The Journal of Immunology, 2008,
181,
6051
-6060
Copyright © 2008 by The American Association of Immunologists, Inc.
IL-24 Induces Apoptosis of Chronic Lymphocytic Leukemia B Cells Engaged into the Cell Cycle through Dephosphorylation of STAT3 and Stabilization of p53 Expression
Alexander Sainz-Perez1,2,*,
Hélène Gary-Gouy1,*,
Françoise Gaudin*,
Ghyath Maarof*,
Anne Marfaing-Koka
,
Thierry de Revel
and
Ali Dalloul3,*
* Institut National de la Santé et de la Recherche Médicale U764, IFR 13, Université Paris XI, Clamart, France;
Laboratoire dHématologie, Hôpital Antoine Béclère, Clamart, France; and
Service dHématologie, Hôpital dInstruction des Armées Percy, Clamart, France
 |
Abstract
|
|---|
Chronic lymphocytic leukemia (CLL) is characterized by the accumulation of long-lived monoclonal B cells mostly arrested at the G0/G1 phase of the cell cycle. CLL cells strongly express intracellular melanoma differentiation-associated gene-7 (MDA7)/IL-24. However, adenovirus-delivered MDA7 was reported to be cytotoxic in several tumor cell lines. We report herein that rIL-24 alone had no effect; however, sequential incubation with rIL-2 and rIL-24 reduced thymidine incorporation by 50% and induced apoptosis of CLL cells in S and G2/M phases of the cell cycle, but not of normal adult blood or tonsil B cells. IL-24 stimulated STAT3 phosphorylation in IL-24R1-transfected cells but not in normal or CLL B cells. In contrast, IL-24 reversed the IL-2-induced phosphorylation of STAT3 in CLL, and this effect was neutralized by anti-IL-24 Ab. Phospho- (P)STAT3 inhibition induced by IL-24 was reversed by pervanadate, an inhibitor of tyrosine phosphatases. The addition of rIL-24 to IL-2-activated CLL B cells resulted in increases of transcription, protein synthesis. and phosphorylation of p53. The biological effects of IL-24 were reversed by the p53 inhibitor pifithrin-
and partly by the caspase inhibitor zvad. Troglitazone (a protein tyrosine phosphatase, PTP1B activator) phosphatase inhibited PSTAT3 and augmented p53 expression. PSTAT3 is a transcriptional repressor of p53, and therefore IL-24 induction of p53 secondary to PSTAT3 dephosphorylation may be sensed as a stress signal and promote apoptosis in cycling cells. This model explains why IL-24 can protect some resting/differentiated cells and be deleterious to proliferating cells.
 |
Introduction
|
|---|
IL-24 belongs to the IL-10 family of cytokines, which also includes IL-19, IL-20, IL-22, and IL-26 (1, 2). The expression of the corresponding gene was first described as being induced by in vitro treatment of melanoma cells with IFN-β plus mezerein (3). This resulted in growth arrest, loss of tumorigenic potential, and terminal differentiation of melanocytes, hence the name melanoma differentiation-associated gene-7 (MDA7).4 Later it was found that the MDA7 gene encoded a secreted protein, which was named IL-24. Two sets of observations suggested that IL-24 had potential as an anticancer treatment: 1) its expression inversely correlated with progression toward malignancy (4, 5); 2) delivery of IL-24 by an adenoviral vector induced growth suppression in human cancer cells (6, 7).
Among cells of the immune system, IL-24 is expressed mostly by T cells and monocytes but not by B and NK cells (8). Forced expression of CD5 (9, 10, 11) in B cells increases the abundance of IL-10 mRNA and protein (12). DNA chip analysis revealed that other transcripts of the IL-10 family were also induced by CD5 (13). Importantly, IL-24/MDA7 mRNA and protein were both found to be abnormally abundant in 30 of 30 samples from CD5+ chronic lymphocytic leukemia (CLL) B cells, reminiscent of their mature differentiated/memory status (14). We have confirmed that MDA7/IL-24 was scarce or absent in normal adult B cells (8). This strong expression in CLL argued against a proapoptotic role for endogenous IL-24 protein. Indeed, IL-24 mRNA silencing promoted CLL cell apoptosis (14), indicating that IL-24 is a survival factor in CLL. Curiously, we failed to detect IL-24 in sera from 28 of 28 CLL patients, whereas concentrations of 100–500 pg/ml are commonly detected in healthy controls. This suggests that CLL cells do not secrete IL-24, or alternatively that they inhibit IL-24-producing cells or secrete a neutralizing anti-IL-24 activity.
The protective effect of endogenous IL-24 on CLL cells seemed paradoxical, given the above-mentioned results from other groups (6, 7). One possible explanation is that IL-24 protects resting/terminally differentiated cells, whereas it is detrimental to proliferating cells. It is worth mentioning here that CLL is characterized by in vivo accumulation of long-lived and slow-dividing monoclonal B cells arrested at the G0/G1 phase with a genetic profile similar to that of memory B cells (15, 16).
We therefore studied the effects of rIL-24 on malignant B cells and found that it exerted an inhibitory effect on thymidine incorporation by IL-2-stimulated CLL B cells. We explored its mechanisms of action further and found that, following stimulation with IL-2, rIL-24 induced apoptosis of cells engaged into the cell cycle. The mechanism probably involves dephosphorylation of phospho (P)STAT3 and enhancement/stabilization of p53 expression, thereby mediating cell cycle arrest and apoptosis of cells in the G2/M phase of the cell cycle. This mechanism was unexpected as it is opposite to that generally attributed to members of the class II family of cytokines from studies with epithelial cell lines. Additionally, and at variance with the previously reported JAK/STAT-independent action of adenovirus MDA7 (17), we demonstrate a specific induction of apoptosis by rIL-24.
 |
Materials and Methods
|
|---|
Patients
The patients enrolled in the study were diagnosed according to cytologic and immunologic analyses and followed up at the Percy Military Hospital (Clamart, France) and Antoine Béclère Hospital (Clamart, France) between 2004 and 2007. Treatment-free period (if any) was at least 3 mo. Approval for these studies was obtained from the institutional review board of the University Hospital Antoine Béclère (Paris XI). All patients gave informed consent. B lymphocytes from leukemic donors were purified and maintained in culture as previously described (14). For B cell purification, a negative B cell selection was applied using a B cell enrichment RosetteSep kit (StemCell Technologies). The mean percentage of B cells was 92.5% (89.5–98%) in patients.
Reagents
The p53 transactivation activity inhibitor pifithrin-
and the caspase inhibitor zVAD-fmk (Calbiochem) and Troglitazone (Sigma-Aldrich) were used. Na-pervanadate was prepared by mixing equal concentrations of Na3VO4 with H2O2 (100 mM) (both from Sigma-Aldrich) for 15 min at room temperature, and serial dilutions were added to cells.
Cell culture, proliferation, cell cycle, and apoptosis
BW5147 cell lines transfected with empty vector or with IL-20R
plus IL-20Rβ (IL-24R1 heterodimer, given by Dr. J.-C. Renauld) were expanded in IMDM with 10% FCS, stimulated, and processed in the same way as CLL and control B cells. Tonsil and donor blood B cells were negatively selected using magnetic beads (Dynal Biotech) as previously described (12). B cells from patients were cultured in RPMI 1640 medium supplemented with 10% FCS or 10% autologous serum, penicillin (100 U/ml), streptomycin (100 mg/ml), 2 mM L-glutamate, and 1 mM sodium pyruvate (Invitrogen). Cells were incubated with rIL-2 and rIL-24 (both from R&D Systems) at respective final concentrations of 50 and 100 ng/ml (or as indicated).
Proliferation assays were performed in flat-bottom 96-well plates. Cells (105/200 µl/well) were incubated at 37°C under various conditions. Each condition was done in triplicate. After 72 h, 0.5 µCi of [methyl-3H]thymidine was added to each well and incubated 18 h at 37°C. Plates were then harvested in a Wallac Printed Filtermat A with a Harvester 96 (Tomtec) and were dried for at least 1 h. Dried Printed Filtermat was put into a Wallac sample bag and 10 ml of Betaplate Scint was added. Incorporation of thymidine was measured with the Wallac 1205 Betaplate liquid scintillation counter (all components are from PerkinElmer).
For apoptosis studies, cells were stained either with the Apo2.7-PE mAb (Beckman Coulter) on ice for 15 min, washed, and resuspended in 300 µl of PBS 1x supplemented with 0.1% BSA or with the annexin V-FITC apoptosis detection kit (BD Biosciences). Cells (1 x 105) in 100 µl 1x binding buffer were stained with 5 µl of annexin V-FITC and 5 µl propidium iodide (PI) in the dark for 15 min at room temperature. Next, 400 µl of 1x binding buffer was added before FACS analysis. For cell cycle analysis, cells were synchronized with cold thymidine (100 µM) and 1 x 106 cells were washed with cold PBS 1x and resuspended in 1 ml EtOH 70% and kept on ice for at least 10 min. Cells were then centrifuged and the pellet was suspended in 1 ml PBS 1x plus RNase (40 µg) plus PI (18 µl) (all from Sigma-Aldrich) at room temperature. The percentage of doublets was estimated by forward scatter (FSC) linear vs FSC area analysis. For CFSE staining, 5 x 106 cells were washed twice in cold PBS and resuspended in PBX plus CFSE (5 µM) for 10 min at room temperature and reaction blocked with addition of FSC (2%), washed twice, and resuspended in culture medium at different conditions.
Fluorescence was measured using a FACScan flow cytometer (BD Biosciences), and data analysis was performed using CellQuest software (BD Biosciences).
Immunoprecipitation and Western blot
CLL cells were processed from fresh blood and washed at room temperature in a serum-free RPMI with10 mM HEPES. Lysates from fresh blood CLL cells (10 x 106), stimulated with IL-2 at different times, were precipitated with 1 µg anti-phosphotyrosine clone 4G10 mAb (Upstate Biotechnology) plus protein G-Sepharose beads (Sigma-Aldrich). Proteins were separated on SDS-PAGE gels, electrotransferred onto polyvinylidene difluoride membranes (Amersham), and blotted with anti-STAT3, STAT5, and JAK1 MAbs (BD Transduction Laboratories). Blots were revealed using a goat-anti-mouse HRP-conjugate (Bio-Rad Laboratories) and ECL detection (Amersham). For pervanadate experiments, fresh CLL cells were preincubated or not with IL-2 overnight, then incubated or not with 25 µM pervanadate during 5 min and stimulated or not with IL-24 for 10 min and lysed as previously described. Blots were hybridized with anti phospho-Tyr705-STAT3 (B-7) mAb (Tebu-bio), dehybridized, and reblotted with anti-STAT3 mAb (BD Transduction Laboratories).
CLL cells (10 x 106) were stimulated or not with rIL-24, rIL-2, or rIL-2 plus rIL-24 and lysed at 4°C for 30 min in lysis buffer (20 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1 mM EDTA, 50 U/ml aprotinin, 1 mM PMSF, 1 mM sodium orthovanadate) containing 1% Nonidet P-40 detergent. Proteins were separated on SDS-PAGE gels, electrotransferred onto polyvinylidene difluoride membranes (Amersham), and blotted with either anti-p53 mAb (DakoCytomation), anti-phospho-p53 (S15) mAb (R&D Systems), anti-p38 (A-12) mAb (Tebu-bio), or anti-Bcl-2 (C-2) mAb (Tebu-bio). Blots were revealed using a goat-anti-mouse HRP conjugate (Bio-Rad Laboratories) and ECL detection (Amersham). IL-24 was neutralized with a goat IgG-anti-human IL-24 Ab (R&D Systems) according to the manufacturers instructions for 1 h at 37°C before addition to cells.
Real-time PCR
Cells (2 x 106/ml) were incubated in complete medium for 24 h under various conditions, and RNA was purified using the RNeasy Mini kit (Qiagen). Reverse transcription was done with random hexamers using SuperScript first strand synthesis system for RT-PCR (Invitrogen). Transcript expression was analyzed by PCR using the TaqMan technology. Results were analyzed using the ABI Prism 7700 sequence detection system software (PE Applied Biosystem). Each reaction was normalized by the cycle threshold (Ct) of GAPDH cDNA expression. Relative expression was calculated by measuring the difference of normalized Ct between condition A vs condition B and applying the following formula: difference of expression between A and B = 2CtA – CtB. TaqMan-specific primers and probes were selected using Primer Express software and specificity verified using National Center for Biotechnology Information (NCBI) BLAST software. The names of amplicon size primer sequences are: p53 82 L1 ATCTACTGGGACGGAACAGC, R1 GCGGAGATTCTCTTCCTCTG, P1 CGGTCTCTCCCAGGACAGGCA; p21 73 L1 CGACTGTGATGCGCTAATG, R1 TCTCGGTGACAAAGTCGAAG, P1 CATCCAGAGGCCCGTGAGC; p19 70 L1 TCCATCTGGCAGTTCAAGAG, R1 GCGATGGAGATCAGATTCAG; P1 TGCCAGAAACTGACCACAGCA; GADD45
114 L1 GATAACGTGGTGTTGTGCCT, R1 GGATGTTGATGTCGTTCTCG, P1 CTGTCGTCGTCCTCGTCCGC; MDM2 143 L1 TGCCAAGCTTCTCTGTGAAA, R1 TTTGATCACTCCCACCTTA, P1 CCTGAGTCCGATGATTCCTGCTGA; GAPDH 225 L1 GAAGGTGAAGGTCGGAGTC, R1 GAAGATGGTGATGGGATTTC, P1 CAAGCTTCCCGTTCTCAGCC.
Immunofluorescence staining
Cytospin samples were analyzed for PSTAT3 expression. Slides were fixed in PBS- 4% paraformaldehyde for 20 min and permeabilized with acetone/methanol for 10 min. Slides were then washed in PBS and incubated with 1 µg/ml anti phospho-Tyr705-STAT3 (B-7) mAb (Tebu-bio) in PBS-1% BSA for 2 h. Slides were washed in PBS then incubated with a donkey-anti-mouse R-PE conjugate (AbCys, Interchim) for 30 min and washed with PBS. Slides were then mounted with Vectashield anti-fading medium (AbCys). Fluorescent images were acquired using a charge-coupled device DP71 camera (Olympus) connected to a Zeiss microscope and managed by a computer equipped with the Cell F software (Olympus).
Statistical analysis
Statistics were carried using the two-tailed, nonparametric Wilcoxon tests using paired values.
 |
Results
|
|---|
rIL-24 inhibits thymidine incorporation by activated CLL B lymphocytes
The effect of rIL-24 on CLL cell proliferation was investigated. Peripheral blood samples were collected from 33 patients with CLL with >20,000 lymphocytes/mm3 and B cells were cultured for 3 days in medium or medium plus IL-2, with or without IL-24; then, [3H]thymidine incorporation was tested. Spontaneous apoptosis was negligible in all samples cultured for 3 days (<2%) and therefore did not affect our results. As expected, most cell samples (22/33) proliferated in response to 50 ng/ml of IL-2 alone (18, 19), albeit to various degrees. The range of the IL-2 thymidine incorporation index was from 3 to >200 (Table I shows the results for B cells from 17 patients: proliferation as assessed from thymidine incorporation was 8.9–205 times that of cells cultured in medium alone). In contrast to IL-2, rIL-24 alone had no significant effect on cell proliferation, even when used at a dose of 300 ng/ml (data not shown). However, 20–100 ng/ml of IL-24 partially reversed the IL-2-induced proliferation in 14 of 17 samples: the inhibition was between 11.7% (patient 11) and 77.3% (patient 29) ([3H]thymidine incorporation (cpm): IL-2 = 12,770; IL-2 + IL-24 = 8,868; p = 0.0004). Interestingly, cells from patient 33 underwent a Richter transformation, evolving from a CLL (33e) toward a large cell lymphoma (33f). After transformation, the cells retained strong CD5 expression and their protein phosphorylation profile on tyrosine was much more extensive than that in cells from the CLL stage (data not shown). Cells from both CLL and lymphoma stages were thawed and analyzed in parallel in the same experiment. Lymphoma cells proliferated much faster than CLL cells both in medium alone and in the presence of IL-2. IL-24 inhibited both the spontaneous (data not shown) and IL-2-induced cell growth of lymphoma cells by 59% but had no effect on CLL cells (Table I). We tested combinations of IL-2 and IL-24 on six samples of B cells from tonsils or normal adult peripheral blood in parallel, and IL-24 did not exert any inhibitory activity on normal B cells.
We also tested the effect of IL-24, added to the cultures at various times before or after addition of IL-2 (Fig. 1a). The inhibitory effect of IL-24 was greater when IL-24 was added 1 day after IL-2 (p = 0.032) than when added at the same time (p = 0.041). IL-24 added to the culture 1 day before IL-2 had no inhibitory effect (p = 0.687).

View larger version (17K):
[in this window]
[in a new window]
|
FIGURE 1. rIL-24 inhibits thymidine incorporation in activated CLL cells. a, IL-24 was added to cells cultured with IL-2 1 day before (D-1), at the same time (D0), or one day after (D1) IL-2. Counts of cells cultured with IL-2 were compared with those with IL-2 plus IL-24. b, IL-24 was added to CLL cells cultured for 24 h with medium alone, IL-2, IL-2 plus CD40 ligand, or anti-IgM plus CD40 ligand. For each condition, counts of cells cultured with IL-24 were compared with those without IL-24. Statistics: two-tailed Wilcoxons test. Thymidine (0.5 µCi/well) was added at day 3 for 15 h (n = 5–8 experiments).
|
|
IL-24 also has an inhibitory effect on cells stimulated with either IL-2 plus CD40 ligand or anti-IgM plus CD40 ligand (Fig. 1b). This effect was similar to that on cells stimulated with IL-2 alone (p = 0.01 for all conditions). These various observations suggested that IL-24 acts mainly on stimulated/proliferating cells but not on resting cells.
IL-24 suppresses IL-2-induced STAT3 phosphorylation on tyrosine through a phosphatase-dependent mechanism
We studied the effects of IL-24 on IL-2 signaling in CLL cells. The IL-2 signaling pathway starts with its interaction with IL-2R, which is then phosphorylated; this triggers the phosphorylation of JAK1, which associates with the IL-2Rβ chain, and JAK3, which associates with the common
c chain; this results in activation of STAT5 and STAT3 (20, 21, 22). Protein extracts from CLL cells incubated with IL-2 were immunoprecipitated with anti-phosphotyrosine 4G10 Ab, and Western blots were performed with mAbs specific for proteins of the JAK/STAT pathway (Fig. 2a).

View larger version (71K):
[in this window]
[in a new window]
|
FIGURE 2. IL-24 inhibits the phosphorylation of STAT3 on tyrosine in IL-2-stimulated CLL cells. a, Kinetics of IL-2 signaling. Cells (10 x 106) were cultured with rIL-2 for the indicated time, lysed, and immunoprecipitated with anti-phosphotyrosine 4G10 Ab (Ipp pTyr, left) or not (total lysate, right) and submitted to Western blotting with the Abs specific for STAT3, STAT5, and JAK1. b, IL-24 inhibits IL-2-induced PSTAT3: CLL cells from five patients were cultured with or without IL-2 overnight and stimulated or not with 100 ng/ml IL-24 for 10 min. Cells were then submitted to Western blotting with anti-PY705-STAT3, dehybridized, and blotted with anti-STAT3. c, Cells from the BW cell line transfected with empty vector or with vector carrying genes encoding the IL-24R1 heterodimer (IL-20R1 + IL-20R2 chains) (left) or B cells from tonsils (right) were incubated as in b with combinations of IL-2, IL-24, and IL-2 plus IL-24 as above; proteins were extracted and submitted to Western blotting as in b.
|
|
IL-2 induced a rapid phosphorylation (within 2 min, peaking at 10 min) of tyrosine residues in JAK1, STAT3, and STAT5 proteins (Fig. 2a). Thus, IL-2 signaling stimulated the phosphorylation of JAK/STAT proteins in CLL cells in the same way as described in normal lymphocytes and lymphoid cell lines.
We cultured CLL B cells overnight with or without IL-2 and stimulated them or not with IL-24 (sequential incubation with IL-2 and IL-24 inhibits thymidine incorporation, see above) and assessed STAT3 phosphorylation on tyrosine with anti-PY705-STAT3. STAT3 was extensively phosphorylated in cells incubated overnight with IL-2 (evidence of sustained activity) but not in cells stimulated with IL-24 alone (Fig. 2b). In contrast, the presence of IL-24 inhibited IL-2-induced phosphorylation of STAT3. The total amount of STAT3 was similar under all conditions (Fig. 2b). The above results are shown on cells from five different patients. However, IL-24 has been reported to induce the phosphorylation of STAT3 in non-B cells (27), and this is inconsistent with our observations. We therefore investigated its action on the BW5147 thymoma cell line transfected with genes encoding an IL-24R1 heterodimer consisting of both IL-20Rβ and IL-20R
chains. We confirmed IL-24R expression in this cell line by immunofluorecence (data not shown). IL-24R-transfected cells displayed a strong STAT3 phosphorylation in the presence of IL-24 but did not respond to IL-2, whereas the untransfected control cell line did not respond to either IL-2 or IL-24 (Fig. 2c, left). Control experiments with purified tonsil B cells were performed in parallel and failed to show any effect of IL-24 on STAT3 (Fig. 2c, right). These experiments demonstrated the specific effect of IL-24 on CLL cells and validated the activities of recombinant cytokines used.
We studied the kinetics and dose response of STAT3 phosphorylation following incubation with IL-2 and IL-24. STAT3 phosphorylation was inhibited by IL-24 doses as low as 10 ng/ml of IL-24 (Fig. 3b), and inhibition was rapid (2 min) (Fig. 3a). In contrast to STAT3, the amounts of STAT5 in the cytosol of cells incubated overnight with IL-2 declined (Fig. 3a, lower panel) and PSTAT5 became undetectable presumably due to dimerization and translocation into the nucleus (22). In parallel, we confirmed the specificity of rIL-24 activity on IL-2-stimulated CLL cells by neutralization experiments using a polyclonal anti-human IL-24 Ab (Fig. 3b, right).

View larger version (63K):
[in this window]
[in a new window]
|
FIGURE 3. Kinetics and specific activity of IL-24 on CLL cells. a, Right, CLL cells were cultured overnight with IL-2, and IL-24 (100 ng/ml) was added or not thereafter for 10 min; proteins were extracted, immunoprecipitated with 4G10 Ab or control mouse IgG, and submitted to Western blotting with anti-STAT3. Top left, cells were cultured overnight with IL-2 and then stimulated with IL-24 (100 ng/ml) for the indicated time, and proteins were submitted to Western blotting and probed with anti-PSTAT3, anti-STAT3, and anti-STAT5. Bottom left, Proteins were immunoprecipitated with 4G10 Ab and probed with anti-STAT5. b, Left, CLL cells were cultured overnight with IL-2 and indicated concentrations of IL-24 were added thereafter. Right, Cells cultured overnight with IL-2 were then stimulated with IL-24 (10 ng/ml), IL-24 plus anti-IL-24, or control goat IgG, or not stimulated. Protein extracts were probed with anti-PSTAT3 and with anti-STAT3 Ab.
|
|
Thus, IL-24 stimulated the dephosphorylation of PSTAT3 in CLL cells that had been prestimulated with IL-2. We used immunostaining experiments to confirm this finding. Cells were incubated overnight with or without IL-2, and IL-24 was then added for 30 min. The cells were isolated from the medium by centrifugation and stained with anti-PSTAT3 Ab. PSTAT3 was much more abundant in IL-2-cultured cells than in nonstimulated cells, and its abundance declined rapidly in the presence of IL-24; it did not relocate to the nucleus (Fig. 4a). This suggested active dephosphorylation of tyrosine in STAT3 rather than the translocation of PSTAT3 to another cell compartment. To test this possibility cells were incubated or not for 5 min with and without 25 µM pervanadate, an inhibitor of protein tyrosine phosphatase activity (23), and were then stimulated for another 10 min with IL-24. Proteins were then extracted and analyzed by Western blotting. A small amount of STAT3 in untreated CLL is naturally phosphorylated on tyrosine (Fig. 4b). As expected STAT3 was phosphorylated in the presence of IL-2 and dephosphorylated by the addition of IL-24. A short incubation with pervanadate (Fig. 4b, right panel) antagonized the inhibition by IL-24 of STAT3 phosphorylation in IL-2-stimulated cells (Fig. 4b).

View larger version (47K):
[in this window]
[in a new window]
|
FIGURE 4. IL-24 stimulates PSTAT3 dephosphorylation in IL-2-stimulated CLL cells. a, CLL cells were cultured overnight with medium alone or with IL-2. IL-24 was then added and cells were cytospun 30 min later. Cells were fixed and stained with anti-PSTAT3 Ab plus donkey anti-mouse-PE Ab (top) or with secondary Ab alone (bottom). b, Pervanadate, an inhibitor of tyrosine-phosphatase activity, reverses the inhibition by IL-24 of STAT3 phosphorylation. Left, Cells were cultured in medium alone or with IL-2 overnight, and IL-24 was added after 10 min and the cells were lysed and blotted with anti PY705-STAT3 and with anti-STAT3. Right, Cells cultured in the same conditions were supplemented with 25 µM Na-pervanadate for 5 min. The data are representative of four experiments.
|
|
Therefore, the effect of IL-24 on CLL is mediated by the induction and/or engagement of a tyrosine-phosphatase activity.
IL-24 induces the apoptosis of B cells engaged into the cell cycle
We next determined whether the inhibition of thymidine incorporation into B cells reflected cell cycle block and/or apoptosis. CLL B cells were synchronized with cold thymidine for 24 h and cultured with or without IL-2, then washed and stimulated or not with IL-24 for an additional 24 h; they were then fixed and stained thereafter with PI and subjected to FACS analysis. The proportion of hypodiploid cells as assessed by the analysis of the cell cycle was very similar to that estimated by staining with annexin V (data not shown). Hypodiploid (apoptotic) cells, cells in G0/G1, S/G2/M phases of the cell cycle, and hyperdiploid cells were counted (M1 to M4 populations, respectively, in Fig. 5, a and b). The number of cycling (S + G2/M + hyperdiploid) cells increased 4-fold under IL-2, whereas IL-24 alone had no significant effect (see the one representative sample in Fig. 5a). In contrast, the number of (S + G2/M + hyperdiploid) cells was reduced by more than half under IL-2 plus IL-24. A parallel increase in hypodiploid cells was observed under this condition (Fig. 5a). In this figure, we show all ungated cells. The percentage of cell doublets was estimated in eight experiments to be 4.4 ± 1.5, and these doublets localized mostly in the hyperdiploid population.

View larger version (31K):
[in this window]
[in a new window]
|
FIGURE 5. rIL-24 induces apoptosis and decreases the population of CLL cells engaged into the S/G2/M phase of the cell cycle. a, CLL cells were synchronized with cold thymidine, cultured in medium only or medium supplemented with IL-24, IL-2, or IL-2 then IL-24, and then fixed and stained with PI. M1, hypodiploid cells (dead); M2, cells in G0/G1; M3, cells in S + G2/M; M4, hyperdiploid cells. The increase in the M3 population under IL-2, the decrease of this population, and the increase in the M1 population under IL-2 plus IL-24 are shown. b, Analysis of the cell cycle. Mean ± SD (n = 8) of the M1 to M4 populations calculated as in a from CLL cells cultured as indicated. In each population, IL-2 vs IL-2 plus IL-24 conditions were compared using Wilcoxons test. c, Top, Cells were incubated in CFSE, stimulated with IL-2 or IL-2 plus IL-24 and stained with Apo2.7 Ab. Bottom, Cells cultured for 3 days with IL-2 or IL-2 plus IL-24 were stained with annexin V-FITC and PI; the histogram shows the population gated on annexin V plus PI cells.
|
|
The mean ± SD percentage of cells in each phase of the cell cycle was determined (Fig. 5b). Analysis of 24 samples indicated that the most significant inhibitory effect of IL-24 in IL-2-cultured cells vs IL-2 alone was on the G2/M population (7.34 ± 2.30% vs 4.01 ± 1.4%), whereas its effect was lower in hyperdiloid cells (5.42 ± 2.85% vs 2.71 ± 1.58%). IL-24 significantly increased the proportion of the cell population that was hypodiploid (4.0 ± 1.7% vs 6.79 ± 2.8%) but increased only slightly that in G0/G1 (83.4 ± 5.3 vs 87.2 ± 5.3%) (Fig. 5b).
These results suggested that IL-24 induced apoptosis at the expense of proliferating cells. To verify this, we incubated cells with CFSE, with IL-2 and with or without IL-24; the cells were then stained with Apo2.7 mAb after 2 days. Apoptosis was evidenced in 27.7% cells that had been stimulated with IL-2 plus IL-24 and only in those that had undergone one division (CFSElow cells) but not in those that did not divide (CFSEhigh cells) (Fig. 5c). In contrast, the proportion of cells cultured with IL-2 alone and that had divided and underwent apoptosis was much lower (10.5%) (Fig. 5c). The percentage of annexin V-positive, PI-negative apoptotic cells was also higher under IL-2 plus IL-24 (20%) than under IL-2 (8%) (see the representative sample in Fig. 5c).
IL-24 induces apoptosis through stabilization/enhancement of p53 expression
Oncogenic pathways that signal through STAT3 inhibit p53 expression (24, 25). STAT3 is a latent transcription factor activated by several growth factors and cytokines (26), including cytokines of the
c family, which cause its phosphorylation on tyrosine and translocation into the nucleus. Work with nonlymphoid cells shows that several members of the class II family of cytokines, which includes IL-24 (2, 27, 28), activate STAT3; also, IL-24-mediated apoptosis was reported to be independent of STATs in several nonlymphoid cell lines (17). However, our results demonstrate that IL-24 abolishes IL-2 signaling in CLL.
To investigate the mechanisms of IL-24-mediated apoptosis, we incubated CLL cells with various combinations of IL-2, IL-24, zvad (a caspase inhibitor), and pifithrin (pft)-
, an inhibitor of p53 transactivation (29). Cell cycle analysis was performed using cells stained with PI. The number of cells in the G2/M phase of the cell cycle was, under IL-2 plus IL-24, half that under IL-2 (3.36 ± 1.3% vs 7.1 ± 1.5%). Pft-
almost totally reversed the loss of cells from the S/G2/M phases induced by IL-24 (6.44 ± 2.2% in the presence of pft-
vs 3.36 ± 1.3% in its absence) (Fig. 6, a and b). The effect of IL-24 on the proportion of cells in the S/G2/M phase was also reduced albeit to a lesser extent by zvad (IL-2 + IL-24 + zvad: 4.8 ± 1.77%) (Fig. 6, a and b). These observations suggest that cells driven to proliferation by IL-2 undergo a p53-mediated block of the cell cycle followed by (at least partly) caspase-dependent apoptosis. IL-24 increased p53 expression in IL-2-stimulated CLL cells as assessed by Western blots and quantitative PCR (Fig. 6, c and d), consistent with this model. Note that, unlike p53, there were no detectable effects on Bcl-2 and p38MAPK expression (Fig. 6c). p53 expression and stabilization depend on phosphorylation of serines in the N-terminal transactivation domain (30), and we observed an increase in Pser15-p53 in IL-2 plus IL-24-stimulated cells (Fig. 6c). Thus, IL-24 promoted the expression and possibly the stabilization of p53 protein. We investigated the expression of downstream targets of p53, including p19, p21 and GADD45 gene products (30, 31, 32): the transcription of p21 was enhanced by IL-24 after 72 h, whereas MDM2, a molecule that helps degrade p53 (33), was slightly inhibited, and p19 and GADD45 were unchanged (Fig. 6d).

View larger version (49K):
[in this window]
[in a new window]
|
FIGURE 6. The decrease in the S/G2/M population in IL-2 plus IL-24-cultured cells is dependent on IL-24-mediated induction of p53 expression. a and b, The pharmacological inhibitor of p53, pft- , reverses the IL-24-mediated decrease of cells engaged into cell cycle. Cells were cultured overnight with medium or IL-2 and then supplemented with pft- (40 µM), zvad-fmk (zvad) (10 µg/ml), IL-24, IL-24 plus pft- , IL-24 plus zvad, or IL-24 plus anti-IL-24 for 24 h and stained with PI for cell cycle analysis. a, A representative experiment from one patient with CLL is shown. b, Percentage of CLL cells in the S/G2/M phases of the cell cycle (open histograms) or hypodiploid cells (filled histograms). Means ± SD for cells from eight different patients. For black-and-white histograms, comparisons were made between IL-2 plus IL-24 vs IL-2 and between IL-2 plus IL-24 and IL-2 plus IL-24 plus either pft- , zvad, or anti-IL-24. Only significant results (p < 0.03) using Wilcoxons test are indicated (*). c, IL-24 augments p53 expression and phosphorylation in CLL. Cells were lysed after 3 days of culture as indicated and analyzed by Western blotting with anti-p53, anti-Pser15-p53, anti-Bcl-2, and anti-p38 MAP kinase Abs. d, Relative gene expression in CLL cells cultured for 48 h with medium only and medium containing IL-24, IL-2, and IL-2 plus IL-24 (histograms in that order). RNA was extracted on day 3, reverse-transcribed, amplified, and analyzed by real-time PCR. Means ± SD samples for samples from four to six different patients are shown. Values for medium- vs IL-2 plus IL-24-treated samples were compared using Wilcoxons test.
|
|
The phosphatase activator troglitazone induces p53 expression, STAT3 dephosphorylation, and apoptosis of CLL cells
We showed that IL-24-induced apoptosis in CLL is dependent on p53 expression (see above). As PSTAT3 is a repressor of p53 transcription, IL-24-induced apoptosis in CLL is presumably also dependent on PSTAT3 dephosphorylation. Therefore, a phosphatase activator may reproduce some of the effects of IL-24.
Troglitazone (TG) is an activator of protein tyrosine phosphatase 1B (PTP1B); it reduces PY705-STAT3 and promotes apoptosis in human primary gliomas (34). We tested whether TG stimulated p53 expression and apoptosis in CLL. TG induced dose-dependent dephosphorylation of PSTAT3 in CLL cells cultured in the presence of IL-2. It also induced p53 production, but had no effect on total STAT3 abundance (Fig. 7a). Cell cycle analysis (Fig. 7b) and annexin V staining and cell counting (data not shown) showed that TG treatment led to the death of IL-2-stimulated cells. Note that IL-24 killed cells in S/G2/M phase but not those in G0/G1 phase of the cell cycle, whereas TG mainly affected cells in the G0/G1 phase (Fig. 7b, left). Thus, although there were some differences, TG had effects similar to those of IL-24, consistent with our observation that the inhibition of PSTAT3 is a general mechanism leading to enhanced p53 expression and cell death of proliferating cells.

View larger version (38K):
[in this window]
[in a new window]
|
FIGURE 7. Effect of TG on dephosphorylation of PSTAT3, p53 induction, and cell death in CLL. a, TG inhibits the phosphorylation of STAT3 and augments p53 expression in IL-2-cultured CLL cells. Cells cultured with IL-2 and the indicated concentrations of TG were lysed and probed by Western blotting with Abs specific for PY705-STAT3, total STAT3, p53 and Bcl-2. b, The same cells as in a were analyzed for progression through the cell cycle. Left, Analysis of the population in G1 gated on living populations. Right, Analysis of the cells in G2/M phase (M2) (n = 5).
|
|
 |
Discussion
|
|---|
We report the first description of the conditions under which IL-24 exerts a proapoptotic effect on CLL as well as the associated molecular events. The effect is dose dependent and reversed at both cellular and molecular levels by anti-IL-24 Abs; it is therefore specific. CLL cells contain abundant IL-24 mRNA and protein (14), and this led us to study the effect of exogenous IL-24 on these cells. Our findings appeared not to be entirely coherent with the published (5, 6, 7) apoptotic effect of adenovirus-encoded IL-24. This effect was described as being independent of both IL-24R and the JAK/STAT pathway (17). However, we found that rIL-24 is proapoptotic, provided that CLL cells are stimulated to enter the cell cycle, and this reconciles the various diverse observations. IL-24 expression inversely correlates with the proliferation of malignant melanocytes (4, 5), which is consistent with IL-24 having protective and growth inhibition activities in terminally differentiated cells, which is the case in CLL cells (13, 14, 15, 16). However, intracellular IL-24 did not apparently counteract the apoptotic effect of rIL-24 in IL-2-stimulated CLL cells. To explain this, we observed that IL-24 transcripts are rapidly down-regulated in activated B cells (unpublished data). We think therefore that once cells have received a proliferation signal (here by IL-2), intracellular IL-24 is down-regulated; this allows cells to enter the cell cycle. If cells are exposed shortly after a "stop signal" (here by rIL-24), they undergo apoptosis (this is also consistent with the role of p53, see below).
Note that the effects of IL-24 on B cells are similar to those of IL-4. IL-4 exerts an inhibitory effect after B cells receive an activation signal, from, for example, IL-2 (35, 36). However, IL-4 and IL-24 may inhibit B cell proliferation by different molecular mechanisms, as their respective expressions are inversely correlated. We indeed observed that IL-4 is a potent inhibitor of both CD5 and IL-24 expression in B cells (our unpublished results), which is also consistent with CD5 being an IL-24 inducer (14).
CLL cell death was diminished by zvad-fmk, and thus caspases are involved to some extent and need to be studied more in detail. In contrast, cell death was abolished by a pharmacological inhibitor of p53, and therefore the mechanism involves p53 induction.
p53 is a major transcription factor that potently inhibits cell cycle progression at G1/S and G2/M checkpoints (37, 38). Its expression and function are impaired in many tumors (39, 40) due to down-regulation or inactivation by mutations. Restoring endogenous p53 induced regression of murine liver carcinomas in vivo. The mechanism did not involve apoptosis but instead involved induction of a senescence program associated with the production of M-CSF, CCL2, CXCL1, and IL-15 (41). Note that IL-24 induces the production by human PBMC of inflammatory cytokines, including TNF-
, GM-CSF, IL-6, IL-12, and IFN-
(42). Restoration of p53 function in vivo can lead to tumor regression through induction of cellular senescence in sarcomas and apoptosis in lymphomas (43). These studies pave the way for the use of p53 activators to treat human cancers. Here, however, we could not reverse death completely with zvad-fmk, so both senescence and apoptosis may be at work in CLL. The patterns of regulation of downstream genes indicate that p53 accumulates in cells following stress signals that stop its degradation and/or enhance its transcription and its activity as a transcription factor (Fig. 6). IL-24 may act as a stress signal that turns off the IL-2-signaling cascade and induces p53 expression, probably by inactivating the p53 transcriptional repressor PSTAT3. Other mechanisms may also be operating through the stabilization of p53 and/or inhibition of its degradation through the phosphorylation of Ser15 in p53 by any of at least eight different Ser/Thr kinases (30), including p38 MAPK, which is activated by IL-24 (14). However, the complexity of p53 regulation by posttranslational mechanisms is such that dedicated analysis is required to understand the effects of IL-24 more fully. Our experiments support the role of PSTAT3 dephosphorylation on p53 de-repression and downstream induction of cell death. TG, an antidiabetic drug and a PPAR-
agonist (34) that activates the tyrosine phosphatase PTP1B, which then dephosphorylates PSTAT3, augmented p53 expression and apoptosis in IL-2-stimulated CLL cells, thereby mimicking the effect of IL-24. Inhibiting PSTAT3 to enhance p53 expression, which in the context of proliferating cells is sensed as a danger signal, may be a general mechanism operating in both normal and malignant cells. This mechanism requires p53 with no inactivating mutation or deletion that is active as a transcription factor. This is indeed the case in most CLLs (44, 45) and in cancers, as p53 mutations generally occur late in tumor progression (46, 47). Our results and working hypothesis are summarized in Fig. 8.

View larger version (19K):
[in this window]
[in a new window]
|
FIGURE 8. Working hypothesis of the effects of IL-24 on the p53 gatekeeper of the cell cycle in CLL cells. In resting cells, IL-2 induces sustained STAT3 phosphorylation, thereby repressing p53. This allows cells to progress toward the cell cycle. In cycling cells, the addition of IL-24 or TG induces PSTAT3 dephosphorylation, thus derepressing/stabilizing p53. This results in exit from the cell cycle at the G2/M phase and apoptosis. This effect is blocked by the p53 inhibitor pft- .
|
|
IL-24 is expressed in keratinocytes (48) and in inflamed skin (49). Its physiological function, if any, on lymphocytes remains obscure despite IL-24 being expressed by human PBMC and having pro-TH1 activity (42). Further work is required to determine which receptor(s) of IL-24, and phosphatases mediated its effects. In physiological conditions, SHP-1 and SHP-2, are recruited to the IL-2Rβ and dephosphorylate proteins of the JAK/STAT family, thereby terminating the IL-2-induced signal (50, 51). We indeed observed that SHP-1 is present in huge amounts in CLL (data not shown). Our molecular studies were limited to the action of IL-24 on IL-2-stimulated cells, although IL-24 inhibits cells stimulated with anti-IgM plus CD40 ligand (Fig. 1). In contrast, IL-24 was inactive on cells stimulated with anti-IgM only probably due to the poor response of CLL cells to anti-IgM alone. In conclusion, sequential activation of cells with a growth factor to trigger the proliferation followed by PSTAT3 inhibition and restoration of p53 expression by IL-24 may be useful to treat CLL and other cancers (52, 53).
 |
Acknowledgments
|
|---|
We thank Dr. J. C. Renauld for giving us IL-24R-transfected cell lines, and for critical reading of the manuscript.
 |
Disclosures
|
|---|
The authors have no financial conflicts of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 A.S.-P. and H.G.-G. contributed equally to this work. 
2 Current address: Département dImmunologie, Bâtiment Metchnikoff, 2ème Étage, Institut Pasteur, 25 Rue du Dr. Roux, Paris 75524, France. 
3 Address correspondence and reprint requests to Dr. A. H. Dalloul, Unité de Thérapie Cellulaire (UTCT), Hôpital Universitaire de Nancy-Brabois, Nancy 54000 France. E-mail address: a.dalloul{at}chu-nancy.fr 
4 Abbreviations used in this paper: MDA7, melanoma differentiation-associated gene-7; CLL, chronic lymphocytic leukemia; pft-
, pifithrin-
; PI, propidium iodide; PSTAT3, phospho STAT3; PTP1B, protein tyrosine phosphatase 1B; TG, troglitazone; FSC, forward scatter. 
Received for publication April 29, 2008.
Accepted for publication August 16, 2008.
 |
References
|
|---|
- Kotenko, S. V.. 2002. The family of IL-10-related cytokines and their receptors: related but to what extent?. Cytokine Growth Factor Rev. 13: 223-240. [Medline]
- Renauld, J. C.. 2003. Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat. Rev. Immunol. 3: 667-676. [Medline]
- Jiang, H., J. J. Lin, Z. Z. Su, N. I. Goldstein, P. B. Fisher. 1995. Subtraction hybridization identifies a novel melanoma-associated differentiation antigen, mda7, modulated during human melanoma differentiation growth and progression. Oncogene 11: 2477-2486. [Medline]
- Ellerhorst, J. A., V. G. Prieto, S. Ekmekcioglu, L. Broemeling, S. Yekell, S. Chada, E. A. Grimm. 2002. Loss of MDA-7 expression with progression of melanoma. J. Clin. Oncol. 20: 1069-1074. [Abstract/Free Full Text]
- Ekmekcioglu, S., J. Ellerhorst, A. M. Mhashilkar, A. A. Sahin, C. M. Read, V. G. Prieto, S. Chada, E. A. Grimm. 2001. Down-regulated melanoma differentiation associated gene (mda-7) expression in human melanomas. Int. J. Cancer 94: 54-59. [Medline]
- Lebedeva, I. V., Z. Z. Su, Y. Chang, S. Kitada, J. C. Reed, P. B. Fisher. 2002. The cancer growth suppressing gene mda-7 induces apoptosis selectively in human melanoma cells. Oncogene 21: 708-718. [Medline]
- Su, Z. Z., M. T. Madireddi, J. J. Lin, C. S. Young, S. Kitada, J. C. Reed, N. I. Goldstein, P. B. Fisher. 1998. The cancer growth suppressor gene mda-7 selectively induces apoptosis in human breast cancer cells and inhibits tumor growth in nude mice. Proc. Natl. Acad. Sci. USA 95: 14400-14405. [Abstract/Free Full Text]
- Poindexter, N. J., E. T. Walch, S. Chada, S. , E. A. Grimm. 2005. Cytokine induction of interleukin-24 in human peripheral blood mononuclear cells. J. Leukocyte Biol. 78: 745-752. [Abstract/Free Full Text]
- Bikah, G., J. Carey, J. R. Cialella, A. Tarakhovsky, S. Bondada. 1996. CD5-mediated negative regulation of antigen-receptor-induced growth signals in B-1 B cells. Science 274: 1906-1909. [Abstract/Free Full Text]
- Gary-Gouy, H., P. Bruhns, A. Dalloul, M. Daëron, G. Bismuth. 2000. The pseudo-immunoreceptor tyrosine-based activation motif of CD5 mediates its inhibitory action on B-cell receptor signaling. J. Biol. Chem. 275: 548-556. [Abstract/Free Full Text]
- Gary-Gouy, H., J. Harriague, A. Dalloul, E. Donnadieu, G. Bismuth. 2002. CD5-negative regulation of B cell receptor signaling pathways originates from tyrosine residue Y429 outside an immunoreceptor tyrosine-based inhibitory motif. J. Immunol. 168: 232-239. [Abstract/Free Full Text]
- Gary-Gouy, H., J. Harriague, G. Bismuth, C. Platzer, C. Schmitt, A. H. Dalloul. 2002. Human CD5 promotes B-cell survival through stimulation of autocrine IL-10 production. Blood 100: 4537-4543. [Abstract/Free Full Text]
- Gary-Gouy, H., A. Sainz-Perez, J.-B. Marteau, A. Marfaing-Koka, J. Delic, H. Merle-Béral, P. Galanaud, A. Dalloul. 2007. Natural phosphorylation of CD5 in chronic lymphocytic leukemia B cells and analysis of CD5-regulated genes in a B cell line suggest a role for CD5 in malignant phenotype. J. Immunol. 179: 4335-4344. [Abstract/Free Full Text]
- Sainz-Perez, A., H. Gary-Gouy, A. Portier, F. Davi, H. Merle-Beral, P. Galanaud, A. Dalloul. 2006. High MDA-7 expression promotes malignant cell survival and p38 MAP kinase activation in chronic lymphocytic leukemia. Leukemia 20: 498-504. [Medline]
- Klein, U., Y. Tu, G. A. Stolovitzky, M. Mattioli, G. Cattoretti, H. Husson, A. Freedman, G. Inghirami, L. Cro, L. Baldini, et al 2001. Gene expression profiling of B cell chronic lymphocytic leukemia reveals a homogeneous phenotype related to memory B cells. J. Exp. Med. 194: 1625-1638. [Abstract/Free Full Text]
- Rosenwald, A., A. A. Alizadeh, G. Widhopf, R. Simon, R. E. Davis, X. Yu, L. Yang, O. K. Pickeral, L. Z. Rassenti, J. Powell, et al 2001. Relation of gene expression phenotype to immunoglobulin mutation genotype in B cell chronic lymphocytic leukemia. J. Exp. Med. 194: 1639-1647. [Abstract/Free Full Text]
- Sauane, M., R. V. Gopalkrishnan, I. Lebedeva, M. X. Mei, D. Sarkar, Z.-Z. Su, D.-C. Kang, P. Dent, S. Pretska, P. B. Fisher. 2003. Mda7/IL-24 induces apoptosis of diverse cancer cell lines through JAK/STAT-independent pathways. J. Cell. Physiol. 196: 334-345. [Medline]
- Lantz, O., C. Grillot-Courvalin, J.-P. Fermand, J.-C. Brouet. 1985. Interleukin-2-induced proliferation of leukemic human B cells. J. Exp. Med. 161: 1225-1230. [Abstract/Free Full Text]
- Touw, I., B. Lowenberg. 1985. Interleukin 2 stimulates chronic lymphocytic leukemia colony formation in vitro. Blood 66: 237-240. [Abstract/Free Full Text]
- Friedmann, M. C., T.-S. Migone, S. M. Russell, W. J. Leonard. 1996. Different interleukin 2 receptor β-chain tyrosines couple to at least two signaling pathways and synergistically mediate interleukin 2-induced proliferation. Proc. Natl. Acad. Sci. USA 93: 2077-2082. [Abstract/Free Full Text]
- Frank, D. A., M. J. Robertson, A. Bonni, J. Ritz, M. E. Greenberg. 1995. Interleukin 2 signaling involves the phosphorylation of Stat proteins. Proc. Natl. Acad. Sci. USA 92: 7779-7783. [Abstract/Free Full Text]
- Paukku, K., O. Silvennoinen. 2004. STATs as critical mediators of signal transduction and transcription: lessons learned from STAT5. Cytokine Growth Factor Rev. 6: 435-455.
- Heffetz, D., H. Bushkin. 1990. The insulinomimetic agents H2O2 and vanadate stimulate protein tyrosine phosphorylation in intact cells. J. Biol. Chem. 265: 2896-2902. [Abstract/Free Full Text]
- Bromberg, J.F., M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese, J. E. Darnell, Jr. 1999. Stat3 as an oncogene. Cell 98: 295-303. [Medline]
- Niu, G., K. L. Wright, Y. Ma, G. M. Wright, M. Huang, R. Irby, J. Biggs, J. Karras, D. Cress, D. Pardoll, et al 2005. Role of stat3 in regulating p53 expression and function. Mol. Cell. Biol. 25: 7432-7440. [Abstract/Free Full Text]
- Zhong, Z., Z. Wen, J. E. Darnell, Jr. 1994. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264: 95-98. [Abstract/Free Full Text]
- Dumoutier, L., C. Leemans, D. Lejeune, S. V. Kotenko, J. C. Renauld. 2001. Cutting edge: STAT activation by IL-19, IL-20, and mda-7 through IL-20 receptor complexes of two types. J. Immunol. 167: 3545-3549. [Abstract/Free Full Text]
- Wang, M., P. Liang. 2005. Interleukin-24 and its receptors. Immunology 114: 166-170. [Medline]
- Komarov, P. G., E. A. Komarova, R. V. Kondratov, C. Christov-Tselkov, J. S. Coon, M. V. Chernov, A. V. Gudkov. 1999. A chemical inhibitor of p53 that protect mice from the side effects of cancer therapy. Science 85: 1733-1737.
- Toledo, F., G. Wahl. 2006. Regulating the p53 pathway: in vitro hypothesis, in vivo veritas. Nat. Rev. Cancer 6: 909-923. [Medline]
- el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. F. Mercer, K. W. Kinzler, B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 19: 817-825.
- Zhan, Q., I. Bae, M. B. Kastan, A. J. Fornace, Jr. 1994. The p53-dependent gamma-ray response of GADD45. Cancer Res. 54: 2755-2760. [Abstract/Free Full Text]
- Efeyan, A., M. Serrano. 2007. p53: guardian of the genome and policeman of the oncogenes. Cell Cycle 6: 1006-1010. [Medline]
- Akasaki, Y., G. Liu, H. H. Matundan, H. Ng, X. Yuan, Z. Zeng, K. L. Black, J. S. Yu. 2005. A peroxisome proliferator-activated receptor-
agonist, troglitazone, facilitates caspase-8 and -9 activities by increasing the enzymatic activity of protein-tyrosine phosphatase-1B on human glioma cells. J. Biol. Chem. 281: 6165-6174. [Medline] - Defrance, T., B. Vanbervliet, J. P. Aubry, J. Banchereau. 1988. Interleukin-4 inhibits the proliferation but not the differentiation of activated human B cells in response to interleukin 2. J. Exp. Med. 168: 1321-1337. [Abstract/Free Full Text]
- Llorente, L., M. C. Crevon, S. Karray, T. Defrance, J. Banchereau, P. Galanaud. 1989. Interleukin (IL) 4 counteracts the helper effect of IL-2 on antigen-activated human B cells. Eur. J. Immunol. 19: 765-769. [Medline]
- Levine, A. J.. 1997. p53, the cellular gatekeeper for growth and division. Cell 88: 323-331. [Medline]
- Vousden, K. H.. 2002. Activaton of the p53 tumor suppressor protein. Biochim. Biophys. Acta 1602: 47-59. [Medline]
- Raman, V., A. Martensen, D. Reisman, E. Evron, W. F. Odenwald, E. Jaffee, J. Marks, S. Sukumar. 2000. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 405: 974-978. [Medline]
- Honda, U., K. Ushijima, H. Oda, Y. Tanaka, S. Aizawa, T. Ishikawa, Y. Yazaki, H. Hirai. 2000. Acquired loss of p53 induces blastic transformation in p210bcr/abl-expressing hematopoietic cells: a transgenic study for blast crisis in CML. Blood 95: 1144-1152. [Abstract/Free Full Text]
- Xue, W., L. Zender, C. Miething, R. A. Dickins, E. Hernando, V. Krizhanovsky, C. Cordon-Cardo, S. W. Lowe. 2007. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature 445: 656-660. [Medline]
- Caudell, E. G., J. B. Mumm, N. Poindexter, S. Ekmekcioglu, A. M. Mhasilkar, X. H. Yang, M. W. Retter, P. Hill, E. A. Grimm. 2002. The protein product of the tumor suppressor gene, melanoma differentiation-associated gene 7, exhibits immunostimulatory activity and is designated IL-24. J. Immunol. 168: 6041-6046. [Abstract/Free Full Text]
- Ventura, A., D. G. Kirsch, M. E. McLaughlin, D. A. Tuveson, J. Grimm, L. Lintault, J. Newman, E. E. Reczek, R. Weissleder, T. Jacks. 2007. Restoration of p53 function leads to tumour regression in vivo. Nature 445: 661-665. [Medline]
- Thornton, P. D., A. M. Gruszka-Westwood, R. A. Hamoudi, S. Atkinson, P. Kaczmarek, R. M. Morilla, B. L. Hilditch, R. A'Hern, E. Matutes, D. Catovsky. 2004. Characterisation of TP53 abnormalities in chronic lymphocytic leukaemia. Hematol. J. 5: 47-54. [Medline]
- el Rouby, S., A. Thomas, D. Costin, C. R. Rosenberg, M. Potmesil, R. Silber, E. W. Newcomb. 1993. p53 gene mutation in chronic B-cell lymphocytic leukemia is associated with drug resistance and is independent of MDR1/MDR3 gene expression. Blood 82: 3452-3459. [Abstract/Free Full Text]
- Baker, Z. J., A. C. Preisinger, J. M. Jessup, C. Paraskeva, S. Markowitz, J. K. Wilson, S. Hamilton, B. Vogelstein. 1990. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res. 50: 7717-7722. [Abstract/Free Full Text]
- Pharoah, P. D., N. E. Day, C. Caldas. 1999. Somatic mutations in the p53 gene and prognosis in breast cancer: a meta-analysis. Br. J. Cancer 80: 1968-1973. [Medline]
- Kunz, S., K. Wolk, E. Witte, W. D. Doecke, H.-D. Volk, W. Sterry, K. Asadullah, R. Sabat. 2006. Interleukin (IL)-19, IL-20 and IL-24 are produced by and act on keratinocytes and are distinct from classical ILs. Exp. Dermatol. 15: 991-1004. [Medline]
- Chan, J. R., W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A.B. Kimball, et al 2006. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis. J. Exp. Med. 203: 2577-2587. [Abstract/Free Full Text]
- Adachi, M., M. Ishino, T. Torigoe, Y. Minami, T. Matozaki, T. Miyazaki, T. Taniguchi, Y. Hinoda, K. Imai. 1997. Interleukin-2 induces tyrosine phosphorylation of SHP-2 through IL-2 receptor β chain. Oncogene 14: 1629-1633. [Medline]
- Migone, T. S., N. A. Cacalano, N. Taylor, T. Yi, T. A. Waldmann, J. A. Johnston. 1998. Recruitement of SH2-containing protein tyrosine phosphatase SHP-1 to the interleukin 2 receptor; loss of SHP-1 expression in human T-lymphotropic virus type-I-transformed T cells. Proc. Natl. Acad. Sci. USA 95: 3845-3850. [Abstract/Free Full Text]
- Kojima, K., M. Konopleva, T. McQueen, S. O'Brien, W. Plunkett, M. Andreeff. 2006. Mdm2 inhibitor Nutlin-3a induces p53-mediated apoptosis by transcription-dependent and transcription-independent mechanisms and may overcome Atm-mediated resistance to fludarabine in chronic lymphocytic leukemia. Blood 108: 993-1000. [Abstract/Free Full Text]
- Yu, H., R. Jove. 2004. The STATs of cancer-new molecular targets come of age. Nat. Rev. Cancer 4: 97-105. [Medline]