Article Figures & Data
Figures
- FIGURE 1.
Kinetics of TIMP expression in infected C57BL/6 mice. Time course of liver mRNA expression for TIMP-1 (A), TIMP-2 (B), and TIMP-3 (C) in S. mansoni-infected C57BL/6 mice. Expression values for each mouse have been normalized to the corresponding HPRT value. UI, uninfected mice. ∗, p < 0.05 vs the uninfected group. Each data point represents one mouse, while bars represent the median value for each group. The line in A denotes a representative pattern of liver fibrosis during the same time frame (graphed as the fold change in hydroxyproline levels per worm pair).
- FIGURE 2.
Expression of TIMP in TIMP-1-deficient and TIMP-2-deficient mice. Liver mRNA expression for TIMP-1 and TIMP-2 (A) or MMP (B) in mice infected with S. mansoni for 9 wk in C57BL/6 (□), TIMP-1 knockout (▵), and TIMP-2 knockout (▿) mice. Filled shapes represent infected mice; open shapes represent uninfected mice (UI). Expression values for each mouse have been normalized to the corresponding HPRT value. Mann-Whitney test p values vs C57BL/6 are shown. Each data point represents one mouse, while bars represent the median value for each group.
- FIGURE 3.
Liver histology of TIMP-1- and TIMP-2-deficient mice. Data are from several experiments at 9 and 14 wk after infection of C57BL/6 (□), TIMP-1 knockout (▵), and TIMP-2 knockout (▿) mice with 25 S. mansoni cercariae per mouse. The degree of liver fibrosis in TIMP-1 and -2-deficient mice is assessed by the amount of hydroxyproline in micromoles detected in liver per 10,000 eggs at 9 (A) and 14 wk (B) postinfection. Granuloma volume for TIMP-1 and -2-deficient mice was assessed by microscopy at 9 (C) and 14 wk (D). The average size of 30 granulomas is shown for each mouse. Mann-Whitney test p values vs C57BL/6 are shown. Each data point represents one mouse, while bars represent the median of each group.
- FIGURE 4.
Kinetics of MMP expression in infected C57BL/6 mice. Time course of liver mRNA expression for MMP-2 (A), MMP-3 (B), MMP-13 (C), MMP-9 (D), and MMP-12 (E) in S. mansoni-infected C57BL/6 mice. Expression values for each mouse have been normalized to the corresponding HPRT value. UI, uninfected mice. ∗, p < 0.05 vs uninfected C57BL/6 mice. Each data point represents one mouse, while bars represent the median value for each group.
- FIGURE 5.
Cytokine data from MLN cells of various cytokine-deficient mice showing the cytokine response of cultured primary MLN cells prepared from mice 8 wk after infection. Cells were cultured in medium alone or with SEA (20 μg/ml), SWAP (40 μg/ml), or Con A (1 μg/ml) for 72 h. The Th2-type cytokines, IL-4 (A), IL-5 (B), IL-13 (C), and IL-10 (E), and the Th1-type cytokine, IFN-γ (D), are shown. Error bars show variation between two separate experiments using 7–10 mice/group.
- FIGURE 6.
Liver histology of infected cytokine-deficient mice. Combined histologic data from two separate experiments at 8 wk after infection with 25 S. mansoni cercariae per mouse are shown. Each data point represents one mouse, while bars represent the median of each group. Mann-Whitney test p values vs C57BL/6 are shown. A, The degree of fibrosis is assessed by the amount of hydroxyproline in micromoles detected in liver per 10,000 eggs. B, Granuloma volume as assessed by microscopy. The average size of 30 granulomas is shown for each mouse.
- FIGURE 7.
Liver mRNA expression for TIMP-1 (A) and TIMP-2 (B) in mice infected with S. mansoni for 8 wk. ▵, C57BL/6 mice; ----, IFN-γ-deficient mice; ⋄, IL-10 knockout mice; ○, IL-10/IFN-γ-deficient mice. Filled shapes represent infected mice; open shapes represent uninfected mice (UI). Expression values for each mouse have been normalized to the corresponding HPRT value. ∗, p < 0.05 vs C57BL/6. Each data point represents one mouse, while bars represent the median value for each group.
- FIGURE 8.
Liver mRNA expression for MMP-2 (A), MMP-3 (B), MMP-13 (C), MMP-12 (D), and MMP-9 (E) in mice infected with S. mansoni for 8 wk. ▵, C57BL/6 mice; ▿, IFN-γ-deficient mice; ⋄, IL-10 knockout mice; ○, IL-10/IFN-γ-deficient mice. Filled shapes represent infected mice, open shapes represent uninfected mice (UI). Expression values for each mouse have been normalized to the corresponding HPRT value. ∗, p < 0.05 vs C57BL/6. Each data point represents one mouse, while bars represent the median value for each group.
Tables
Gene Upper Primer Lower Primer Protocola HRPT gttggatacaggccagactttgttg gattcaacttgcgctcatcttaggc 3.5 mM, 54°C, 10 s MMP-2 gccccgagaccgctatgtccact gccccacttccggtcatcatcgta 2.5 mM, 60°C, 8 s MMP-3 ggatgtcactggtaccaacctattc actgcatcaaagaacaaagtagagc 3.5 mM, 53°C, 12 s MMP-9 gcgccaccacagccaactatg tggatgccgtctatgtcgtcttta 3.0 mM, 57°C, 16 s MMP-12 ctgggcaactggacaactcaactc aatgctgcagccccaaggaat 3.5 mM, 56°C, 20 s MMP-13 ctggcacacgcttttcctcctg gggctgggtcacacttctctggt 2.0 mM, 57°C, 13 s TIMP-1 actcggacctggtcataagggc ttccgtggcaggcaagcaaagt 2.5 mM, 54°C, 20 s TIMP-2 ggcaaccccatcaagagga ccttctgcctttcctgcaattag 2.5 mM, 54°C, 10 s TIMP-3 gcaattgcaagatcaagtcctgc tgtggcgttgctgatgctctt 3.0 mM, 54°C, 10 s -
a Values are the final concentration of MgCl in the reactions, the annealing temperature, and the extension time in seconds. All other parameters are the same for the different primer sets, and are as follows: 95°C denaturation for 3 s, (anneal temperature) for 5 s, 72°C for (extension time). There was an initial 30-s denaturation at 95°C for all primer sets.
-
Mice MMP:TIMP Ratios MMP-2:TIMP-1 MMP-3:TIMP-1 MMP-9:TIMP-1 MMP-12:TIMP-1 MMP-13:TIMP-1 IFN-γ KO 0.8 0.6 0.6 0.5 0.6 IL-10 KO 0.7 2.9 2.1 0.4 0.6 IL-10/IFN-γ KO 3.3 0.7 16.0 0.7 0.4 -
a To obtain the ratios, the MMP median value for the knockout (KO) group was divided by the corresponding wild-type (WT) value, which was then divided by a TIMP-1 value treated in the same manner: (MMP median value (KO)/MMP median value (WT))/(TIMP-1 median value (KO)/TIMP median value (WT)).
-
In this issue
