Differential Regulation of Chemoattractant-Stimulated β₂, β₃, and β₇ Integrin Activity

Antibodies

The FLAG epitope-specific mAb M1 was from Eastman Kodak (Rochester, NY). Cells producing the α_L mAb, TS1/22, were from American Type Culture Collection (ATCC), Rockville, MD, and the β₁ mAb, 3S3, was a gift from Dr. John Wilkins, University of Manitoba (Winnipeg, Canada). The β₂ mAb, 22F12C, and the α₄ mAb, 72A1H, were generated at ICOS. Fib 504.64, a rat anti-mouse β₇ mAb (12) that also binds to human β₇, was obtained from ATCC. All of the Abs were purified according to standard procedures.

Generation of human lymphoid cell lines expressing IL-8 or FMLP receptor

The human IL-8RA (IL-8 receptor subtype A) (13) sequence was amplified from genomic DNA. The FMLP receptor (FPR) cDNA was a gift from Dr. Richard Ye (The Scripps Research Institute, La Jolla, CA). HindIII and XbaI restriction endonuclease sites were added by PCR to the 5′ and 3′ ends of the IL-8RA and the FPR cDNA clones. For IL-8RA, the following oligonucleotide primers were used: 5′ (HindIII), 5′ATGCAAGCTTTCAAAT ATTACAGATCCA 3′; and 3′ (XbaI), 5′ATGCTCTAGATTTTCAGAGGTTGGAAGAG AC 3′. Sequences of the oligonucleotide primers used for the FPR cDNA are: 5′ (HindIII), 5′ATGCAAGCTTGAGACAAATTCCTCTCTC 3′; and 3′ (XbaI), 5′ATGCTCTAG ATCACTTTGCCTGTAACGCCAC 3′. The PCR-amplified products were verified by DNA sequencing. The mammalian expression vector, pcDNA3 (Invitrogen, San Diego, CA) was modified by inserting the bovine prolactin signal sequence and the FLAG epitope (Eastman Kodak) 3 prime to the CMV promoter. The HindIII-XbaI site-adapted cDNAs were then ligated to the corresponding sites of the pcDNA3-FLAG expression vector. In the resulting construct, the IL-8RA and FPR cDNAs were in-frame to the prolactin signal sequence and the FLAG epitope.

The FLAG-tagged receptors were expressed in the human B lymphoblastoid cell line, JY, obtained from ATCC. For each electorporation, 1 × 10⁷ cells were centrifuged, washed in ice-cold PBS, and resuspended in 0.5 ml of PBS. Thirty micrograms of the expression construct DNA was added to the cell suspension and incubated on ice for 10 min. Electroporation was done at 250 V, 960 μFd capacitance, using a Bio-Rad (Hercules, CA) electroporator. After incubating the electroporated cells on ice for 10 min, they were transferred to the growth medium for 24 h. The transfected cells were then selected using G418 at 1 mg/ml in medium. Expression of the receptors on the surface of the transfected cells was monitored using the anti-FLAG Ab, M1 (Eastman Kodak). About 10% of the G418-resistant cells expressed the FLAG epitope. The cell population was stained with the M1 Ab and sorted for high levels of receptor-expressing cells. After two rounds of sorting, 95% of the cells expressed the FLAG epitope. Functional expression of the receptors was confirmed by cell adhesion and chemotactic assays in the presence of IL-8 and FMLP (see below). These cells were designated JY-8 and JY-fp.

Adhesion assay

Adhesion assays were performed in 96-well Easy Wash plates (Corning Glass, Corning, NY) using a modified procedure (14). Each well was coated with 50 μl of ICAM-1/Fc (10 μg/ml), VCAM-1/Fc (5 μg/ml), or vitronectin (0.5 μg/ml) in 50 mM bicarbonate buffer (pH 9.6). Some wells were coated with a β₂ mAb (22F12C, ICOS), to quantitate the maximum number of input cells binding, (taken as 100%) or glycophorin, to determine background binding. Plates were blocked with 1% BSA in PBS for 1 h at room temperature. Wells were then rinsed and 200 μl of adhesion buffer (RPMI + 0.2% human serum albumin) was added with or without PMA (20 ng/ml), IL-8, or FMLP. Cells (100 μl of 1 × 10⁶/ml) were then added to each well, and plates were incubated at 37°C in 5% CO₂ for the indicated time. Cells were allowed to settle on the plate for 25 min, and then PMA (20 ng/ml) or IL-8 or FMLP was added. In some assays, cells were mixed with cytochalasin D and added to the wells such that the final concentration of cytochalasin D was 10 μg/ml. For chelerythrin treatment, cells were preincubated with the inhibitor at 37°C for 10 min and then added to wells. Adherent cells were fixed with the addition of 50 μl of a 10% glutaraldehyde solution and stained with 0.5% crystal violet (Sigma, St. Louis, MO) solution. The plates were washed in several changes of water. After washing, 70% ethanol was added, and adherent cells were quantitated by determining absorbance at 570 nm using a SPECTRAmax 250 microplate spectrophotometer system (Molecular Devices, Sunnyvale, CA). Percentage of cell binding was determined using the formula:

Establishment of IL-8 and FMLP receptor-expressing cell lines

For a detailed analysis of integrin activation by chemoattractants, we have established cell lines stably expressing either of two chemoattractant receptors. The formyl peptide receptor, FPR, is representative of the classical chemoattractant receptor, and the other, IL-8RA (CCR1), is a member of the α chemokine (CXC) receptor family. Based on their pertussis toxin sensitivity, it is believed that both of these receptors transduce a signal through the Gi class of G proteins (15, 16). These receptors were tagged with the FLAG epitope at their N termini and were expressed in the human B lymphoid cell line JY. JY cells express the integrins α_Lβ₂, α_vβ₃, and α₄β₇ (Fig. 1⇓), all of which may be stimulated by PMA (data not shown). The untransfected cells did not respond to the chemoattractants, as there was no increased α_Lβ₂-, α_Vβ₃-, or α₄β₇-dependent binding observed in the presence of either FMLP or IL-8 (data not presented). After transfection and G418 selection, cells were sorted using a mAb that binds to the FLAG epitope. Following two rounds of sorting, cell lines expressing high levels of FPR (JY-fp) and IL-8RA (JY-8) were established (Fig. 1⇓). Cell surface expression of both the IL-8 and FMLP receptors remained stable for months without subsequent G418 selection.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 1.

Expression of chemoattractant receptors and integrins on JY transfectants. JY cells were transfected with either IL-8RA (JY-8) or FPR (JY-fp) expression constructs, selected with G418, and sorted using the anti-FLAG mAb, M1. Cell surface expression (shaded areas) of the indicated molecule was determined by staining with the following mAb: IL-8RA (M1); α_L (TS1/22); β₂ (22F12C); FPR (M1); α_Vβ₃ (mAb 1976; α_Vβ₅ (mAb 1961); α₄ (72A1H); β₁ (3S3); β₇ (Fib 504.64). Unshaded curves show staining with isotype-matched irrelevant mAb. Expression of integrins in JY-8 cells are shown. The pattern of integrin expression in JY-fp cells (not shown) was identical to that of the JY-8 cells. The level of FPR expression by the JY-fp cells is shown in the bottom right panel.

IL-8- or FMLP-induced activation of integrins on JY transfectants

We tested JY-8 and JY-fp for their ability to activate integrins upon treatment with IL-8 or FMLP. Of the four known β₂ (CD18) integrins, JY cells express only α_Lβ₂, which binds to ICAM-1. As shown in Figure 2⇓, IL-8 stimulated JY-8 adhesion to ICAM-1 in a concentration-dependent manner. The maximum response was observed at about 60 ng/ml of IL-8 (Fig. 2⇓A). This concentration of IL-8 also resulted in maximal stimulation of α₄β₇- and α_Vβ₃-dependent adhesion (data now shown). At this concentration, there was a two- to threefold increase in α_Lβ₂-mediated adhesion to ICAM-1. This response was similar in magnitude to PMA-stimulated JY-8 adhesion to ICAM-1 (Fig. 2⇓A). Adhesion of JY-8 to ICAM-1 was completely and specifically blocked by the α_L (CD11a) mAb and the β₂ (CD18) mAb (data not shown). JY cells transfected with the expression vector (JY-vector) did not demonstrate IL-8-stimulated binding (Fig. 2⇓A).

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 2.

Dose-response of agonist-induced cell adhesion to ICAM-1. A, IL-8 concentration dependence of JY-8 (open bars) and JY-vector (solid bars) adhesion; B, FMLP concentration dependence of JY-fp (open bars) and JY-vector (solid bars) adhesion. Error bars show the range of triplicate samples. One representative example of several experiments is shown. Percentage of cell binding was determined by crystal violet staining, quantification of A₅₇₀, and normalized according to the formula presented in Materials and Methods.

JY-fp binding to ICAM-1 was specifically stimulated by FMLP, with maximum binding observed at ∼600 nM (Fig. 2⇑B). At this concentration of FMLP, there was an approximately threefold increase in binding of JY-fp to ICAM-1. FMLP did not stimulate adhesion of JY-vector cells (Fig. 2⇑B). Thus, JY-fp and JY-8 express functional chemoattractant receptors.

Activation profiles of α_Lβ₂, α_vβ₃, and α₄β₇ by IL-8 and FMLP

We determined and compared the magnitude and rate of chemoattractant-mediated activation of three integrins expressed in JY-8 and JY-fp. JY cells express the integrins α₄β₇ and α_Vβ₃ (Fig. 1⇑), which bind to VCAM-1 and vitronectin, respectively (17, 18). JY cells may express a very low level of β₁ integrin (Fig. 1⇑, second row, middle panel), however, binding to VCAM-1 was blocked by β₇-blocking mAb, and not by β₁-blocking mAb (data not shown). Thus, we compared binding of the JY-8 and JY-fp cells to ICAM-1, VCAM-1, and vitronectin as an indication of the activation profile of α_Lβ₂, α₄β₇, and α_Vβ_3.

In the absence of stimulation, there was a slight increase in JY-8 and JY-fp binding to ICAM-1 within the first 5 min. Thereafter, this level of binding did not change significantly for up to 30 min (Fig. 3⇓, A and D). In the presence of the appropriate agonists, however, both the JY-8 and the JY-fp cells showed two- to threefold enhanced binding to ICAM-1 within 5 min. Thus, there is a rapid activation of α_Lβ₂ induced by the binding of either agonist to their corresponding receptors. The initial two- to threefold increase in binding was sustained for at least 30 min.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 3.

IL-8 or FMLP induced prolonged activation of α_Lβ₂ and α_Vβ₃ and transient activation of α₄β₇. Shown are the time courses of agonist induced cell adhesion to ICAM-1 (10 μg/ml), VCAM-1 (5 μg/ml), and vitronectin (0.5 μg/ml). A, B, C, IL-8; D, E, F, FMLP. Gray bar indicates with agonist; open bar, without agonist. Final concentration of IL-8 was 100 ng/ml and that of FMLP was 500 nM. After cells settled, agonists were added and the plate was incubated at 37°C. Incubation was stopped by the addition of glutaraldehyde (final concentration of 1.5%) at the indicated times. Percentage of cell adhesion was determined as described in Figure 2⇑ legend. Shown is one representative of three experiments.

The activation profile of α_Vβ₃ was similar to that of α_Lβ₂ (Fig. 3⇑, C and F). There was a rapid increase in JY-8 and JY-fp cell binding to vitronectin within 5 min of adding either IL-8 or FMLP, as compared with the binding in the absence of either agonist. The maximum level of induced binding in the presence of the agonists was two- to threefold. Since the activation of α_vβ₃ was sustained, the ratio of induced binding to uninduced binding did not change significantly for as long as 30 min.

The activation profile of α₄β₇ in JY-8 and JY-fp differed from that of α_Lβ₂ and α_Vβ₃. As shown in Figure 3⇑B, there was increased binding of the JY-8 cells to VCAM-1 within the first 5 min after adding IL-8, indicating a rapid activation of α₄β₇. Both the response time and fold increase was similar to that of α_Lβ₂ and α_Vβ₃. However, the induced α₄β₇-mediated binding in response to IL-8 was not sustained. After the initial 5 min, a steady decrease in binding was observed. By 30 min, the extent of cell adhesion to VCAM-1 in the presence of IL-8 was essentially the same as in the absence of IL-8. This resulted in a decreased ratio of binding to VCAM-1 in the presence of IL-8 vs in the absence of IL-8. The observed decrease in the ratio between 5 and 30 min is in contrast to the profile of binding to ICAM-1 and vitronectin, indicating a differential temporal regulation of α₄β₇.

Chemoattractant-stimulated binding of JY-fp cells to VCAM-1 was similar to that of JY-8. As shown in Figure 3⇑E, FMLP caused a rapid increase in the JY-fp cell binding to VCAM-1 within 5 min. With longer periods of incubation, the agonist-stimulated binding was not sustained. Since both JY-8 and JY-fp demonstrated a transient induction of binding to VCAM-1 relative to ICAM-1 and vitronectin, this suggests a unique and integrin-proximal modulation of the α₄β₇ activity.

Differential effect of cytochalasin D on activation of α_Lβ₂-, α₄β₇-, and α_Vβ₃-mediated activation of cell adhesion

Cytochalasin D, which prevents actin polymerization (19), blocks PMA-induced α_Lβ₂-mediated aggregation of JY cells, suggesting a role for F actin in the regulation of α_Lβ₂ activity (20). We tested whether IL-8- or PMA-induced activation of integrins on JY-8 requires an intact cytoskeleton. Because FMLP- and IL-8-stimulated responses were identical, with perhaps both receptors interacting with the same Gαi, only IL-8 was used in these and subsequent assays. Cytochalasin D treatment significantly reduced both IL-8- and PMA-induced cell binding to ICAM-1 (Fig. 4⇓A). A similar pattern of cytochalasin D inhibition was observed for α_Vβ₃-dependent adhesion to vitronectin (Fig. 4⇓C). In contrast to that of α_Lβ₂ and α_Vβ₃, α₄β₇-mediated JY-8 binding was markedly enchanced in the presence of the same concentration of cytochalasin D (Fig. 4⇓B). A greater than threefold enhancement of α₄β₇-mediated JY-8 cell binding to VCAM-1 was observed in the presence of cytochalasin D alone. IL-8 or PMA further increased JY-8 cell adhesion to VCAM-1 in the presence of cytochalasin D. Thus, α₄β₇ differs from α_Lβ₂ and α_Vβ₃ in its requirement of F actin.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 4.

Differential cytoskeleton dependency for integrin-dependent cell adhesion. JY-8 cells were treated with cytochalasin D (solid bars) or DMSO (open bars) and allowed to bind to ICAM-1 (A)-, VCAM-1 (B)-, or vitronectin (VN) (C)-coated surfaces. Cells were incubated for an additional 5 min in the presence of no agonist, IL-8, or PMA. Percentage of cell adhesion was determined as described in the Figure 2⇑ legend. Shown is one representative of three experiments.

Role of PKC in IL-8-stimulated integrin activation

Members of the PKC family of enzymes can stimulate integrin-dependent adhesion, since the PKC agonist, PMA, stimulates integrin activity. Calphostin C, a potent inhibitor of diacylglycerol and Ca²⁺-dependent PKC isoforms (21), can block PMA-induced α₄β₁ and α_Mβ₂ integrin activation (16). However, calphostin C did not inhibit IL-8- or FMLP-stimulated α₄β₁- and α_Mβ₂-dependent adhesion (16).

We used chelerythrin (22), a catalytic domain antagonist of different PKC isoforms, to determine whether different PKC family members are involved in IL-8-mediated integrin activation in JY-8. Although chelerythrin may have broad specificity, its IC₅₀ for different PKC isoforms can vary. Initially, we determined the effect of a range of concentrations of chelerythrin on α_Lβ₂-dependent JY-8 adhesion to ICAM-1 (Fig. 5⇓). At concentrations <6 μM, chelerythrin did not inhibit IL-8- or PMA-stimulated binding. At 6 μM, there was no inhibition of PMA-stimulated binding, although IL-8-stimulated binding was blocked 50%, while at 12.5 μM or higher concentrations, chelerythrin substantially blocked both IL-8- and PMA-stimulated cell adhesion. These results suggest a role for PKC in IL-8- mediated stimulation of α_Lβ₂.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 5.

Inhibition of α_Lβ₂-mediated cell adhesion by the PKC inhibitor chelerythrin. JY-8 cells were pretreated with chelerythrin for 10 min at 37°C and allowed to settle in wells coated with ICAM-1. Percentage of cell binding at the end of 5 min (with no inducer □, IL-8 □, or PMA ▪) was measured as described in the legends to Figures 2⇑ and 4⇑. Final concentration of chelerythrin in each well is indicated. Duration and concentration of chelerythrin during the experiment did not affect cell viability as measured by trypan blue staining. One representative of three experiments is shown.

We further compared the effect of chelerythrin on α_Lβ₂, α₄β₇, and α_Vβ₃ activity. Because at 12.5 μM chelerythrin blocked both chemoattractant- and PMA-stimulated adhesion of JY-8 to ICAM-1 (Fig. 5⇑), it was used in additional experiments. Chelerythrin was not used at higher concentrations at which additional PKC isoforms or kinases might be inhibited. As seen in Figure 6⇓, A and C, at this concentration chelerythrin markedly inhibited both IL-8- and PMA-stimulated α_Lβ₂ and α_vβ₃ activity. In contrast, chelerythrin did not inhibit IL-8-stimulated JY-8 adhesion and only marginally inhibited PMA-stimulated adhesion (Fig. 6⇓B) to VCAM-1 (Fig. 6⇓B). Furthermore, chelerythrin treatment increased basal level binding to VCAM-1 by approximately twofold and IL-8-induced binding by about 20%. These results indicate that α₄β₇ differs from α_Lβ₂ and α_Vβ₃ in PKC dependency.

• Download figure
• Open in new tab
• Download powerpoint

FIGURE 6.

Differential effect of chelerythrin on integrin activation. JY-8 cells were pretreated with chelerythrin as described in Figure 5⇑ legend and allowed to bind to ICAM-1 (A), VCAM-1 (B), or vitronectin (C) in the presence of no agonist, IL-8, or PMA as described in Figure 3⇑. Activation by the agonists was terminated at the end of 5 min, and bound cells were quantitated. Shown is one representative of three experiments.