96(1–96) proteins, indicating that the Fas-FADD chimera is not toxic to the cells. Stimulation of three independent Fas-FADD stable clones (G3, H3, and D9) with the anti-Fas Abs resulted in a high level of apoptosis as measured by the TUNEL assay (Fig. 2⇓C). As controls, neither the parental YAC-1 cells nor the FasΔCT clones (A11, C2) showed any significant apoptosis when treated with anti-Fas Ab (Fig. 2⇓C). We concluded that Fas-FADD 1–96(1–96) fusion protein, hereafter termed Fas-FADD, is not lethal to cells and is capable of delivering Fas apoptotic signals.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

A schematic diagram of the mouse Fas-FADD transgene. A schematic diagram of the mouse Fas protein is depicted as a black box for its extracellular domain (1–148), an open box for the transmembrane domain (TM, 149–165), its membrane proximal (166–216), and distal region of the cytoplasmic tail (292–306), and a stippled box for the death domain (DD, amino acid 217–291). The mouse FADD protein is drawn in a gray box, which indicates its death-effector domain (amino acid 1–96) and a stippled box for its death domain (97–206). The Fas-FADD cDNA used for transgenic experiments was derived by fusing the mouse Fas cDNA encoding the first 183 amino acids to the mouse FADD cDNA encoding its first 96 amino acids. A 6-amino acid peptide (SREFTR) was introduced into the junction between Fas and FADD because of the polylinker sequence used for cloning. The Fas-FADD (1–96) transgenic construct consists of the TCR Vα11.1 promoter, Fas-FADD cDNA and the human growth hormone minigene. The TCRα locus control region (28, 29) with all eight DNase I hypersensitive sites (1–8) was coinjected with the Vα11.1-Fas-FADD cassette into the mouse embryos.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Characterization of the Fas-FADD chimeras in T cell lines. A, Five different versions of the Fas-FADD chimeric cDNAs (fusion of Fas 1–183 to full-length FADD, 1–96, 19–96, 1–67, or 1–82 of FADD) and the truncated Fas cDNA (FasΔCT) were transcribed and translated in vitro using standard techniques. Samples were run on a 12% SDS-PAGE gel and were developed using autoradiography. B, The tailless Fas (FasΔCT) or five different versions of Fas-FADD chimeric constructs were transiently transfected into Jurkat T cells. Cells were treated with or without 0.5 μg/ml anti-Fas (Jo2) for 6 h. Whole cell extracts were made after this incubation time and were subjected to Western blot analysis using anti-PARP Abs. Upon Fas stimulation, PARP cleavage (an indication of apoptosis) was detected in cells transfected with Fas-FADD chimeras containing either a full-length FADD, 1–96 death-effector domain of FADD, or the first 82 amino acids of mouse FADD. The experiments have been repeated several times with similar results. C, Stable transfectants were generated using pHβ-APr-neo plasmid expressing the tailless Fas or by cotransfecting the same neomycin-containing plasmid with the Fas-FADD (1–96) cDNA under expression of the cytomegaloviral promoter/enhancer. Constructs were transfected into YAC-1 T cell subclones that were sorted for a lack of Fas cell surface expression by flow cytometry. Two FasΔCT stable clones (A11 and C2) and three Fas-FADD clones (G3, H3, and D9) were tested for their sensitivity to Fas killing using the TUNEL assay. All five clones express equivalent amount of Fas on the cell surface (data not shown). Upon stimulation with 0.5 μg/ml of anti-Fas (Jo2), the Fas-FADD clones undergo apoptosis, while clones expressing the tailless Fas protein remain viable. As a control, the parental YAC-1 cells, which express very little Fas on the cell surface, remain TUNEL-negative under similar conditions. Open and shaded bars represent duplicate samples.

Generation of Fas-FADD transgenic mice

Fas-FADD transgenic mice were generated using the chimeric Fas-FADD 1–96(1–96) cDNA under the control of the TCRα promoter and locus control region 29 . This locus control region has previously been shown to confer copy number-dependent and integration-independent expression to a transgene in both thymus and spleen 28 . Thus, the Fas-FADD fusion protein should be expressed in both the developing and the mature T cell compartment. The expression pattern was confirmed using Western blot and flow cytometric analyses (Fig. 3⇓). Abs for mouse FADD were used to detect expression of the transgenic protein, which runs at a higher m.w. than the endogenous FADD. Transgene expression was detected in both thymocytes and splenocytes of three separate lines (lines 2, 4, and 8). Line 8 has the highest while line 2 has the lowest transgenic expression (Fig. 3⇓A). Transgene expression in the peripheral lymphocyte organs is high (Fig. 3⇓A and data not shown), as expected for a transgene under the control of the TCRα locus control region. All the transgenic founders were subsequently mated to MRL-lpr/lpr mice for at least two generations to generate transgenic mice in Fas-deficient background. Cell surface expression of transgenic Fas-FADD fusion protein in thymocytes, splenocytes, and lymph node cells was examined in line 8 lpr/lpr mice (Fig. 3⇓B and data not shown). In the thymus, Fas expression was found in the majority of CD4⁺CD8⁺ (double positive, DP) and all of CD4⁺CD8⁻, CD4⁻CD8⁺ (single positive, SP) thymocytes but not in the CD4⁻CD8⁻ (double negative, DN) population (Fig. 3⇓B). Endogenous Fas from lpr/+ mice is expressed in a similar fashion (Fig. 3⇓B), as described previously 32 . While expression of the transgenic Fas-FADD is higher than the endogenous Fas in MRL-lpr/+ mice, it is similar to levels of Fas found in the thymocytes of C57BL/6 mice (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

Fas-FADD transgenic expression pattern. A, Whole cell extracts were made from thymus and spleen of line 2, line 4, and line 8 Fas-FADD transgenic mice. Western blot analysis was performed using purified rabbit anti-mouse FADD Abs. The transgenic protein (Fas-FADD Tg) runs at a higher m.w. (roughly 46 kDa) than the endogenous FADD, which runs close to the 30-kDa marker. B, Flow cytometric analysis of thymocytes from lpr/lpr, lpr/+, and line 8 Fas-FADD transgenic in lpr/lpr background. Thymocytes from 8-wk-old mice were analyzed using anti-CD4, anti-CD8, and anti-Fas Abs. Fas expression is plotted on the x-axis for each individual thymocyte population (DP: double positive, CD4⁺CD8⁺; SP: single positive, CD4⁺CD8⁻ and CD4⁻CD8⁺; DN: CD4⁻CD8⁻).

Transgenic Fas-FADD does not grossly affect T cell development

Thymocytes of transgenic and nontransgenic littermates were analyzed using various Abs that stain different T cell populations. The total thymocyte cell number for transgenic mice did not vary significantly from that of the nontransgenic counterparts in either lpr/+ or lpr/lpr background (Figs. 4⇓ and 5A for line 8, similar results were obtained for other lines of transgenic mice). Staining with anti-CD4, CD8, and CD3 did not reveal any abnormalities in transgenic thymocytes. Normal percentages of DP, SP, and DN T cells were found in all the transgenic mice examined, whether they were in lpr/lpr or lpr/+ background (Fig. 4⇓). Staining with anti-CD69 activation markers also did not reveal any significant differences between transgenic and nontransgenic thymocytes. When cultured in vitro, transgenic thymocytes did die faster over time as compared with their nontransgenic counterparts (data not shown). However, the number of steady-state transgenic thymocytes in vivo did not significantly differ from that of the wild-type mice (Fig. 5⇓A). Thus, expression of the Fas-FADD fusion protein does not grossly affect T cell development.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Analysis of transgenic thymocytes and peripheral T cells. Flow cytometric analysis of thymocytes and lymph nodes from nontransgenic lpr/+, nontransgenic lpr/lpr, and line 8 Fas-FADD transgenic mice in lpr/lpr background. Thymocytes or lymph nodes (eight total from the following areas: superficial inguinal, axillary, lateral axillary, and cervical) from 5-wk-old mice were analyzed using anti-CD4 and anti-CD8 Abs. The total cell numbers for organs from each mouse are indicated below. The number in each quadrant corresponds to the percentage of the corresponding population.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Rescue of T cell abnormality by the Fas-FADD transgene. A, Total cell number of thymocytes, lymph node cells, as well as spleen weight (in grams) of wild-type (lpr/+), Fas-FADD transgenic (line 8) lpr/+,lpr/lpr, and lpr/lpr Fas-FADD transgenic (line 8) mice. Mice were analyzed at 16–17 wk of age. B, Flow cytometric analysis of lymph node cells from lpr/+, lpr/lpr, and lpr/lpr transgenic Fas-FADD (Tg) mice. Abs for B220 and Thy-1 were used for staining. The numbers in each quadrant denote percentages for each cell population. “High” indicates mice from line 8 littermates, which express a high level of transgenic protein in those that are typed transgene positive. “Mid” denotes littermates from line 4 transgenic mice, which express a modest amount of Fas-FADD fusion protein. Mice were analyzed at 16–17 wk of age.

Peripheral T cells of 5- to 8-wk-old line 8 transgenic mice were examined. The Fas-FADD transgenic mice contained normal numbers of splenocytes and lymph nodes T cells (Fig. 4⇑ and data not shown). The percentages of CD4 or CD8 SP T cells were similar to that of their nontransgenic lpr/+ littermates, while the nontransgenic lpr/lpr mice already contained slightly elevated cell numbers (Fig. 4⇑). Examination of early activation markers CD69 and Mel14 indicated that the transgenic mice contained a slightly higher number of CD69⁺ cells and a slightly lower percentage of Mel14⁺ cells (data not shown). However, the profile of two late T cell activation markers, CD25 and CD44, in these mice are normal (data not shown). These data suggest that the transgenic T cells may be somewhat activated.

Absence of lymphadenopathy, splenomegaly, and Thy-1⁺B220⁺ T cell population from MRL-lpr/lpr mice expressing the Fas-FADD protein

Fas deficiency in lpr/lpr mice leads to severe autoimmune problems in both T and B cells. Introduction of wild-type Fas into T cells of lpr/lpr mice was shown to eliminate their T cell abnormality, lymphadenopathy, and splenomegaly but not the B cell autoimmunity 33 . To see if the Fas-FADD fusion protein is functionally equivalent to Fas in vivo, we analyzed a number of aged transgenic mice in the lpr/lpr background. As shown in Fig. 5⇑A and Table I⇓, while lpr/lpr mice developed lymphadenopathy and enlarged spleens, lpr/lpr mice with high levels of Fas-FADD transgene expression showed normal numbers of lymph node cells and splenocytes. A similar but less dramatic rescue was observed in line 4 mice, which contain a fewer number of cells expressing the transgenic protein (data not shown, see below). Transgenic mice from the line 2 founder, which barely express the Fas-FADD protein, did not have a significant effect on the lpr/lpr phenotype (data not shown).

Flow cytometric analysis further supported the notion that the Fas-FADD fusion protein is functionally equivalent to the wild-type Fas receptor in T cells. In addition to lymphadenopathy and splenomegaly, older lpr/lpr mice also develop an unusual T cell population, which is CD4⁻CD8⁻CD3⁺B220⁺Thy-1⁺ 34 . This signature T cell population has all but disappeared in the high expressing transgenic line (4% vs 79%; Fig. 5⇑B). This population was also greatly reduced in mice that expressed medium levels of Fas-FADD chimeric protein (20% vs 72%; Fig. 5⇑B). Thus, expression of the Fas-FADD transgene eliminates the T cell abnormality associated with lpr/lpr mice in a dose-dependent manner.

Normal proliferation of transgenic peripheral T cells in response to mitogens

Previous analysis of FADD-deficient mice indicated that FADD is not only required for Fas apoptosis but is surprisingly also essential for mitogen-induced T cell proliferation 19 . As FADD is normally not associated with Fas, the direct linkage between FADD and Fas in the Fas-FADD chimeric protein may accelerate cell death and affect T cell proliferation. In addition, Fas-FADD peripheral T cells appear somewhat activated (see above). We examined the proliferative capacity of Fas-FADD mature T cells by performing proliferation assays using purified T lymphocytes activated with anti-CD3 and anti-CD28 (Fig. 6⇓). Proliferation was detected starting at 24 h poststimulation and was measured up to 48 h after addition of anti-CD3 and anti-CD28. As shown in Fig. 6⇓, no substantial differences in T cell proliferation were observed between transgenic lpr/lpr, lpr/lpr, and wild-type (lpr/+) T cells. Consistent with these data, IL-2 production of activated transgenic T cells was not significantly different from that of the wild-type T cells (data not shown). We conclude that the presence of Fas-FADD chimera does not affect proliferative capacity of peripheral T cells.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Proliferation assay. Proliferative response of lymph node T cells to TCR stimulation. Solid black diamonds indicate wild-type (lpr/+), solid black squares indicate lpr/lpr, and solid gray triangles indicate lpr/lpr transgenic Fas-FADD (line 8) T cells. Purified T cells from 11-wk-old mice were stimulated with immobilized anti-CD3 (500A2) and soluble anti-CD28. Results are presented as incorporated [³H]thymidine counts measured from triplicate cultures over time.

B cell abnormality in Fas-FADD lpr/lpr mice

In addition to the T cell dysfunction, Fas deficiency also results in a B cell abnormality as manifested by a high level of serum Abs, development of glomerulonephritis, and the presence of anti-dsDNA Abs 34 . Although there were initial conflicting reports regarding interdependency of B and T cell dysfunction 35, 36, 37, 38, 39 , recent results favored a function for Fas in both T and B cells 33, 40, 41 . Thus, the rescue of T cell abnormality alone would not necessarily lead to resolution of the B cell autoimmunity unless Fas is functional in B cells as well. We examined this issue in the Fas-FADD transgenic mice. Despite the use of TCR locus control region, Western blot analysis showed that the transgenic protein is expressed at a high level in purified transgenic B cell population (Fig. 7⇓A). Expression of the chimera is higher than or equivalent to the endogenous FADD and is not too dissimilar from its expression level in total lymph nodes (75–80% T cells). This is further confirmed by flow cytometric analysis (Fig. 7⇓B). Wild-type B cells have been shown to express a low level of Fas receptor on their cell surface that is subsequently up-regulated upon B cell activation 42 . In contrast, a majority of the Fas-FADD transgenic IgM⁺ resting B cells constitutively express the chimeric protein (Fig. 7⇓B). Its level is similar to the cell surface expression on the peripheral T cells (Fig. 7⇓C).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 7.

Fas-FADD expression in B cells by Western blot analysis and FACS analysis. A, Bone marrow cells, splenic B cells (>95% pure B cells purified using anti-Thy1.2/complement lysis), lymph node cells (75–80% T cells), and thymocytes from wild-type and transgenic Fas-FADD lpr/+ were lysed, and Western blot analysis was performed using purified rabbit anti-mouse FADD Abs. “Tg⁻” denotes cells from a wild-type mouse, and “Tg⁺” denotes cells from a transgenic Fas-FADD mouse. B, Lymph node cells from 5-wk-old mice were collected, stained for flow cytometry, and gated on IgM⁺ cells. Fas expression is plotted on the x-axis and overlaid for the following three genotypes: lpr/+ denotes wildtype, lpr/lpr denotes homozygous MRL-lpr, and Tg⁺ lpr/lpr denotes transgenic Fas-FADD in a homozygous MRL-lpr background. Similar results were obtained from splenic IgM⁺ cells. C, Lymph node cells from 5-wk-old mice were collected, stained for flow cytometry, and gated on TCRαβ⁺ cells. Fas expression is plotted on the x-axis and overlaid for the same three genotypes as in B.

The presence of serum Abs and anti-dsDNA Abs was measured using ELISA assays in transgenic and nontransgenic littermates of lpr/+ and lpr/lpr background. As shown in Fig. 8⇓A, nontransgenic lpr/lpr mice expressed elevated amounts of serum IgM, IgG1, IgG2a, IgG2b, and IgG3 when compared with their lpr/+ littermates. The levels of serum Abs in the transgenic lpr/lpr mice were reduced, although they were still higher than those found in the wild-type lpr/+ mice. These are particularly obvious for IgG1, IgG2a, IgG2b, and IgG3. Similar results were found for anti-dsDNA Abs (Fig. 8⇓B). While lpr/lpr mice expressed elevated amounts of anti-DNA Abs, the transgenic lpr/lpr mice expressed intermediate levels of serum autoantibodies. Thus, in contrast to the T cell compartment, the B cell abnormalities of MRL-lpr/lpr mice are not completely diminished despite a high level of Fas-FADD chimera expression.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 8.

Partial rescue of B cell abnormality in Fas-FADD transgenic lpr/lpr mice. A, Serum Ab levels were determined using ELISA assay as described in Materials and Methods. Each circle denotes the serum level of one mouse, and numbers along the y-axis represent units in mg/ml. Gray filled circles indicate the level of antiserum in the lpr/lpr Fas-FADD transgenic mice. B, Serum levels of anti-dsDNA Abs were determined using ELISA assay. Each circle denotes the level (in arbitrary units) of anti-DNA Abs present in the serum of one mouse based on a standard curve supplied by the manufacturer (Hemagen). Gray filled circles denote the level for lpr/lpr Fas-FADD transgenic (Tg) mice.