Table I.

PCR primers used in the preparation of CD20 derivativesa

DesignationPrimerSequence of Primer
C220A5′AAAAGAACGGCCTCCAGACCC
3′GGGTCTGGAGGCCGTTCTTTT
CΔ219-2255′TGGAAAAGAAACATAGTTCTCCTGTCA
3′AACTATGTTTCTTTTCCATTCATTCTC
CΔ226-2525′CCCAAATCTTCTTCCCAACCAAAGAAT
3′TTGGGAAGAAGATTTGGGTCTGGAGCA
  • a All sequences are written in the 5′ to 3′ direction.