Human Polymorphonuclear Leukocytes Produce IL-12, TNF-α, and the Chemokines Macrophage-Inflammatory Protein-1α and -1β in Response to Toxoplasma gondii Antigens

Parasite extracts

RH strain T. gondii tachyzoites were maintained by biweekly passage on human foreskin fibroblasts in DMEM (Life Technologies, Grand Island, NY), 1% FCS (HyClone, Logan, UT), 100 U/ml of penicillin, and 0.1 mg/ml of streptomycin (Sigma, St. Louis, MO). Soluble tachyzoite Ag (STAg) was prepared as previously described (24). Briefly, tachyzoites were sonicated in the presence of protease inhibitors (0.2 mM PMSF, 0.2 mM aprotinin, 1 mM leupeptin, and 1 mM EDTA), dialyzed into PBS, and filter sterilized through a 0.2-μm membrane (Corning Costar, Cambridge, MA), assayed for protein concentration, and stored at −70°C. Parasite extracts were found to be free of endotoxin as measured by the Limulus amebocyte assay. Parasite cultures were free of Mycoplasma contamination as determined by diagnostic RT-PCR and ELISA (kits from Strategene, La Jolla, CA and Boehringer-Mannheim, Indianapolis, IN, respectively), as well as by microbiological assay and fluorescent DNA staining (performed by the Mycoplasma Testing Laboratory, Coriell Institute for Medical Research, Camden, NJ)

Toxoplasma ELISA

Peripheral blood from healthy human donors was obtained by venipuncture and collected in vacutainer tubes (Becton Dickinson, Franklin Lakes, NJ) containing EDTA. Whole blood was centrifuged (13,000 × g, 5 min), plasma was transferred to a new tube, and an ELISA was performed to test for T. gondii-seropositive individuals as described below.

First, 96-well ELISA plates (Corning Costar) were coated with STAg diluted in PBS (25 μg/ml), and the plates were incubated at 37°C for 2 h. After washing in PBS with 0.05% Tween 20, the plates were blocked by overnight incubation at 4°C in 1% BSA in PBS. Plates were subsequently washed and a serial dilution of each plasma sample was added to wells and incubated at 37°C for 2 h. After washing the plates, a HRP-conjugated goat anti-human Ab (Jackson Immunoresearch Laboratories, West Grove, PA) was added to sample wells and the plates were incubated a further 90 min at 37°C. After washing, the plates were developed with 2.2-azino-di(3-ethyl-benzthiazoline sulfonate) (ABTS; Kirkegard and Perry Laboratories, Gaithersburg, MD), absorbance (405 nm) was measured on a Microplate BIO Kinetics Reader (Bio-Tek Instruments, Winooski, VT), and the results were compared with a positive serum pool.

Isolation of human neutrophils

Whole blood was obtained from T. gondii-seronegative individuals by venipuncture and was placed on ice. Neutrophils were isolated as previously described (25) with the following modifications. Before blood collection, an isotonic solution of Percoll (Pharmacia Biotech, Piscataway, NJ) was prepared by mixing nine parts Percoll with one part 10× HBSS (Life Technologies). Next, 69% and 75% Percoll solutions were prepared from isotonic Percoll diluted with 1× HBSS. Then 1.5 ml of 75% Percoll was poured into a 15-ml round-bottom tube and overlaid with 3 ml of the 69% solution. Whole blood was diluted 2-fold with complete RPMI 1640 media (10% FCS, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 30 mM HEPES, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 5 × 10⁻⁵ M 2-ME), and 4 ml was overlaid on the Percoll gradients. Tubes containing Percoll gradients and blood were centrifuged (500 × g) for 30 min at room temperature. The band corresponding to the neutrophil fraction was collected, washed twice with complete RPMI 1640 media, and cells were counted. To determine the purity of isolated cells, differential cell counts were performed on Diff-Quik (American Scientific Products, McGraw Park, IL)-stained cytocentrifuge slides, counting a minimum of 500 cells per slide.

Neutrophil stimulation

PMN were plated in triplicate for each experimental group in a 96-well tissue culture plate (Corning Costar) at 1 × 10⁶ cells/well in complete RPMI 1640 media with either media alone, LPS (1 μg/well), or STAg (50 and 100 μg/well). Tissue culture plates were incubated at 37°C with 5% CO₂. Culture supernatants were removed at various times after culture initiation and stored (−70°C) until assayed for the presence of cytokines.

RNA isolation

At the time of supernatant harvest, cells were collected from triplicate wells and pooled in 200 μl of RNA STAT 60 (Tel-Test, Friendswood, TX), then placed in 2 ml Eppendorf tubes. To obtain sufficient RNA for analysis, triplicate samples were pooled. Cellular RNA was subsequently isolated by adding 40 μl of chloroform (Sigma) per 1 × 10⁶ cells, vortexing the tube, and centrifuging at 13,000 × g at 4°C for 15 min. The resulting aqueous phase was transferred to a new tube containing an equal volume of isopropanol (Sigma) and incubated at −20°C overnight. To precipitate RNA, a one-tenth volume of 3 M sodium acetate was added to the RNA-isopropanol solution, and the mixture was vortexed then centrifuged at 13,000 × g at 4°C for 15 min. The resulting pellet was washed in 75% ethanol, resuspended in H₂O, and the concentration was determined using a spectrophotometer equipped with a UV lamp (Beckman DU-50, Beckman Instruments, Palo Alto, CA).

RT-PCR and Southern blotting

RNA (6 μg) was reverse transcribed using oligo(dT) primers (Promega, Madison, WI). After heating samples to 72°C and chilling on ice to allow hybridization, a master mix (5× reverse transcriptase buffer, 0.1 M DTT, 2.5 mM dNTPs, 40 U/ml RNasin, and 200 U/ml superscript reverse transcriptase) was added, and the samples were incubated at 45°C for 60 min followed by 10 min at 94°C. The resulting cDNA was either used immediately or stored at −20°C until PCR-mediated gene amplification.

The PCR was performed using a master mix containing dNTPs (2.5 mM), PCR buffer containing 1.5 mM MgCl₂ (Promega), primers (0.5 μM; 1:1 antisense: sense), and Taq polymerase (5 U/μl; Life Technologies). The nucleotide sequences employed as sense and antisense primers were: β-actin, TGACGGGGGTCACCCACACTGTGCCCATCTA, CTAGAAGCATTGCGGTGGACGATGGAGGG; MIP-1α, CGCCTGCTGCTTCAGCTACCTCCCGGCA, TGGACCCCTCAGGCACTCAGCTCCAGGTCG; MIP-1β, ACCCTCCCACCGCCTGCTGCTTTTCTTCAC, GTTGCAGGTCATACACGTACTCCTGGACCC. The program for PCR consisted of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min, with a final extension of 7 min at 72°C. The cDNA was amplified 33 cycles (β-actin), 31 cycles (MIP-1α), and 29 cycles (MIP-1β).

The RT-PCR products were resolved on 2% agarose gels, and bands were visualized by staining with ethidium bromide. A 100-bp DNA ladder (Life Technologies) was simultaneously run on the gels to confirm that PCR products possessed the predicted size. Photographs of gels were scanned and analyzed with the use of Adobe Photoshop software (Adobe Systems, Mountain View, CA). Integrated band size and pixel density was evaluated and expressed as a ratio of chemokine band intensity divided by β-actin band intensity.

Southern blotting was performed as described in detail elsewhere (26). Briefly, amplified DNA was blotted from agarose gels onto a Hybond-N⁺ membrane (Amersham International, Buckinghamshire, U.K.) and subsequently probed with internal cytokine-specific oligonucleotides. An enhanced chemiluminescence protocol was employed to detect binding (Amersham). The following probes were employed: MIP-1α, GACACCGGGCTTGGAGCACTGGCTGCTCGT; MIP-1β, AGAGGCTGCTGGTCTCATAGTAATCTACCA; β-actin, CATGAGGTAGTCAGTCAGGTCCCGGCCAGC.

Cytokine measurement

Levels of TNF-α and IL-12 (p70) in culture supernatants were measured using commercially available ELISA kits according to the manufacturer’s instructions (Genzyme, Cambridge, MA).

Recombinant cytokine and anti-cytokine treatment

The neutrophils were stimulated in the presence and absence of STAg with recombinant human TNF-α (100 ng/ml) and IFN-γ (20 U/ml) (PharMingen, San Diego, CA). The induction of MIP-1α and MIP-1β mRNA transcript synthesis was detected by RT-PCR 3 h after culture initiation. For blocking TNF-α, a neutralizing rabbit antiserum (Genzyme) was employed and compared with normal rabbit serum. Both reagents were used at a 1/500 dilution, a 100-fold excess in the amount required to neutralize >95% of the TNF-α activity.

Purification of PMN from T. gondii-seronegative donors

We wished to initially focus our study on donors possessing low T. gondii Ab titers who presumably had not been exposed previously to the parasite. T. gondii-specific serum Ab levels were measured by ELISA and 4 donors with titers >1/50 were selected for purification of PMN from peripheral blood. As shown in Table I⇓, the populations obtained ranged from 94–99% PMN. The vast majority of these cells were neutrophils, although for the case of donor 1, a relatively large proportion obtained were eosinophils on several separate occasions. Because neutrophils may undergo apoptotic death when cultured for 24 h and beyond (4, 5), we also measured cell viability after 12 h, the time at which our experiments were terminated. As shown in Table I⇓, there was no significant cell death during this period.

T. gondii stimulates neutrophil TNF-α and IL-12 production

Previous studies have shown that human neutrophils are capable of responding to bacterial LPS by producing TNF-α and IL-12 (8, 9), but their ability to produce these cytokines in response to protozoan stimulation is unexplored. Accordingly, PMN cultures were initiated from the seronegative donors listed in Table I⇑, and supernatants were assayed for the presence of IL-12 (p70) and TNF-α after stimulation with media or STAg.

As shown in Fig. 1⇓, parasite Ag induced IL-12 (p70) release from each of the donors. A low level of IL-12 production was found in the absence of parasite stimulation, possibly a result of nonspecific activation during the course of purification. Similar results were obtained in an RT-PCR analysis (data not shown), suggesting that the background IL-12 shown in Fig. 1⇓ is not an artifact of the ELISA. We also found that STAg stimulated production of TNF-α from the PMN. Although we found a degree of variability in the amount of cytokine produced from donor to donor, the production of TNF-α in the presence of STAg was consistently much greater than in media alone.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Human PMN secrete both IL-12 (p70) and TNF-α during in vitro stimulation with T. gondii. Responder cells were obtained from healthy donors with no previous exposure to T. gondii. The PMN were cultured with STAg (ST) or media alone (Med) for 2 h, then supernatants were collected for cytokine measurement. Levels of IL-12 (p70) and TNF-α were measured by cytokine-specific ELISA (see Materials and Methods for details). The results represent mean ± SD values for triplicate wells. In this figure, donors 1–4 correspond to those listed in Table I⇑.

Fig. 2⇓ shows the kinetics of cytokine production using PMN from one individual (donor 4). The release of IL-12 (p70) into culture supernatants in response to STAg occurred extremely rapidly, reaching maximal levels within 2 h. We do not at present know if this response is the result of preformed cytokine release, for example by granule exocytosis, or whether it represents the rapid up-regulation of IL-12 gene transcripts. However, similar studies using mouse neutrophils suggest that much of the IL-12 produced in response to STAg results from de novo protein synthesis.⁵ Interestingly, the kinetics of LPS-driven cytokine production differed from that of STAg (Fig. 2⇓). At 2 h, STAg-induced production of TNF-α was higher relative to LPS. Whereas STAg-induced TNF-α reached maximal levels at 6 h and subsequently declined, LPS-stimulated TNF-α production rapidly rose through this period. A similar kinetic profile was found for LPS-driven IL-12 (p70) production, but in contrast to TNF-α, LPS was a less potent stimulus for IL-12 production than was STAg. These and previously published data (24, 27) indicate that the underlying biochemical pathways triggered by LPS and T. gondii, which result in the induction of IL-12 and TNF-α, are distinct.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Kinetics of IL-12 and TNF-α production by PMN in response to T. gondii or LPS. Neutrophils were purified and stimulated with STAg (ST), LPS, or media (Med), and supernatants were harvested for cytokine measurement at the indicated time points after culture initiation. This figure shows the results from a single individual, but similar results were obtained from three additional donors.

T. gondii induces up-regulation of MIP-1α and MIP-1β in PMN

Because PMN, more than other cell types, are able to rapidly accumulate at a site of infection, we asked whether parasite-stimulated PMN produced chemotactic factors potentially involved in further immune cell recruitment. Both MIP-1α and MIP-1β, members of the CC chemokine family, are chemotactic factors for monocytes and dendritic, NK, and T cells (28, 29, 30, 31). As shown in Fig. 3⇓, RT-PCR analysis demonstrates rapid up-regulation of transcripts for both MIP-1α and MIP-1β, and up-regulation of these transcripts was sustained for at least 12 h following culture initiation.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

T. gondii up-regulates neutrophil MIP-1α and MIP-1β gene expression. PMN were purified and incubated with STAg (ST) or media (M). At the times indicated, cells were collected, RNA was isolated, and RT-PCR amplification was conducted as described in Materials and Methods. Amplified PCR products were separated on an agarose gel, stained with ethidium bromide, and photographed (A). A 100-bp ladder (mw, molecular weight) demonstrates that the PCR products possess the predicted size (MIP-1α, 195 bp; MIP-1β, 190 bp; β-actin, 661 bp). B, PCR products were amplified and subjected to Southern blot analysis employing internal chemokine-specific probes. The cell population used in this experiment was comprised of 94.7% neutrophils, 4.6% eosinophils, and 0.7% lymphocytes. Monocytes were not detected. This figure shows results using PMN from one representative donor but similar data were obtained over the course of three additional experiments using other donors.

The cytokines TNF-α and IFN-γ have been reported to exert effects on cytokine production by PMN. Thus, TNF-α possesses the ability to induce MIP-1α and IL-8, while IFN-γ appears capable of both inhibitory and stimulatory activity dependent upon the time of analysis (32, 33, 34). Accordingly, PMN were cultured with STAg or media in the presence of recombinant TNF-α or IFN-γ, and 3 h later cells were harvested and the induction of gene transcripts was examined. Fig. 4⇓, A and B show that exogenous TNF-α alone provided a potent stimulus for increased expression of MIP-1α and MIP-1β gene transcripts. The inclusion of STAg with TNF-α did not appear to further augment the expression of the chemokines. We found a different pattern when examining the effect of exogenous IFN-γ. In this case, the cytokine alone did not induce up-regulation of MIP-1α or MIP-1β transcripts. STAg-driven expression of the chemokines appeared slightly augmented when exogenous IFN-γ was included in the cultures (Fig. 4⇓, A and B).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Effect of exogenous IFN-γ and TNF-α on MIP-1α and MIP-1β expression. Human neutrophils were isolated and stimulated with STAg (ST) or media (M) in the presence or absence of recombinant human IFN-γ (20 U/ml) or TNF-α (100 ng/ml). Cells were harvested after 3 h, and RT-PCR analysis was conducted as described in Materials and Methods. A, The amplification products separated by agarose gel electrophoresis followed by ethidium bromide staining are shown. B, Transcript levels relative to β-actin, determined by scanning densitometric analysis, are shown. In this experiment, the cell population consisted of 95.3% neutrophils, 2.6% monocytes, and 2.1% lymphocytes. This experiment was repeated twice with essentially identical results.

Because TNF-α alone provided a strong stimulus for MIP-1, we wished to determine whether the expression of this chemokine was driven by TNF-α, itself induced early during STAg stimulation. As shown in Fig. 5⇓, when a neutralizing anti-TNF antiserum was included in the cultures, up-regulation of MIP-1 gene transcription in response to STAg was partially blocked (MIP-1α, 62% inhibition; MIP-1β, 78% inhibition, as estimated from densitometric analysis of scanned gel images). In contrast, normal control serum had no inhibitory effect on STAg-induced chemokine production. We conclude that the T. gondii-induced chemokine response is, in part, driven through TNF-α production. Nevertheless, we cannot exclude the possibility that the parasite directly stimulates neutrophil production of MIP-1α and MIP-1β.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Neutralizing anti-TNF-α antiserum partially blocks T. gondii-induced neutrophil chemokine up-regulation. Human PMN were isolated and stimulated with media (lane 1), STAg (lane 2), STAg in the presence of anti-TNF-α antiserum (lane 3), and STAg with control serum (lane 4). Three hours after culture initiation, cells were harvested and transcript levels were determined by RT-PCR-assisted amplification followed by agarose gel separation and visualization with ethidium bromide (A). Transcript levels were estimated using scanning densitometry and expressed relative to β-actin levels (B). The cells employed in this study were comprised of 90% neutrophils, 9% eosinophils, and 1% lymphocytes. This experiment was repeated twice with similar results.