Cutting Edge: Differential Responsiveness of the IL-5 and IL-4 Genes to Transcription Factor GATA-3

Dong-Hong Zhang, Liyan Yang and Anuradha Ray
J Immunol October 15, 1998, 161 (8) 3817-3821;

Abstract

The cytokines IL-4 and IL-5 are often coordinately produced by Th2 cells as in asthma. However, it is unclear whether similar molecular mechanisms underlie transcription of the two genes. We have previously shown that the transcription factor GATA-3 is expressed in Th2 but not Th1 cells and is crucial for activation of the IL-5 promoter by different stimuli. In a different study, GATA-3 was shown to be sufficient for the expression of IL-4 and other Th2 cytokine genes. Here, we show that ectopic expression of GATA-3 is sufficient to drive IL-5 but not IL-4 gene expression. Also, in Th2 cells, antisense GATA-3 RNA inhibits IL-5 but not IL-4 promoter activation. The induction of IL-5 gene expression by GATA-3 involves high affinity binding of GATA-3 to an inverted GATA repeat in the IL-5 promoter.

In both humans and mice, activated CD4+ T cells can be classified generally into two subsets, Th1 and Th2, based on their biologic functions, which, in turn, depend on the cytokines they produce (1, 2, 3, 4). These distinct populations of helper T cells are intimately associated with the pathophysiology of different diseases including infectious, autoimmune, and asthma/allergic diseases (1, 5, 6). Th1 cells secrete IL-2 and IFN-γ and are important for protective cell-mediated immune responses against intracellular microbes, but they can also cause tissue injury in autoimmune diseases (3, 6). Th2 cells, on the other hand, secrete IL-4 and IL-5 and protect against parasitic infections but promote asthma and other allergic diseases (7). While IL-4 stimulates IgE production, IL-5 promotes eosinophilic inflammation in the airways of asthmatics.

It appears that the differentiation of naive CD4+ T cells along the Th1 or Th2 pathway triggers different molecular events resulting in the differential expression of particular transcription factors in the two cell types. For example, we have previously shown that the transcription factor GATA-3 is expressed in Th2 but not Th1 cells and is critical for IL-5 gene expression (8). In a different study, GATA-3 was shown to be important and sufficient for the expression of other Th2 cytokine genes including IL-4, IL-6, and IL-10 (9). In these studies, ectopic expression of GATA-3 in the B cell line M12 was shown to be sufficient for activation of a minimal IL-4 promoter in the presence of phorbol ester and ionomycin (9). However, the GATA site(s) in the IL-4 promoter that conferred GATA-3-responsiveness was not characterized in this study (9). In the same study, the authors also showed that expression of antisense GATA-3 in Th2 cells affected IL-4 gene expression more than IL-5 gene expression (9). To sort out the apparently differential dependence on GATA-3 for IL-5 vs IL-4 gene expression, we attempted to define the GATA site(s) in the minimal IL-4 promoter that responded to GATA-3 in the studies reported by Zheng and Flavell (9). Our studies show that ectopic expression of GATA-3 alone can support IL-5 but not IL-4 gene induction in non-Th2 cells such as B cells.

Materials and Methods

Transfection assays

Rested D10 cells were transfected by electroporation as described previously (8). After electroporation, the cells were left on ice for 10 to 30 min, diluted to 5 ml with fresh medium, and incubated at 37°C with or without anti-CD3 (at 10 μg/ml in wells coated with the Ab), Ag + APC (8), dibutyryl cAMP (bt2cAMP3; 1 mM) + PMA (25 ng/ml) (for IL-5 promoter-reporter constructs), or ionomycin (1 μm) + PMA (100 ng/ml) (for the IL-4 promoter-reporter constructs). Cells were harvested for reporter gene assays as described previously (8). For M12 cell transfections, cells were grown in RPMI 1640, and at 10 h before transfection, the cells were transferred to fresh medium. Electroporation conditions were the same as for D10 cells. After electroporation, the cells were left in fresh medium for 2 h. The cells were left with or without the appropriate stimuli for ∼15 h and harvested for reporter gene assay. The Rous sarcoma virus (RSV)-β-galactosidase plasmid could not be used to monitor transfection efficiency in M12 cells, since phorbol ester stimulates multiple promoter/enhancers including RSV and CMV promoters in M12 cells. For assessing cytokine production, 5 × 106 cells were electroporated with a total of 15 μg of DNA containing 10 μg of expression vector containing GATA-3 cDNA in either the sense (S) or antisense (AS) orientation. Cells were left overnight at 37°C, and dead cells were removed by Ficoll density gradient centrifugation. An equal number of live cells from each group was split equally (8 × 105 cells per condition) and either left untreated or treated with PMA+ bt2cAMP or with PMA + ionomycin for 30 h. Supernatants were collected for ELISAs (Endogen, Cambridge, MA); the lower limit of detection for both cytokines was 5 pg/ml. Nuclear extracts prepared from cell pellets were used in EMSAs.

Electrophoretic mobility shift assays

EMSAs were conducted as described previously using a double-stranded oligonucleotide containing the wild-type double GATA site present in the IL-5 promoter (8, 11). The sequence of the sense strand was −73CCTCTATCTGATTGTTAGCA−54; complementary oligonucleotides were annealed before use in EMSAs. The TnT wheat germ lysate system (Promega, Madison, WI) was used to obtain in vitro-translated GATA-3 protein. The Ab to GATA-3 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-GATA-4 Ab was kindly provided by Dr. David Wilson (Washington University School of Medicine, St. Louis, MO).

Results

Antisense GATA-3 RNA expression inhibits IL-5 but not IL-4 promoter activation in Th2 cells

In our previous studies, we showed that a 1700-bp IL-5 promoter containing a mutation in a double GATA-3-binding site (located between −70 and −60 in the promoter) is completely unresponsive to either antigenic stimulation or stimulation with PMA + bt2cAMP in the prototypic murine Th2 clone, D10 (8). In a separate study, Zheng and Flavell showed that expression of antisense GATA-3 RNA in D10 cells only partially inhibits IL-5 gene expression but has a more pronounced effect on IL-4 gene expression (9). One possible explanation for the apparent discrepancy between our data and those of the other investigators is that GATA-3 binds with different affinities to target GATA sites in the IL-5 and IL-4 promoters. To test this hypothesis, we attempted to define the GATA site(s) in the IL-4 promoter that was responsible for GATA-3-dependent activation of the promoter in the studies reported by Zheng and Flavell (9).

For a head-to-head comparison between the effects of antisense GATA-3 RNA expression on IL-4 and IL-5 promoter activation, D10 cells were transiently transfected with an IL-5 promoter-reporter plasmid or an IL-4 promoter-reporter plasmid together with a mammalian expression vector containing the full length cDNA for GATA-3, cloned in the antisense (AS) orientation under the control of the RSV promoter/enhancer. As shown in Figure 1⇓, expression of antisense GATA-3 RNA inhibited anti-CD3-induced IL-5 promoter activity by ∼40% but had no effect on IL-4 promoter activity. The control expression vector transcribing the coding strand (S) of GATA-3 did not have this effect. The likely explanation for incomplete inhibition of IL-5 promoter activation by this approach is the high basal expression of GATA-3 mRNA (and protein) in D10 cells. Therefore, if the IL-5 GATA site has a high affinity for GATA-3, residual GATA-3 activity in the cells expressing antisense GATA-3 RNA may be sufficient to support partial, if not full, activation of the IL-5 promoter. In fact, in the studies reported by Zheng and Flavell, cells stably expressing antisense GATA-3 RNA had significant residual GATA-3 protein levels and could efficiently support IL-5 but not IL-4 gene expression (9).

FIGURE 1.
FIGURE 1.

Inhibition of IL-5 but not IL-4 promoter activation in D10 cells by antisense GATA-3 RNA. D10 cells were transfected with 15 μg of DNA (5 μg of reporter plasmid and 2 μg of CMV-β-galactosidase plasmid and carrier plasmid with or without 2.5 or 5 μg of murine GATA-3 sense or antisense expression plasmid). Cells were left unstimulated or stimulated with anti-CD3 Ab. Cells were harvested and assayed for luciferase and β-galactosidase activity. Shown is a representative experiment of three with <5% deviation between experiments.

Ectopic expression of GATA-3 in B cells supports IL-5 but not IL-4 gene expression

Since the antisense GATA-3 RNA expression studies failed to provide any evidence for a GATA 3-responsive DNA sequence in the ∼800-bp IL-4 promoter, we used a more direct approach to test the ability of GATA-3 to activate the IL-4 promoter. GATA-3 was ectopically expressed in the murine B cell lymphoma line M12, and the cells were cotransfected with either an IL-4 or an IL-5 promoter-reporter construct. When the IL-5 promoter was tested in this system, a small 2- to 4-fold activation was typically observed with PMA + bt2cAMP alone in the absence of GATA-3 expression (Fig. 2⇓A). In the presence of GATA-3 and PMA + bt2cAMP, an increase in IL-5 promoter activity was observed in a dose-dependent fashion with a net 30- to 40-fold activation with the highest dose of GATA-3 expression vector (Fig. 2⇓A). This finding was in keeping with our earlier studies in other non-IL-5-producing cell lines, such as HeLa and the Th1 clone A.E7, in which GATA-3 expression permitted activation of the IL-5 promoter (8). However, when the 800-bp IL-4 promoter was transfected with the GATA-3 expression vector and the cells were stimulated with PMA + ionomycin, no activation of the promoter was observed (Fig. 2⇓B). A shorter IL-4 promoter (−157 to +68) that was reported to be responsive to GATA-3 in these cells (9) was also unreponsive in our assays (Fig. 2⇓B). The shorter promoter had a much higher basal activity in the cells. Use of lower amounts of the reporter construct led to activation of the promoter by PMA + ionomycin alone (data not shown), which was not reflective of the response of the endogenous gene in the B cells. Even at 20 μg of the expression vector, we detected only a 2-fold increase in the basal activity of the 157-bp promoter and no further increase upon stimulation of the cells (data not shown).

FIGURE 2.
FIGURE 2.

Ectopic expression of GATA-3 is sufficient to activate the IL-5 but not the IL-4 promoter in M12 cells. M12 cells were transfected with the indicated plasmids (10 μg of total DNA). Cells were left unstimulated or stimulated with or without PMA + bt2cAMP (for the IL-5 promoter-luciferase construct) or with PMA + ionomycin (for the IL-4 promoter-reporter constructs). Cells were harvested and assayed for luciferase activity. Shown is a representative experiment of five with <3% deviation between experiments.

We also investigated the effect of GATA-3 expression on endogenous cytokine production in M12 cells. As illustrated in Figure⇑ 3A, M12 cells stimulated with PMA + bt2cAMP and expressing GATA-3 sense but not antisense RNA displayed an impressive induction of IL-5 production. In contrast, while there was a small increase in the basal level of IL-4 production by cells expressing the sense GATA-3 RNA, the net production of IL-4 by the M12 cells was very little whether the cells expressed GATA-3 sense or antisense RNA, even upon stimulation with PMA + ionomycin. The expression of GATA-3 in the M12 cells was comparable to expression in D10 cells as judged by EMSA (Fig. 3⇓B). Thus, it appears that GATA-3 expression in a non-Th2 environment is insufficient for IL-4 gene expression but is sufficient for IL-5 gene expression.

FIGURE 3.
FIGURE 3.

Ectopic expression of GATA-3 is sufficient to induce IL-5 but not IL-4 production in M12 cells. A, Cells were transfected as described in Materials and Methods, and supernatants were assayed for cytokine production by ELISA. Results shown are mean ± SEM. B, Nuclear extracts prepared from the transfected M12 cells were used in EMSA, and the same amount of protein (0.25 μg) was loaded in each lane. A double-stranded oligonucleotide containing the IL-5 GATA doublet (8, 11) was used as the probe.

Both of the individual GATA elements in the double GATA site in the IL-5 promoter are important for activation of the promoter by GATA-3

We previously described the presence of a double GATA site in the IL-5 promoter, located between −70 and −60, which bound GATA-3, and was critical for activation of the promoter by multiple stimuli (8, 11). In a more recent study, Lee et al. also demonstrated a crucial role for this GATA site in IL-5 promoter activation in Th2 cells (10). Here, we show that both of the GATA elements are important for IL-5 promoter activity in Th2 cells. Similar to a mutation affecting both the GATA elements (mut 3), mutation of either element (mut 1 or mut 2) in the context of the 1700-bp promoter abolished promoter activity (Fig. 4A). As we reported previously (8, 11), while a promoter containing a mutation in the activator protein 1 (AP-1)-like site within the CLE0 element located between −53 and −39 was totally inactive, one containing a mutation in an NF-AT element was fully active in these assays.

In our previous studies we showed that the double GATA site forms two complexes (I and II) with nuclear proteins isolated from either D10 cells or from in vitro-differentiated murine CD4+ T cells (8). To further characterize the two DNA-protein complexes, we allowed in vitro-translated GATA-3 to interact with the IL-5 GATA doublet and analyzed the binding reaction in EMSAs along with binding reactions set up with nuclear extracts prepared from anti-CD3-stimulated D10 cells. As shown in Figure 4⇓B, complex I comigrated with the complex formed with the in vitro-translated protein and most likely represents interactions with the GATA-3 homodimer. Complex II probably contains heterodimeric GATA-3. In accordance with the functional data presented in Figure 4⇓A, the formation of complexes I and II required both GATA elements. The identity of the proteins present in the complex formed with the mut. 2 probe is unknown and probably represents nonspecific binding. This complex did not contain GATA-3 since its formation could not be supershifted/inhibited by the anti-GATA-3 Ab. Taken together, the functional studies and the DNA-binding experiments suggest that both GATA elements within the doublet contribute to activation of the IL-5 promoter by GATA 3.

FIGURE 4.
FIGURE 4.

Both of the GATA elements between −70 and −65 and between −65 and −60 in the GATA doublet in the IL-5 promoter are important for activation by GATA-3. A, Rested D10 cells were first stimulated with the Ag conalbumin and mitomycin C-treated and T cell-depleted APCs in complete medium containing 5 U/ml of IL-2 for 72 h and then subjected to electroporation as described previously (8). After 18 to 20 h, cells were harvested and luciferase and β-galactosidase assays were performed. The luciferase activity (arbitrary units) for each of the reporter plasmids is shown with results representing the average of multiple experiments and normalized for β-galactosidase activity. The location and sequence of the different site-directed mutations in the IL-5 promoter are identified. Base pair changes are identified with lower case letters. Shown is a representative experiment of three with <15% deviation between experiments. B, Nuclear extracts were prepared from anti-CD3 Ab-stimulated cells (2 μg of protein was used in each lane). In vitro-translated GATA-3 was obtained using the TnT wheat germ lysate system (Promega). The probes in the EMSAs were three double-stranded oligonucleotides containing either wild-type or mutated sequences between −73 and −54 containing the double GATA site present in the IL-5 gene. The EMSAs were performed essentially as reported previously (8, 11). Note that arrows indicate the specific complexes I and II, whereas the other complexes are nonspecific in nature.

Discussion

The aim of the present study was to define the GATA-3-responsive sequences in the IL-4 promoter and compare the binding affinities of GATA-3 for the functional GATA-3-responsive site(s) in the IL-4 and IL-5 promoters. Although a minimal IL-4 promoter containing sequences between −157 and +68 was previously shown to be dramatically activated (∼50-fold) by GATA-3 expression alone in PMA + ionomycin-stimulated M12 cells (9), our studies failed to detect any activation of either an ∼800 bp IL-4 promoter fragment or the shorter −157/+68 fragment in M12 cells in the presence of GATA-3 and a combination of PMA and ionomycin. However, in keeping with our earlier observations with two other non-IL-5-producing cell types HeLa and A.E7 (Th1) cells (8), ectopically expressed GATA-3 in M12 cells efficiently supported IL-5 promoter activation in a dose-dependent fashion.

IL-5 promoter activation needs at least two DNA elements–the double GATA site and an AP-1-like site within a CLE0 element as previously described by us (8, 11). Since GATA-3 expression alone is sufficient to activate the IL-5 promoter in different cell types when the cells are also stimulated with PMA + bt2cAMP, stimulation of the cells most likely triggers the binding of similar proteins to the AP-1-like site in all cell types. Using nuclear proteins derived from either in vitro-differentiated murine Th1 and Th2 cells or from T cell clones, we have shown that the DNA-protein complex formed with the AP-1-like site with either cell extract contains JunB and JunD (8, 11). Therefore, neither JunB nor JunD appears to be expressed in a Th2-specific fashion. In fact, both JunB and JunD have been implicated in IL-2 gene transcription in Th1 cells (12).

The individual GATA elements in the double GATA site in the IL-5 promoter are present in an inverse orientation with respect to each other and are located between −70 and −65 and between −65 and −60. The first sequence conforms with the WGATAR consensus sequence. The second site has an intact GAT core but has a T instead of A in the +1 position. However, it appears that this substitution can still be selected by GATA-3, particularly within overlapping GATA sites (13). Overlapping GATA sites have also been previously identified in many erythroid-expressed genes such as the chicken α-globin promoter (14). Overlapping and/or multiple GATA sites appear to confer increased GATA binding activity and may play a key role in differential responsiveness to GATA-3 for different genes (14, 15, 16). It is important to note, in this context, that the region between −157 and +68 in the IL-4 promoter does not have any double GATA sites and that the single GATA sites located in this region are not sensitive to GATA-3 activation. Also, although there is a double GATA site located between −264 and −274 in the IL-4 promoter (17), this site is unresponsive to transactivation by GATA-3. These two GATA sites (−274TGATAAGATTA−264) are present as direct repeats, unlike the inverted repeats found in the IL-5 promoter (Fig. 3⇑). In the studies of Ko and Engel, in which binding of GATA-3 to random oligonucleotides was assessed, GATA-3 was found to select oligonucleotides containing inverted GATA repeats much more frequently than those containing GATA sites as direct repeats (13). Thus, our studies lend functional credence to the studies of Ko and Engel (13) and suggest that sensitivity to GATA-3 is dictated by inverted double GATA sites.

While a direct involvement of GATA-3 in IL-5 promoter activation has been demonstrated in our studies (8) as well as in those of Lee et al. (10), a similar direct role for GATA-3 in IL-4 promoter activation is not evident in our studies. Therefore, the logical question that arises is how GATA-3 activates IL-4 gene expression in Th2 cells. Based on the recent reports from various laboratories, it seems likely that IL-4 gene expression needs multiple factors such as c-Maf (18), NF-ATc (19, 20), or NF-IL6 (21, 22), which probably act in concert with GATA-3 to induce gene expression. Interestingly, it was recently shown that although NF-ATc−/−/RAG-1−/− mice contained a full complement of GATA-3 activity, the mice were deficient in IL-4 gene expression, indicating that the presence of GATA-3 is not sufficient to support IL-4 gene expression (20). It appears that the GATA site that confers responsiveness to GATA-3 in the IL-4 gene is located elsewhere in the IL-4 gene and has yet to be identified. Indeed, studies of Wenner et al. indicate that the 800-bp IL-4 promoter lacks sufficient information for maximal expression of the IL-4 gene (23). Thus, collectively it appears that although the IL-4 and IL-5 genes are most often coordinately expressed in Th2-type cells, GATA-3 is sufficient for optimal expression of the IL-5 but not the IL-4 gene.

Acknowledgments

We thank J. D. Engel for the GATA-3 expression vectors, D. Wilson for the anti-GATA-4 Ab, K. M. Murphy for the −741/+60 IL-4 promoter construct, R. Flavell for the −157/+68 IL-4 promoter construct, and P. Ray for helpful discussions.

Footnotes

  • ↵1 This work was supported by National Institutes of Health Grants RO1 AI31137 and RO1 HL 56843 and Specialized Center of Research Grant P50 HL56389 (to A.R.).

  • ↵2 Address correspondence and reprint requests to Dr. Anuradha Ray, Department of Internal Medicine, Pulmonary and Critical Care Section, Yale University School of Medicine, 333 Cedar Street, LCI 105, New Haven, CT 06520. E-mail address: Anuradha.Ray{at}yale.edu

  • ↵3 Abbreviations used in this paper: bt2cAMP, dibutyryl cAMP; RSV, Rous sarcoma virus; EMSA, electrophoretic mobility shift assay; AP-1, activator protein 1.

  • Received June 10, 1998.
  • Accepted August 12, 1998.

References

  1. ↵
    Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787
    OpenUrlCrossRefPubMed
  2. ↵
    Constant, S. L., K. Bottomly. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15: 297
    OpenUrlCrossRefPubMed
  3. ↵
    Lichtman, A. H., A. K. Abbas. 1997. T-cell subsets: recruiting the right kind of help. Curr. Biol. 7: R242
    OpenUrlCrossRefPubMed
  4. ↵
    Romagnani, S.. 1997. The Th1/Th2 paradigm. Immunol. Today 18: 263
    OpenUrlCrossRefPubMed
  5. ↵
    Umetsu, D. T., R. H. DeKruyff. 1997. TH1 and TH2 CD4+ cells in human allergic diseases. J. Allergy Clin. Immunol. 100: 1
    OpenUrlCrossRefPubMed
  6. ↵
    Romagnani, S., P. Parronchi, M. M. D’Elios, P. Romagnani, F. Annunziato, M. P. Piccinni, R. Manetti, S. Sampognaro, C. Mavilia, M. De Carli, E. Maggi, G. F. Del Prete. 1997. An update on human Th1 and Th2 cells. Int. Arch. Allergy Immunol. 113: 153
    OpenUrlCrossRefPubMed
  7. ↵
    Umetsu, D. T., R. H. DeKruyff. 1997. Th1 and Th2 CD4+ cells in the pathogenesis of allergic diseases. Proc. Soc. Exp. Biol. Med. 215: 11
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Zhang, D.-H., L. Cohn, P. Ray, K. Bottomly, A. Ray. 1997. Transcription factor GATA-3 is differentially expressed in Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene. J. Biol. Chem. 272: 21597
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Zheng, W.-P., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89: 587
    OpenUrlCrossRefPubMed
  10. ↵
    Lee, H. J., A. O’Garra, K.-I. Arai, N. Arai. 1998. Characterization of cis-regulatory elements and nuclear factors conferring Th2-specific expression of the IL-5 gene: a role for a GATA-binding protein. J. Immunol. 160: 2343
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Siegel, M. D., D.-H. Zhang, P. Ray, A. Ray. 1995. Activation of the interleukin-5 promoter by cAMP in murine EL-4 cells requires the GATA-3 and CLE0 elements. J. Biol. Chem. 270: 24548
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Mondino, A., C. D. Whaley, D. R. DeSilva, W. Li, M. K. Jenkins, D. L. Mueller. 1996. Defective transcription of the IL-2 gene is associated with impaired expression of c-Fos, FosB, and JunB in anergic T helper 1 cells. J. Immunol. 157: 2048
    OpenUrlAbstract
  13. ↵
    Ko, L. J., J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13: 4011
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Evans, T., G. Felsenfeld. 1991. Trans-activation of a globin promoter in nonerythroid cells. Mol. Cell. Biol. 11: 843
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Martin, D. I. K., S. H. Orkin. 1990. Transcriptional activation and DNA-binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev. 4: 1886
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Tsai, S. F., E. Strauss, S. H. Orkin. 1991. Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev. 5: 919
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Otsuka, T., D. Villaret, T. Yokota, Y. Takebe, F. Lee, N. Arai, K.-I. Arai. 1987. Structural analysis of the mouse chromosomal gene encoding interleukin 4 which expresses B cell, T cell and mast cell stimulating activities. Nucleic Acids Res. 15: 333
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Ho, I.-C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85: 973
    OpenUrlCrossRefPubMed
  19. ↵
    Ranger, A. M., M. R. Hodge, E. M. Gravallese, M. Oukka, L. Davidson, F. W. Alt, F. C. de la Brousse, T. Hoey, M. Grusby, L. H. Glimcher. 1998. Delayed lymphoid repopulation with defects in IL-4-driven responses produced by inactivation of NF-ATc. Immunity 8: 125
    OpenUrlCrossRefPubMed
  20. ↵
    Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, P. S. Ohashi, J. M. Penninger, G. R. Crabtree, T. W. Mak. 1998. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8: 115
    OpenUrlCrossRefPubMed
  21. ↵
    Li-Weber, M., P. Salgame, C. Hu, I. V. Davydov, P. H. Krammer. 1997. Differential interaction of nuclear factors with the PRE-I enhancer element of the human IL-4 promoter in different T cell subsets. J. Immunol. 158: 1194
    OpenUrlAbstract
  22. ↵
    Davydov, I. V., P. H. Krammer, M. Li-Weber. 1995. Nuclear factor-IL6 activates the human IL-4 promoter in T cells. J. Immunol. 155: 5273
    OpenUrlAbstract
  23. ↵
    Wenner, C. A., S. J. Szabo, K. M. Murphy. 1997. Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J. Immunol. 158: 765
    OpenUrlAbstract
Back to top

In this issue

The Journal of Immunology
Vol. 161, Issue 8
15 Oct 1998
Print
Download PDF
Article Alerts
Email Article
Citation Tools

Jump to section