The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 181, 6027 -6037
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le, T.-v. L.
Right arrow Articles by Chaplin, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le, T.-v. L.
Right arrow Articles by Chaplin, D. D.

Intraclonal Competition Inhibits the Formation of High-Affinity Antibody-Secreting Cells1

Thuc-vy L. Le2, Tea Hyun Kim and David D. Chaplin3

Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Protective immunity requires a diverse, polyclonal B cell repertoire. We demonstrate that affinity maturation of the humoral response to a hapten is impaired when preexisting clonally restricted cells recognizing the hapten are dominant in the B cell repertoire. B1-8i+/– mice, which feature a high frequency of B cells with nitrophenyl (NP)-binding specificity, respond to NP-haptenated proteins with the production of NP-specific Abs, but affinity maturation is impaired due to insufficient generation of high-affinity Ab-producing cells. We manipulated the frequency of NP-specific B cells by adoptive transfer of B1-8 B cells into naive, wild-type recipients. Remarkably, when 104 B1-8 B cells were transferred, these cells supported efficient affinity maturation and plasma cell differentiation. In contrast, when 106 B1-8 cells were transferred, affinity maturation did not occur. These data indicate that restricting the frequency of clonally related B cells is required to support affinity maturation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Affinity maturation of the Ab response is a hallmark of adaptive immunity. Affinity maturation is a process by which Ab produced in response to immunization show increased binding strength to their target Ag over time. This process involves both clonal selection (1) and somatic hypermutation (SHM)4 (2). A broad range of studies using cellular and molecular approaches are providing an increasingly complete appreciation of the molecular mechanisms underlying these processes.

CD4+ T cells are activated by encounter with proteolytically processed Ag presented on APC (3, 4, 5). In contrast, naive B cells can be primed by either soluble (6) or membrane-bound unprocessed Ag (7). Priming of Ag-specific B and T cells is thought to occur in the B cell and T cell zones of secondary lymphoid tissues (8). Within 1–3 days after immunization, IgM+ Ab-secreting cell (ASC) clusters appear in bridging channels between the red pulp and the periarteriolar lymphoid sheathes of the spleen or in the medullary cords of lymph nodes (9). The bridging channel ASC are thought to arise largely from marginal zone B cells (10). In contrast to activated marginal zone B cells, Ag-primed follicular B cells and T cells relocate to and interact at the junction between the B cell and T cell zones. There, B cells present processed Ag to CD4+ TH cells (11). Class switch recombination (CSR) also occurs at the B cell/T cell interface (12). Activated Ag-specific B and T cells subsequently migrate to the follicles and enter into germinal center (GC) reactions (8, 13). Within the GC structure, GC B cells interact intimately with the local cellular microenvironment and here it is thought that the GC B cells undergo SHM, affinity-based selection, and differentiation into memory B cells and long-lived ASC (8).

When C57BL/6 mice are immunized with (4-hydroxy-3-nitrophenyl)acetyl (NP)-haptenated proteins, B cells expressing the VH186.2 gene paired with a {lambda}1-L chain (LC) predominate in the repertoire of responding cells. The B1-8i mouse strain was created by targeted insertion of a VH186.2(DFL16.2)JH2 gene into the H chain (HC) locus of a 129/Ola ES cell (14). B cells that coexpress this B1-8 HC transgene with an endogenous {lambda}1-LC express the a allotypic variant of the HC and confer specificity to the hapten NP. Because not all {lambda}-LC-bearing B cells that pair with the B1-8 HC have the same NP-binding affinity, the {lambda}-LC- bearing B cells in the B1-8i strain do not act as a true monoclonal population. Nevertheless, because the predominant {lambda}-LC in mice is {lambda}1, we considered this NP-binding population to be functionally monoclonal.

In wild-type (WT) mice, as the immune response progresses, increasing numbers of high-affinity ASC and memory B cells are detected in secondary lymphoid tissues and bone marrow (BM). Clonal proliferation of high-affinity B cells is thought to be the result of competition for growth signals between high-affinity B cells, low-affinity B cells, and B cells with no affinity to the Ag. This competition is defined as interclonal and is widely accepted as a mechanism for selection of high-affinity B cells within the GC. We demonstrate that, in addition to interclonal competition between B cells that express different BCR, elevated numbers of B cells expressing similar or identical Ig genes undergo intraclonal competition. When elevated, this form of competition results in the reduction of the high-affinity Ab response and alters the pathways that lead to generation of high-affinity ASC.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

C57BL/6, C57BL/6(Ig {kappa}–/–), and C57BL/6(CD45.1) mice were purchased from The Jackson Laboratory and 129/Ola mice were purchased from Harlan. The B1-8i+/– knock-in mouse strain was produced by Sonoda et al. (14) and was generously provided by F. Alt (Harvard Medical School, Boston, MA). It was backcrossed to the C57BL/6 strain for at least 10 generations. Previous studies have demonstrated that the B1-8 knock-in allele effectively excludes the endogenous allele (14). Therefore, we used heterozygous mice in all subsequent studies. Mice were immunized i.p. with 50 µg of NP-keyhole limpet hemocyanin (KLH; Biosearch Technologies) precipitated in alum (Sigma-Aldrich) and boosted with 25 µg of NP-KLH at day 25. All immunization protocols followed this time line and dose unless stated in the text. Mice were housed in a barrier facility and maintained under protocols approved by the Institutional Animal Care and Usage Committee at the University of Alabama at Birmingham.

Abs and reagents

Monoclonal mouse anti-IgMa-PE, anti-IgMb-FITC, anti-B220-PerCP, anti-B220-allophycocyanin-Cy7, anti-IgG1a-biotin, anti-IgG1b-biotin, anti-CD138-PE, and anti-MHC II-PE, were purchased from BD Biosciences. Anti-CD22-PE-Cy5 was purchased from Abcam and anti-CD38-FITC was purchased from eBioscience. Monoclonal rat anti-mouse IgM-HRP, anti-IgG1-HRP, and streptavidin-HRP were purchased from Southern Biotechnology Associates. Polyclonal goat anti-mouse IgM, goat anti-mouse IgG, and mouse IgG1 Abs were purchased from Sigma-Aldrich. NP-allophycocyanin was made by coupling NP-Osu (Biosearch Technologies) with allophycocyanin (ProZyme) in N,N-dimethylformamide.

Immunofluorescence microscopy

Freshly isolated tissues were embedded in Tissue Tek OCT compound (Fisher Scientific) and frozen by floating the tissues on liquid nitrogen-chilled 2-methylbutane. Eight- to 10-µm sections were cut on a cryostat (Leica), air dried on Superfrost Plus slides (Fisher Scientific), and fixed for 10 min in acetone at 4°C before storage at –20°C until further use. Nonspecific binding was blocked using a combination of 10% rabbit and 10% goat serum together with a biotin blocking kit (Vector Laboratories), followed by staining with primary and secondary Abs or 4-hydroxy-3-iodo-5-nitrophenylacetyl (NIP)-biotin (NIP-biotin; Biosearch Technologies). Signals due to bound NIP were enhanced using streptavidin-HRP Alexa Fluor 350 Tyramide Signal Amplification System (Invitrogen).

Flow cytometry

Single-cell suspensions from spleen tissues were stained with the indicated Abs or NP-allophycocyanin. For adoptive transfer experiments, purified B cells were prepared by incubation with MACS anti-CD43 beads and fractionation with the AutoMACS (Miltenyi Biotec) according to the manufacturer’s protocols. For intracellular staining, cells were incubated with mAb 24. G2 and anti-mouse IgG1 to block Fc receptors and surface IgG1. The cells were fixed and permeabilized using CytoFix/Cytoperm (BD Biosciences) and then intracellular IgG1 was stained according to the manufacturer’s guidelines. Cytometric data were acquired using an LSR II (BD Biosciences) and analyzed using FlowJo software (Tree Star).

ELISA

Immunlon plates (Thermo Labsystems) were coated with 10 µg/ml NP24BSA or NP2BSA (Biosearch Technologies) overnight at 4°C. The plates were washed with 0.05% Tween 20 in PBS (PBS-Tween20) and blocked for 1 h at 37°C with blocking buffer consisting of 1% BSA in PBS-Tween 20. All subsequent incubations were at 37°C for 1 h. Sera were diluted in blocking buffer, added to the NP-BSA-coated plates, and incubated for 1 h. Unbound Abs were removed by washing and bound Abs were detected using anti-mouse IgM-HRP or anti-mouse IgG1-HRP. For allele-specific ELISA, NP-reactive IgG1 Abs that were produced by WT B cells were detected by anti-IgG1b-biotin, while NP-reactive IgG1 Abs produced by B1-8 B cells were detected with anti-IgG1a-biotin followed by streptavidin-HRP. Unbound Abs were removed by washing and ABTS (Roche Applied Sciences) substrate was added. The reaction product was detected at OD405. Serial dilutions of mouse sera were performed to determine the working dilutions and dilutions that produced OD that were within the linear range for the assay were used. In the indicated experiments, the concentrations of Abs in mouse sera were normalized as follows. ELISA plates were coated with polyclonal goat anti-mouse IgM or IgG followed by incubation with mouse IgM or IgG subclass isotype control Abs. Secondary HRP-conjugated detection Abs were added as described above. The concentrations of the standard Abs were converted into arbitrary units. The Ab concentrations in experimental samples were similarly converted to arbitrary units based on the dilutions that yielded OD measurements in the linear range.

ELISPOT

MAHA (Millipore) plates were coated overnight at 4°C with 10 µg/ml NP24BSA or NP2BSA, then washed, and incubated for 1 h at 37°C with blocking buffer. BM cells were harvested and suspended in RPMI 1640 supplemented with 10% FBS. Cells were added to each well at the concentrations described in the text and cultured for 12 h at 37°C in a humidified chamber under 5% CO2. All subsequent blocking, washing, and incubation with primary and secondary Abs were performed as described for ELISA. Bound anti-mouse HRP-conjugated Abs were detected with 3-amino-9-ethylcarbazole (Moss). Spots were systematically counted using the CTL ImmunoSpot Reader and analyzed with ImmunoSpot software (Cellular Technologies).

Lymphocyte adoptive transfer

For adoptive transfer experiments, the B1-8i+/– mice were crossed with Ig{kappa}–/– and CD45.1 mice, also on the C57BL/6 background. Recipient C57BL/6 mice were prepared for adoptive transfer by exposure to 500 rad from a cesium source. Two days after irradiation, the recipients were infused i.v. with a mixture of 1 x 108 spleen cells from C57BL/6 mice and either 104 or 106 purified B cells from either C57BL/6, CD45.1, or B1-8+/– x {kappa}–/– x CD45.1 mice. The purified B cells were prepared by depletion of CD43+ cells with CD43 microbeads followed by magnetic-associated cell sorting with the AutoMACS Separator (Miltenyi Biotec). Two days after adoptive transfer, the mice were immunized i.p. with NP-KLH as described above.

Nucleotide sequencing

Spleen RNA was harvested using a RNeasy kit (Qiagen). All subsequent reagents for purification of RNA and sequencing were purchased from Invitrogen unless stated otherwise. cDNA was prepared using SuperScript III reverse transcriptase. VH186.2 sequences were amplified from {gamma}1 HC transcripts using Pfu50 polymerase and two rounds of PCR with the following nested primer pairs: VH186.2 forward, 5'gatggagctgtatcatgctcttcttggcag3' and IgG1 reverse, 5'gctgctcagagtgtagaggtcagactgc-3'; VH186.2 forward nest, 5'atcgatttggcagcaacagctacagg3', and IgG1 reverse nest, 5'ccggcctcaccatggagttagtttgg3'. The amplified products were purified using the ImmunPure PCR cleanup kit, cloned into the PCR-Blunt II TOPO vector using the Zero-Blunt TOPO cloning kit, and transformed into DH5{alpha}-competent cells. Kanamycin-resistant colonies were picked and plasmids were purified with the Wizard SV 96 plasmid purification system (Promega). Sequence analysis was performed at the Genomics Core Facility of the Howell and Elizabeth Heflin Center for Human Genetics of the University of Alabama at Birmingham using the BigDye Terminator Version 3.1 Cycle Sequencing Ready Reaction Kit (catalog no. 4336919) and an Applied Biosystems 3730 Capillary Sequencer. All sequences were analyzed using the Vector NTI Advance Software (Invitrogen).

Statistical analysis

All ELISA and ELISPOT data were analyzed by performing a one-tailed t test assuming unequal variance. Significance was defined as p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NP-reactive B cells in B1-8i+/– mice participate in the GC reaction

To identify how frequently mature NP-reactive B cells are found in the peripheral lymphoid tissues of the B1-8i+/– mouse strain, we analyzed spleen lymphocytes for NP binding by flow cytometry. In B1-8i+/– mice, B cells that bind NP represent >1.5% of splenic lymphocytes (Fig. 1a). The specificity of binding with NP-allophycocyanin was demonstrated by preincubating spleen cells with 15 ng/ml NP24BSA. This completely blocked subsequent binding of NP-allophycocyanin, whereas preincubation with BSA alone did not. Approximately 5% of murine B cells express {lambda}-LC, with approximately one-half of these expressing {lambda}1. This correlates with the observed 2.5% of NP-binding splenic B cells in naive mice (Fig. 1b, right panel). In contrast, NP binding is undetectable in naive C57BL/6 splenic B cells (Fig. 1b, left panel). The fact that NP-reactive B cells were present in substantial numbers in B1-8i+/– mice permitted the detection of Ag-induced changes in B cell localization in the spleen. Following immunization with NP-KLH plus alum, NP-reactive B cells which were initially distributed evenly in the B cell zones of the spleen relocalized to form foci at the T cell-B cell interface (Fig. 2a) and subsequently entered into GC reactions (Fig. 2c) in a fashion similar to previous reports (12). These changes in distribution of the NP-reactive cells were Ag specific since no changes in the distribution of NP-reactive cells were detected when B1-8i+/– mice were immunized with KLH plus alum alone (Fig. 2b, right panels).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 1. Enrichment of NP-specific B cells in B1-8i+/– knock-in mice. Spleen cells were harvested from naive C57BL/6 (WT) and B1-8i+/– mice. NP-reactive cells were detected with allophycocyanin-conjugated NP. a, Top, 1.6% of splenic lymphocytes from B1-8i+/– mice demonstrated binding to NP-allophycocyanin. The numbers of NP-binding cells in naive C57BL/6 mice were below the levels of detection. Preincubation of cells from B1-8i+/– mice with 15 ng of NP24BSA completely blocked the binding of NP-allophycocyanin (bottom right). b, Naive B220+ lymphocytes from C57BL/6 and B1-8i+/– mice. NP-specific B cells were below the level of detection by FACS in WT mice and enriched to 2.5% of the B220+ gate in B1–8i+/– mice. More than 90% of B cells expressed the B1-8 HC transgene (IgMa), and <10% expressed endogenous HC genes (IgMb). All NP-binding B cells express the B1-8 HC transgene.

 

Figure 2
View larger version (59K):
[in this window]
[in a new window]

 
FIGURE 2. B1-8 NP-binding B cells redistribute to the B cell-T cell interface and enter GC in response to immunization with NP-KLH. a, C57BL/6 and B1-8i+/– mice were immunized with NP-KLH plus alum and sacrificed at the indicated times. The location of NP-specific B cells was demonstrated by binding of biotinylated NIP followed by counterstaining with the streptavidin-HRP Alexa Fluor 350 Tyramide Signal Amplification System. b, Specificity of the anti-NP response. Serial sections prepared from spleens of naive B1-8i+/– mice were preincubated with BSA or NP24BSA before incubation with biotinylated NIP (left panels). NIP binding was blocked by preincubation with NP24BSA. B1-8i+/– mice were immunized with nonhaptenated KLH plus alum and spleens were harvested on days 3, 5, and 10, and NIP-binding cells were identified by incubation of sections with biotinylated NIP (right panels). NIP-binding cells showed minimal relocalization following immunization with KLH. NIP-binding cells were detected as in a. c, Ten days after immunization, GC in both WT and B1-8i+/– mice contained predominately {lambda}-LC+ cells.

 
Affinity maturation is impaired in B1-8i+/– mice

To address how the presence of increased numbers of NP-specific B cells affected the serum Ab response, we measured this response in immunized B1-8i+/– and C57BL/6 mice using an ELISA. During the primary response to NP-KLH, a 4–8-fold induction of NP-specific IgM was measured in B1-8i+/– serum. The response peaked 21 days postimmunization (Fig. 3a). C57BL/6 mice responded similarly; however, the response peaked at 7 days postimmunization. Thereafter, the serum IgM titers declined. In the secondary response, the serum anti-NP IgM response in WT littermates was indistinguishable from the primary response. In contrast, in B1-8i+/– mice, the secondary response resulted in IgM levels that were increased 20-fold above baseline levels.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
FIGURE 3. Affinity maturation is suppressed in B1-8i+/– mice. Mice were immunized i.p. with NP-KLH plus alum on day 0 and boosted at the time indicated by the arrow. a, Measurement of NP-specific IgM by ELISA indicates the anti-NP IgM response is elevated in B1-8i+/– mice. b, Induction of isotype class switching and the anti-NP IgG1 response occur to similar levels in B1-8i+/– mice compared with WT mice. c, The high-affinity anti-NP IgG1 response was severely reduced in B1-8i+/– mice. n represents the number of mice in each experimental group. The experiment was repeated three times with similar results. Error bars represent SEM.

 
Previous reports have established techniques to use steady-state ELISAs with differentially haptenated target Ags to estimate the relative affinities of NP-reactive IgGs (15, 16, 17, 18). Using this approach, we detected total NP-reactive IgG1 Abs using ELISA plates that were coated with NP24BSA. In contrast, by using plates that were coated with the same concentration of BSA carrying only two NP residues for every BSA (NP2BSA), we detected IgG1s with only relatively high affinities for the hapten. It should be indicated clearly that this technique actually detects the average avidity of the Ab for the hapten Ag; however, in the case of bivalent IgG Abs, this measurement closely estimates affinity (16). Using this strategy, NP2BSA efficiently captures Abs that bind with either high avidity or high affinity. Abs with low avidity or low affinity manifest higher off rates from NP2BSA than from NP24BSA and are not detected using the sparsely haptenated target Ag (15, 17).

The serum anti-NP IgG1 titer of B1-8i+/– mice was similar to that of WT littermates (Fig. 3b). Serum anti-NP IgG2b, IgG2c, and IgG3 were also similar between the two strains (data not shown). These data were consistent with previous reports that demonstrated that the increase in NP-specific B cells in B1-8i mice does not correlate directly with the levels of serum anti-NP IgGs (19). Interestingly, after a booster immunization, B1-8i+/– mice produced 4-fold less high-affinity anti-NP IgG1 Ab than C57BL/6 mice (Fig. 3c). This defect in affinity maturation persisted even after secondary and tertiary booster immunizations (data not shown).

High B cell clonal abundance interferes with affinity maturation

Immunization of B1-8i+/– mice with NP-KLH resulted in the redistribution of NP-reactive cells in a fashion that was similar to that described previously for adoptively transferred Ag-specific B cells in the lymph nodes (6) and Ag-specific B cells in the spleen (12). Furthermore, the fact that specific immunization induced the production of NP-reactive IgM and IgG Abs demonstrated that B1-8i+/– mice were capable of responding to a primary and a secondary immunization and that their ability to undergo isotype switching was preserved; however, the dramatic impairment of affinity maturation indicated that there is disturbed regulation of the humoral response in this transgenic model. There is precedent for impaired lymphocyte regulation in mice carrying abundantly expressed Ag receptors. For example, primary immunization of TCR-transgenic mice such as those of the DO11.10 strain leads to abnormally high levels of cell death and thymic involution (20). In our experiments, we have considered that the aberrant affinity maturation may have been due to a B cell intrinsic defect. Alternatively, the abnormal response may not represent an intrinsic B cell impairment, but rather may represent the natural expression of normal immunoregulatory pathways.

A major distinction between B1-8i+/– mice and WT mice is the proportion of recirculating B cells that has specificity for the hapten NP. We hypothesized that the large numbers of NP-specific precursor B cells in the B1-8i+/– mice (Fig. 1) may result in increased competition for limiting signals that were required for affinity maturation of the Ab response to the hapten. It is well established that affinity maturation and isotype switching both require T cell help (13). We considered that the impaired affinity maturation we observed in the B1-8i+/– mice might have been due to a disproportionately smaller TH cell population compared with the large number of NP-specific B cells in this strain. However, when we expanded the available pool of KLH-specific TH cells by priming B1-8i+/– mice with KLH before immunization with NP-KLH, we did not restore affinity maturation (Fig. 4). This indicated that T cell help was not the critical limiting factor for affinity maturation in B1-8i+/– mice when immunized with NP-haptenated carrier proteins.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 4. The induction of a high-affinity Ab response is not restored in B1-8i+/– mice by priming with the T cell Ag. C57BL/6 or B1-8i+/– mice were immunized with 50 µg of KLH precipitated in alum. Three weeks after priming, the mice were reimmunized i.p. with 50 µg of NP-KLH plus alum. Sera were collected 14 days after immunization and serum anti-NP Ab was measured by ELISA. All sera were diluted 1/200. This working concentration was determined to yield measurements within the linear range of the assay for all samples tested. a, Total anti-NP IgG1 titers were similar in WT and B1-8i+/– mice. Despite priming, B1-8i+/– mice showed impaired ability to undergo affinity maturation. b, The ratio of serum high-affinity anti-NP IgG1 to total serum anti-NP IgG1 was reduced in B1-8i+/– mice. Each data point represents one mouse. This experiment was repeated three times with similar results.

 
To test whether the frequency of Ag-specific B cells affects affinity maturation, we used adoptive transfer of different numbers of B1-8i+/– B cells into naive C57BL/6 mice to regulate the starting numbers of NP-reactive cells (Fig. 5ai). Spleen cells (1 x 108) from C57BL/6 mice and varying numbers of either CD43-depleted CD45.1+ B cells from WT-congenic donors or CD43-depleted B1-8i+/–{kappa}–/– CD45.1+ B cells were adoptively transferred i.v. into sublethally irradiated recipients. In naive B1-8i+/– mice, ~2.5% of spleen B cells were NP reactive (Fig. 1b). This represents ~1 x 106 NP-specific B cells out of an average of ~5 x 107 total B cells in the adult mouse spleen. Therefore, adoptive transfer of 106 B1-8i+/–{kappa}–/–CD45.1+ B cells into naive irradiated recipient mice produced recipients with NP-specific B cells at a level similar to that detected in the B1-8i+/– mice. In contrast, adoptive transfer of 104 donor B1-8i+/– B cells yielded recipients in which NP-reactive transgenic B cells represented ~0.025% of the total B cell population, a frequency closer to the estimated frequency in WT adult mice.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 5. Attenuation of affinity maturation is a consequence of high clonal abundance in B1-8i+/– mice. a, i, Sera collected 14 days after a booster immunization of mice that had received adoptive transfer of 108 WT spleen lymphocytes with either 106 WT polyclonal B cells (control), 104 (low), or 106 (high) B1-8{kappa}–/–CD45.1+ B cells. NP-specific IgM (ii), and total anti-NP IgG1 (iii) were similar in all experimental groups. iv, Mice that received adoptive transfer of 106 B1-8{kappa}–/–CD45.1 B cells produced a 10-fold lower titer of high-affinity anti-NP IgG1 than control mice, whereas mice that received lower numbers (104 cells/mouse) produced a high-affinity anti-NP IgG1 response. b, i, B1-8 B cells suppressed the WT total anti-NP IgG1 response. ii, Affinity maturation of the WT response was also disrupted in a cell density-dependent manner. iii, B1-8 B cells produced total anti-NP IgG1 in a fashion independent of clonal abundance. iv, Induction of a high-affinity NP-IgG1 response by the B1-8 B cells was observed when B1-8 B cells were transferred at low cell numbers (104/mouse). *, Values of p comparing control mice and mice that received 104 B1-8 B cells; {dagger}, values of p comparing WT mice and mice that received 106 B1-8 B cells. Four mice were used in each experimental group. The adoptive transfer experiment was performed three times with similar results.

 
B1-8i+/– mice responded to immunization with NP-KLH with an ~8-fold higher titer of hapten-specific IgM compared with the titer in WT mice (Fig. 3a). Unlike B1-8i+/– mice, the levels of NP-specific IgM in the sera of mice that received either adoptively transferred WT B cells, 104 B1-8i+/– B cells, or 106 B1-8+/– B cells all were similar following immunization with 50 µg of NP-KLH (Fig. 5aii). The higher levels of serum IgM in immunized WT mice compared with the levels in the mice that received adoptively transferred WT or B1-8i+/– B cells may have been due to the steady input of naive B1-8i+/– B cells that occurs in an ongoing fashion in the B1-8i+/– mouse strain. The induced levels of total anti-NP serum IgG1 were similar in all groups of mice despite a 100-fold difference in the starting frequencies of B1-8i+/– B cells between the mice that received the low and high numbers of adoptively transferred NP-reactive cells (Fig. 5aiii). This was consistent with the observation that the numbers of NP-specific B cells do not correlate with the titers of NP-specific IgG1 (19) (Fig. 3b). Strikingly, mice that received the high frequency of adoptively transferred NP-specific B cells produced 11-fold less high-affinity anti-NP IgG1 than control mice. In contrast, mice that received the low frequency of adoptively transferred B1-8i+/– B cells produced levels of high-affinity anti-NP IgG1 only 2-fold lower than mice reconstituted with WT B cells (Fig. 5aiv). Together, these data demonstrated that total production of Ag-specific serum Ab was independent of the starting numbers of Ag-specific B cells, but that production of high-affinity Ab was dependent on maintenance of an appropriately low frequency of Ag-specific B cells.

To determine the contributions of the transgenic and the WT B cells to the NP-specific Ab response, we performed allele-specific ELISA. When mice that received adoptive transfer of NP-specific B1-8 B cells were immunized with NP-KLH, the high-affinity anti-NP Ab response from the endogenous WT cells was suppressed in a B1-8 cell number-dependent manner (Fig. 5b, i and ii). The titer of total anti-NP IgG1a was similar regardless of the numbers of B1-8 donor B cells (Fig. 5biii). When B1-8 B cells were present in high numbers, affinity maturation was inhibited (Fig. 5biv). In contrast, affinity maturation was observed when low numbers of B1-8 B cells were transferred. These data established that B1-8 B cells were proficient to undergo affinity maturation when their population density was low. The inverse correlation between the numbers of B1-8 B cells transferred and the amount of anti-NP Ab produced by the WT B cells represent interclonal competition between the functionally monoclonal B1-8 B cells and the diverse WT B cell repertoire. Although the frequency of B1-8 cells did not have a large affect on either the amount of IgM or the total (high affinity plus low affinity) IgG1 produced, affinity maturation was attenuated when the B1-8 B cell frequency was high. These data indicate that the density of the responding cell population does not affect the overall quantity of the Ab response but does significantly alter the quality of the serum Ab.

Clonal selection is modulated by the density of the responding B cell population

To investigate whether the defect in affinity maturation observed in the B1-8i+/– mice was due to aberrant SHM, we sequenced the VH186.2-{gamma}1 transcripts from immunized C57BL/6 and B1-8i+/– mice. Affinity maturation was tracked by the accumulation of the affinity-determining tryptophan to leucine mutation at codon 33 (W33L) in the sequence of individual clones. This single point mutation of the germline W to L results in a 10-fold increase in affinity of the Ab for NP (21). Seventy to 80% of unique VH186.2-{gamma}1 transcripts amplified from spleens of immunized C57BL/6 mice contained the high-affinity W33L mutation in contrast to 50% of transcripts from B1-8i+/– spleens. Furthermore, the ratio of replacement:silent (R:S) mutations in the CDR1 and CDR2 from C57BL/6 mice was 3.2 vs 1.5 from B1-8i+/– mice. These data indicate that selection of high-affinity Ab-expressing B cells is impaired in immunized B1-8i+/– mice.

VH186.2-{gamma}1 sequences were also analyzed in the adoptive transfer model. During the generation of the B1-8i+/– strain, a silent T to C mutation was engineered into the HC cryptic recombination signal sequence at nt 292 to prevent VH gene replacement (14). This mutation and the DFL16.1-JH2 rearrangement distinguished the B1-8 sequences from the nontransgenic sequences. For mice carrying only WT HC genes, the mean percentage of unique sequences carrying the W33L mutation was 58%, (35–77%; Table I). Sixty-two percent of sequences from B1-8 B cells in the mice that received adoptive transfer of 104 B1-8 B cells carried the W33L mutation, ranging from 43 to 76%. In contrast, mice that received adoptive transfer of 106 B1-8 B cells manifested a lower distribution of clones carrying the high-affinity mutation (22–58%, with a mean of 41%). Although the accumulation of point mutations was only modestly reduced (data not shown), these data suggest that when there are abnormally high numbers of B cells with the same antigenic specificity, the frequency of transcripts that accumulate mutations resulting in a high-affinity Ab product is reduced. Interestingly, similar to C57BL/6 mice, the mean R:S ratios of mutations in the HC were 2.2 and 2.5, respectively, for the control mice and the mice that received adoptive transfer of the low frequency of B1-8 B cells, indicating a strong selection for replacement mutation within the CDRs. The mean R:S ratio in mice that received the high frequency of B1-8 B cells was 1.4, confirming in the adoptive transfer system that reduced selection is observed when the frequency of clonally related B cells is high.


View this table:
[in this window]
[in a new window]

 
Table I. Summary of VH186.2-{gamma}1 Sequences

 
Intraclonal competition suppresses formation of high-affinity ASC

Analysis of the serum Abs produced after immunization indicated that production of high-affinity anti-NP IgG1 was dramatically reduced in B1-8i+/– mice and mice that received 106 B1-8 B cells. In contrast, DNA sequencing indicated that approximately one-half of the VH186.2-{gamma}1 transcripts amplified from spleens of these mice were from cells that potentially could produce high-affinity Ab because the included the high-affinity encoding W33L mutation. Because each of the sequences analyzed displayed a unique nucleotide sequence, the possibility that the discrepancy between the measurements of hapten-binding avidity and the presence of the high-affinity-determining codon 33 mutation might be due to the PCR artifact representing contamination of the samples with plasmid DNA is very unlikely. A more likely alternative explanation for the discrepancy between the sequence data and the ELISA data is that the sequenced transcripts were from a pool of total spleen cells, representing the entire expressed VH186.2-{gamma}1 repertoire including transcripts for secreted Ab from ASC and membrane-bound Ab from memory or activated B cells. In contrast, the serum Abs measured by ELISA derive from cells driven to produce secreted Ab.

To determine whether cells in the B1-8i+/– mice were competent to produce NP-specific Abs, particularly high-affinity Abs, we used ELISPOT assays to identify high-affinity and total anti-NP IgG1-producing cells in BM of immunized mice. There were 3-fold greater numbers of high-affinity IgG1 ASC in BM of C57BL/6 mice compared with BM of B1-8i+/– mice (Fig. 6a). Interestingly, when WT mice were sublethally irradiated and reconstituted with WT splenocytes plus 106 B1-8 B cells, then immunized, the numbers of high-affinity anti-NP IgG1 ASC in BM were also reduced (Fig. 6, b and c). In contrast, reconstitution of mice with WT splenocytes plus 104 B1-8 B cells before immunization showed a near normal high-affinity ASC response. This suggested that the transcripts carrying the high-affinity-determining W33L mutation that we observed in the immunized B1-8i+/– mice and in WT mice that had received 106 adoptively transferred B1-8 B cells were unlikely to contribute to the long-lived ASC pool and circulating Ab.


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 6. The ASC repertoire is largely limited to low-affinity Ab when B1-8 B cells are abundant. a, ELISPOT assays were performed using C57BL/6 or B1-8 BM to test for the presence of long-lived ASC. a, B1-8i+/– mice produced ~4-fold more NP-specific IgM-secreting cells than WT mice, 1.8-fold less total NP-specific IgG1 ASC, and ~3-fold less high-affinity NP-specific IgG1 ASC. b and c, BM from mice adoptively transferred with WT B cells or B1-8 B cells. b, The frequency of long-lived total NP IgG1 ASC is not affected by B1-8 population density. c, B1-8 B cells from mice adoptively transferred with the high frequency of B cells do not produce high-affinity IgG1 ASC. Each data point represents one mouse. The experiment was repeated three times with similar results.

 
Under normal conditions, the pool of long-lived ASC elicited in response to a systemic infection resides primarily in the BM and is composed largely of high-affinity ASC while the pool of memory B cells in the BM is thought to be composed of a mixture of high and low or primarily low-affinity cells (22). Our observation that the numbers of high-affinity ASC are reduced in the BM of B1-8i+/– mice indicated that the mechanisms governing ASC and/or memory B cell development are disrupted in these animals. To address whether the effector ASC and memory B cell populations are altered when B cells are subjected to intraclonal competition, we examined BM from control mice and from mice that had received adoptive transfer of either 104 or 106 B1-8 B cells before primary and booster immunization. Long-lived intracellular IgG+CD138+ ASC make up 1.7% of the CD43+ fraction in WT mice compared with 2.1% in mice that received the low numbers of adoptively transferred cells. Although there was an increase in the numbers of CD138high ASC in the mice that received 106 adoptively transferred cells, the percentage of long-lived ASC in these animals was significantly reduced compared with that in WT mice and mice that had received 104 adoptively transferred cells (Fig. 7a).


Figure 7
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 7. The formation of long-lived ASC is suppressed when B1-8 B cells are overrepresented. BM cells were recovered from adoptive transfer mice 14 days after the booster immunization. a, CD43+ MACS-sorted cells from control mice or from mice that received 104 cells or 106 cells were stained for CD138 and intracellular IgG1 to detect IgG1 ASC. b, CD43 BM cells were gated for NP binding and intracellular IgG1 staining (top) and analyzed for B220 (left), CD22 and CD38 (center) and MHC II expression (right). Numbers to the left indicate the percentage of IgG1+ NP binding in CD43 cell fractions. Numbers inside the gates indicate the percentage of gated cells that are B220low/– (red) and B220high (green). B220low/– plasma and B cell blasts (red) down-regulate expression of CD22. B220high (green) up-regulate CD38 and CD22 expression (center). Control mice (gray histogram) and mice transferred with 104 B1-8 B cells (red) expressed equal levels of MHC II while IgG1+ NP-binding cells from mice transferred with 106 B1-8 B cells (blue dashes) up-regulate expression of MHC II.

 
We have demonstrated that the development of long-lived ASC can be influenced and the numbers of ASC can be suppressed when unusually high numbers of Ag-specific B cells are present. Previous studies from Marzo et al. (23) have established that following immunization, large numbers of clonally restricted, Ag-specific CD8 T cells revert from an effector memory CD8+ T cell phenotype into a central memory CD8+ T cell phenotype. We hypothesize that the large numbers of NP-specific B cells present in the B1-8i+/– strain in similar fashion may be impaired for differentiation into the high-affinity long-lived ASC compartment. This impairment may not be restricted to the long-lived ASC compartment alone, but may be observed in the memory compartment as well. By definition, memory B cells have previously encountered Ag and most have class switched. Functionally, memory B cells are thought to be more potent APC compared with naive B cells. Following Ag restimulation, they up-regulate expression of MHC II molecules and other activation molecules more rapidly than naive cells. In the CD43 cell population, IgG1+NP-binding cells from both WT mice and mice that had received 104 B1-8 B cells were found to express surface MHC II at similar levels. In contrast, IgG1+NP-binding cells from mice that had received 106 adoptively transferred B1-8 B cells showed substantially up-regulated expression of class II MHC (Fig. 7b). IgG1+ low NP-binding cells were predominately B220low/–. This population consisted of a mixture of low-affinity ASC and B cell blasts. The IgG1+/high NP-binding population expressed high levels of B220 and was composed of high-affinity, activated, and memory B cells that were CD38highCD22int/high. Although mice that received adoptive transfer of 106 B1-8 B cells had reduced numbers of B cell blasts and ASC, these mice did show enrichment of the high-affinity B220highCD38highCD22int/high activated and memory phenotype B cells (Fig. 7b).

High Ag dose restores affinity maturation in B1-8i+/– mice

The process of affinity maturation of the Ab response requires delivery of a combination of BCR-dependent signals that activate Ag-specific B cells along with T cell-dependent signals that provide B cell help. Since our initial studies showed that preactivation of carrier-specific TH cells by priming with the carrier protein failed to restore affinity maturation, we suspected that T cell help, per se, was not limiting for the affinity maturation response. We therefore tested whether Ag-dependent signals were limiting by immunizing mice with an increased dose of the Ag (150 µg of NP-KLH, rather than the 50-µg dose used originally). Although the titer of total NP-specific IgG1 remained unchanged in WT and B1-8i+/– mice, immunization with the higher Ag dose induced high titers of high-affinity NP-specific IgG1 in the B1-8i+/– mice (Fig. 8).


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 8. Additional immunizing Ag restores affinity maturation in B1-8i+/– mice. C57BL/6 mice and B1-8i+/– mice were immunized with the indicated dose of Ag precipitated with a constant amount of alum and boosted 25 days after the initial immunization. Sera were collected and analyzed for high-affinity anti-NP IgG1 at the designated time points. a, Induction of total anti-NP IgG1 was similar in all mice irrespective of Ag dose. b, Induction of high- affinity Ab was restored in B1-8i+/– mice immunized with 150 µg of NP-KLH plus alum. The experiment was repeated three times with similar results.

 
To test whether immunization with high-dose Ag restored the production of high-affinity Abs in the adoptive transfer model, we analyzed mice that received 106 WT B cells or 106 B1-8 x{kappa}–/– B cells by adoptive transfer before immunization with either 50 µg or 150 µg of NP-KLH plus alum. Mice treated in this fashion accumulated similar levels of total serum anti-NP IgG1 when immunized and boosted with either the low or the high dose of Ag (Fig. 9a, {blacksquare}). In contrast, raising the dose of immunizing Ag from 50 µg to 150 µg increased the high-affinity IgG1 response nearly 3-fold (Fig. 9a, {square}). To determine whether the B1-8 B cells contributed to the high-affinity Ab production, we performed allele-specific ELISA. As previously shown, when B1-8 B cells are present at high cell density (following adoptive transfer of 106 cells), immunization with 50 µg of NP-KLH plus alum resulted in suppression of the production of high-affinity Ab (Fig. 5biv) and also suppression of the generation of high-affinity ASC (Fig. 6c). Although the B1-8 B cells produced detectable high-affinity NP-reactive IgG1a (Fig. 9b, {square}) when mice were immunized with 50 µg of NP-KLH, this represented only 30% of the total NP-reactive Ab present in the blood. In contrast, when mice that had received adoptive transfer of 106 B1-8 B cells were immunized with 150 µg of NP-KLH, a robust affinity-matured Ab response was observed (Fig. 9b, {square}). Thus, in the adoptive transfer model, as well as in the B1-8i+/– mouse strain itself, immunization with a high dose of Ag restored the high-affinity Ab response.


Figure 9
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 9. Immunization with an increased dose of Ag induces the production of high-affinity Ab in mice that received adoptive transfer of high numbers of B1-8 B cells. C57BL/6 mice were conditioned by adoptive transfer of either 106 WT or 106 B1-8 B cells, then were immunized with either 50 µg or 150 µg of NP-KLH plus alum and boosted 25 days after the primary immunization. a, Sera were collected on day 35 and analyzed for either total ({blacksquare}) or high-affinity ({square}) NP-reactive IgG1 by ELISA. b, Total ({blacksquare}) and high-affinity ({square}) anti-NP IgG1a Abs derived from the adoptively transferred B1-8 cells were measured by ELISA. Data represent the means of two independent experiments with three mice per group in each experiment. Error bars represent SEM.

 
These data have identified Ag-dependent signaling as a key resource that B cells compete for in the induction of a high-affinity Ab response. When the numbers of naive, clonally related, Ag-specific cells are high and when the relative amount of the Ag is limited, then affinity maturation is attenuated. This is in sharp contrast to the situation in mice with a diverse polyclonal B cell repertoire in which cells compete for limiting Ag and clones with high-affinity BCRs expand.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The normal T cell-dependent humoral immune response is characterized by activation of Ag-specific B cells and T cells, expansion of the pool of responding B cells to permit production of substantial amounts of circulating Abs, switching to isotypes appropriate for elimination of the immunizing Ag, and affinity maturation to permit the immune response to eliminate the Ag even as its concentration becomes very limited. In our current study, we have observed in the B1-8i+/– Ig HC-transgenic mouse strain that affinity maturation is impaired when the number of Ag-specific naive B cells is inappropriately large. We saw no evidence of failure to activate the SHM process. Rather, we observed that there was failure to select high-affinity B cell variants as a likely cause of the impaired generation of high-affinity ASC. This impairment of affinity maturation in the B1-8i+/– mice was not a B cell intrinsic defect. Affinity maturation could be reestablished either by reducing the number of Ag-specific naive B cells by adoptive transfer into a nontransgenic host or by immunizing with an increased amount of Ag.

In addition to having large numbers of B cells that are poised to respond to immunization with NP-haptenated Ag, the B1-8i+/– strain differs from WT mice in that it has elevated levels of circulating NP-binding serum Abs that are present before deliberate immunization with NP-haptenated Ag (data not shown). We have considered that the elevated levels of anti-NP IgM in naive B1-8i+/– mice might affect the quality of the Ab response following immunization. Previous studies have demonstrated that infusion of Ag-specific Ab into naive mice can alter the quality of the humoral response following systemic immunization. Several studies (24, 25, 26) found that injection of Ag-specific IgM before immunization enhanced the endogenous Ab response to subsequent immunization. This enhancement of the humoral response was dependent on the formation of immune complexes by the passively transferred IgM (27). Arguing against a role for elevated levels of anti-NP IgM in the attenuated affinity maturation in the B1-8i+/– mice is our observation that affinity maturation was attenuated both in B1-8i+/– mice and in WT mice that received adoptive transfer of 106 B1-8 B cells (Fig. 5). Before immunization, the mice that received adoptive transfer of B1-8 B cells had levels of anti-NP IgM and IgG equivalent to the levels observed in naive WT mice that are competent to exhibit normal levels of affinity maturation.

Studies by Freitas et al. (28) showed that when WT mice were reconstituted with a mixture of WT and BCR-transgenic BM, the initial growth curves of WT and transgenic B cells were similar. Once steady state was reached, the WT B cells became the predominant population (28). The B cell population could be shifted toward greater representation of the transgenic B cells if the mice were immunized with the Ag specific to the transgenic BCR (29). In other experiments, mice with conditional ablation of surface Ig had diminishing numbers of peripheral B cells, indicating that BCR signaling is necessary for B cell survival in the periphery (30).

In our adoptive B cell transfer experiments, we anticipated that irradiation of the recipient mice created niches that support the engraftment of all donor cells equivalently, irrespective of their clonal specificity (Ref. 28 and T. L. Le, unpublished data). Furthermore, we anticipated that immunization with NP-haptenated carrier proteins should favor selection of the NP-specific transgenic cells over the WT donor cell population. Our data indicate that when the numbers of cells from an individual B cell clone are high, this leads to failure to select cells carrying somatically mutated high-affinity Ig HC. Our data support the concept that interclonal competition selected for the NP-specific B1-8 B cells over the predominately Ag-nonspecific WT polyclonal B cells. Competition for limited resources was high because of the large representation of NP-specific B1-8 B cells in the total B cell pool.

Cells compete for limiting resources that are needed for growth or survival, including cytokines, mitogens, or local cellular niches such as the GC. In our studies, increasing the dose of immunizing Ag was able to restore affinity maturation in B1-8i+/– mice in a fashion similar to reducing the B1-8 B cell clonal abundance by adoptive transfer into WT mice. Batista et al. (7) have demonstrated that B cells are capable of acquiring membrane-bound Ag, internalizing the Ag, and subsequently presenting the processed Ag to TH cells. This ability to acquire membrane-bound Ag displayed on target cells provides a possible mechanism for affinity-based selection of B cells. When B1-8 B cells or NP-specific B cells are rare and infrequent, the cells are able to test their affinity and undergo affinity-based selection efficiently. B cells with low affinity have the potential to interact with the membrane-bound Ag, but are at a disadvantage and unable to acquire and internalize the Ag as efficiently as high-affinity cells. These cells likely receive very low-level stimulation, are negatively selected in the GC, and undergo apoptosis if the Ab is nonspecific or autoreactive. However, when B1-8 B cells are abundant, a fraction of the cells may capture and internalize the Ag, preventing the remaining B1-8 B cells from contacting the now more limited amounts of Ag. Thus, in the setting of high numbers of Ag-specific cells, the acquisition of Ag by a minority population of cells may create an environment in which the majority of cells (which have not encountered the Ag) are at a selective disadvantage, resulting in an overall reduced high-affinity response.

B cell activation requires BCR cross-linking. This process is enhanced when the antigenic particle is displayed at high density. Immunization with virus-like particles (VLP) that displayed low, medium, or high densities of an antigenic peptide induced similar IgM responses to the peptide and was not dependent on epitope density. Alternatively, the IgG response to the peptide was severely reduced when VLP with low-density peptide were used to immunize mice. Antipeptide IgG was induced only when high-density peptide VLP were used to immunize mice (31). This indicated that the induction of an IgG response requires multiple Ag-capturing events and cross-linking of the BCR. Increasing the numbers of Ag-specific B cells skews the ratio of B cell:Ag, which can result in insufficient activation or selection via the reduction of cross-linking events. The lack of Ag-based selection may result in a loss of apoptotic signals, further altering the balance of high-affinity and low-affinity B cells and the pathway to memory or ASC differentiation. Mice that are reimmunized with Ag shortly after the primary immunization have increased numbers of apoptotic bodies within the GC (32). This observation is in keeping with our finding that increasing the amount of Ag can rescue affinity maturation by enhancing Ag-dependent selection in the GC. Our data show that isotype switching can occur in the context of failed selection for production of high-affinity Abs. Specifically, we find that high intraclonal competition results in failure of somatically mutated cells to progress to ASC. Our observation that immunization with increased amounts of Ag can restore affinity maturation suggests that this intraclonal competition is based at least in part on Ag being a limiting resource for the subsequent selection of high-affinity B cell clones to generate high-affinity ASC when B1-8 B cells are present in large numbers.

When the VH186.2 sequences of IgG1 transcripts were compared between NP-KLH-immunized and boosted control mice and mice that received 106 B1-8 B cells, we observed that there were small numbers of unique sequences and a high frequency of sequences that were identical in the mice that received transgenic B cells (Table I). These data suggested that although B cell activation and class switching occurred, the repertoire of VH gene diversity generated by SHM was very limited. It is formally possible that recovery of a large number of identical sequences was the result of selective PCR amplification of a limited subset of the expressed VH sequences; however, because recovery of large numbers of identical sequences was restricted to mice that received adoptive transfer of large numbers of B1-8 B cells and because the amplified transcripts were from B cells that were activated and class switched, we conclude, rather, that recovery of multiple identical HC sequences was the result of there being a limited number of mutations in the VH genes of the pool of activated B cells. This indicated that in the setting of high intraclonal competition there was reduced efficiency of SHM. This was in the context of the total level of NP-specific serum IgG being similar in the B1-8i+/– mice and the WT mice, as were the numbers of total NP-specific IgG-producing ASC. Although CSR and SHM are mechanistically linked by activation-induced cytidine deaminase (33), studies from the laboratories of Honjo and colleagues (34) and Nussenzweig and colleagues (35) have independently demonstrated that these processes can occur separately. Our data further underscore the fact that CSR and affinity SHM are not obligately linked.

The mechanisms governing the formation of the memory and long-lived ASC compartments remain controversial. The stochastic model suggests that BCR-independent signals such as IL-4 and IL-5 drive ASC differentiation (36). In contrast, studies comparing GC B cells with high-affinity BCR to cells with low-affinity BCR demonstrated that high-affinity cells expressed Blimp-1, whereas low-affinity cells did not (37). Also, analysis of VH gene sequences supported the hypothesis that the memory B cell pool expresses relatively low-affinity BCR while the ASC compartment in the BM produces Ab with relatively high affinity (22). These data support a differential signaling model for determination of memory cell and ASC formation.

In the setting of high intraclonal competition, we found that the numbers of high-affinity ASC were reduced and a large fraction of the high NP-binding B220+ cells displayed a memory cell-like phenotype with enhanced expression of CD22 and MHC II. The relative frequency of these NP-specific memory-like cells compared with ASC in immunized B1-8i+/– mice exceeded that in immunized WT mice and also in immunized mice that were recipients of 104 adoptively transferred NP-binding B1-8 B cells. Additional studies will determine whether these phenotypically memory-like cells express functional memory. Nonetheless, the data indicate that a low Ag-specific precursor B cell population is optimal for establishment of a high-affinity Ab response. The reduction of high-affinity ASC correlates with a shift toward generation of memory-like B cells albeit with a reduction in the numbers of total NP ASC and memory cells. Together, these data indicate that there were insufficient signals or growth factors to support the development of high-affinity ASC. These signals most likely originate from cells that reside within the GC structure.

Our data demonstrate clearly that the normal differentiation pathway that guides isotype-switched B cells through the process of SHM, selection of high-affinity variants, and progression either to ASC formation or B memory cell formation is dependent on maintaining limited intraclonal competition. Our studies have been facilitated by the well-characterized B1-8i+/– BCR-transgenic mouse strain (14) in which the precursor frequency of naive B cells specific for the small hapten NP can be manipulated over a broad range. The extent to which the mechanisms identified here will dramatically impact the humoral responses to complex, multi-epitope protein Ags remains to be tested. With this caveat in mind, our data highlight the need to be aware of the stoichiometry under which B cells are activated in vivo. Furthermore, our data establish the presence of previously unrecognized control points that govern important B cell differentiation processes that follow class switching, leading to the expression of an affinity-selected Ab response.


    Acknowledgments
 
We thank E. Lefkowitz for helpful discussions regarding analysis of somatic mutation and clonal selection, K. Rajewsky for permitting access to the B1-8i+/– mouse strain, and C. Zindl, M. Cooper, P. Burrows, R. Carter, J. Kearney, and C. T. Weaver for helpful discussions and for critique of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institute of Allergy and Infectious Diseases—National Institutes of Health Training Grant T32 AI007493 (to T.L.L.). Back

2 Current address: Department of Microbiology & Immunology, Emory University School of Medicine, 1510 Clifton Road, Atlanta, GA 30322. Back

3 Address correspondence and reprint requests to Dr. David D. Chaplin, Department of Microbiology, University of Alabama at Birmingham, 845 19th Street South, Birmingham, AL 35294. E-mail address: dchaplin{at}uab.edu Back

4 Abbreviations used in this paper: SHM, somatic hypermutation; ASC, Ab-secreting cells; BM, bone marrow; HC, H chain; KLH, keyhole limpet hemocyanin; LC, L chain; NP, (4-hydroxy-3-nitrophenyl)acetyl; CSR, class switch recombination; GC, germinal center; WT, wild type; MHC II, MHC class II; NIP, 4-hydroxy-3-iodo-5-nitrophenyl acetyl; R:S, replacement: silent; VLP, virus-like particle. Back

Received for publication October 10, 2007. Accepted for publication August 1, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Nossal, G. J., J. Lederberg. 1958. Antibody production by single cells. Nature 181: 1419-1420. [Medline]
  2. Li, Z., C. J. Woo, M. D. Iglesias-Ussel, D. Ronai, M. D. Scharff. 2004. The generation of antibody diversity through somatic hypermutation and class switch recombination. Genes Dev. 18: 1-11. [Free Full Text]
  3. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245-252. [Medline]
  4. Itano, A. A., M. K. Jenkins. 2003. Antigen presentation to naive CD4 T cells in the lymph node. Nat. Immunol. 4: 733-739. [Medline]
  5. von Andrian, U. H., C. R. Mackay. 2000. T-cell function and migration: two sides of the same coin. N. Engl. J. Med. 343: 1020-1034. [Free Full Text]
  6. Pape, K. A., D. M. Catron, A. A. Itano, M. K. Jenkins. 2007. The humoral immune response is initiated in lymph nodes by B cells that acquire soluble antigen directly in the follicles. Immunity 26: 491-502. [Medline]
  7. Batista, F. D., D. Iber, M. S. Neuberger. 2001. B cells acquire antigen from target cells after synapse formation. Nature 411: 489-494. [Medline]
  8. McHeyzer-Williams, L. J., M. G. McHeyzer-Williams. 2005. Antigen-specific memory B cell development. Annu. Rev. Immunol. 23: 487-513. [Medline]
  9. Jacob, J., G. Kelsoe. 1992. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl: II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J. Exp. Med. 176: 679-687. [Abstract/Free Full Text]
  10. Oliver, A. M., F. Martin, J. F. Kearney. 1999. IgMhighCD21high lymphocytes enriched in the splenic marginal zone generate effector cells more rapidly than the bulk of follicular B cells. J. Immunol. 162: 7198-7207. [Abstract/Free Full Text]
  11. Lanzavecchia, A.. 1985. Antigen-specific interaction between T and B cells. Nature 314: 537-539. [Medline]
  12. Pape, K. A., V. Kouskoff, D. Nemazee, H. L. Tang, J. G. Cyster, L. E. Tze, K. L. Hippen, T. W. Behrens, M. K. Jenkins. 2003. Visualization of the genesis and fate of isotype-switched B cells during a primary immune response. J. Exp. Med. 197: 1677-1687. [Abstract/Free Full Text]
  13. Tarlinton, D.. 2006. B-cell memory: are subsets necessary?. Nat. Rev. Immunol. 6: 785-790. [Medline]
  14. Sonoda, E., Y. Pewzner-Jung, S. Schwers, S. Taki, S. Jung, D. Eilat, K. Rajewsky. 1997. B cell development under the condition of allelic inclusion. Immunity 6: 225-233. [Medline]
  15. Chen, Z., S. B. Koralov, M. Gendelman, M. C. Carroll, G. Kelsoe. 2000. Humoral immune responses in Cr2–/– mice: enhanced affinity maturation but impaired antibody persistence. J. Immunol. 164: 4522-4532. [Abstract/Free Full Text]
  16. Herzenberg, L. A., S. J. Black, T. Tokuhisa, L. A. Herzenberg. 1980. Memory B cells at successive stages of differentiation: affinity maturation and the role of IgD receptors. J. Exp. Med. 151: 1071-1087. [Abstract/Free Full Text]
  17. Shimizu, T., M. Oda, T. Azuma. 2003. Estimation of the relative affinity of B cell receptor by flow cytometry. J. Immunol. Methods 276: 33-44. [Medline]
  18. Smith, K. G., U. Weiss, K. Rajewsky, G. J. Nossal, D. M. Tarlinton. 1994. Bcl-2 increases memory B cell recruitment but does not perturb selection in germinal centers. Immunity 1: 803-813. [Medline]
  19. Shih, T. A., E. Meffre, M. Roederer, M. C. Nussenzweig. 2002. Role of BCR affinity in T cell dependent antibody responses in vivo. Nat. Immunol. 3: 570-575. [Medline]
  20. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlow thymocytes in vivo. Science 250: 1720-1723. [Abstract/Free Full Text]
  21. Allen, D., T. Simon, F. Sablitzky, K. Rajewsky, A. Cumano. 1988. Antibody engineering for the analysis of affinity maturation of an anti-hapten response. EMBO J. 7: 1995-2001. [Medline]
  22. Smith, K. G., A. Light, G. J. Nossal, D. M. Tarlinton. 1997. The extent of affinity maturation differs between the memory and antibody-forming cell compartments in the primary immune response. EMBO J. 16: 2996-3006. [Medline]
  23. Marzo, A. L., K. D. Klonowski, A. Le Bon, P. Borrow, D. F. Tough, L. Lefrancois. 2005. Initial T cell frequency dictates memory CD8+ T cell lineage commitment. Nat. Immunol. 6: 793-799. [Medline]
  24. Harte, P. G., A. Cooke, J. H. Playfair. 1983. Specific monoclonal IgM is a potent adjuvant in murine malaria vaccination. Nature 302: 256-258. [Medline]
  25. Lehner, P., P. Hutchings, P. M. Lydyard, A. Cooke. 1983. II. IgM-mediated enhancement: dependency on antigen dose, T-cell requirement and lack of evidence for an idiotype-related mechanism. Immunology 50: 503-509. [Medline]
  26. Powell, R., P. Hutchings, A. Cooke, P. M. Lydyard. 1982. Antibody mediated regulation of immune responses: I. Enhancement of specific antibody responses through IgM antibodies. Immunol. Lett. 4: 253-258. [Medline]
  27. Morgan, E. L., W. O. Weigle. 1983. Polyclonal activation of murine B lymphocytes by immune complexes. J. Immunol. 130: 1066-1070. [Abstract]
  28. Freitas, A. A., M. M. Rosado, A. C. Viale, A. Grandien. 1995. The role of cellular competition in B cell survival and selection of B cell repertoires. Eur. J. Immunol. 25: 1729-1738. [Medline]
  29. McLean, A. R., M. M. Rosado, F. Agenes, R. Vasconcellos, A. A. Freitas. 1997. Resource competition as a mechanism for B cell homeostasis. Proc. Natl. Acad. Sci. USA 94: 5792-5797. [Abstract/Free Full Text]
  30. Lam, K. P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90: 1073-1083. [Medline]
  31. Jegerlehner, A., T. Storni, G. Lipowsky, M. Schmid, P. Pumpens, M. F. Bachmann. 2002. Regulation of IgG antibody responses by epitope density and CD21-mediated costimulation. Eur. J. Immunol. 32: 3305-3314. [Medline]
  32. Han, S., B. Zheng, J. Dal Porto, G. Kelsoe. 1995. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl: IV. Affinity-dependent, antigen-driven B cell apoptosis in germinal centers as a mechanism for maintaining self-tolerance. J. Exp. Med. 182: 1635-1644. [Abstract/Free Full Text]
  33. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102: 553-563. [Medline]
  34. Ta, V. T., H. Nagaoka, N. Catalan, A. Durandy, A. Fischer, K. Imai, S. Nonoyama, J. Tashiro, M. Ikegawa, S. Ito, et al 2003. AID mutant analyses indicate requirement for class-switch-specific cofactors. Nat. Immunol. 4: 843-848. [Medline]
  35. Barreto, V., B. Reina-San-Martin, A. R. Ramiro, K. M. McBride, M. C. Nussenzweig. 2003. C-terminal deletion of AID uncouples class switch recombination from somatic hypermutation and gene conversion. Mol. Cell 12: 501-508. [Medline]
  36. Hasbold, J., L. M. Corcoran, D. M. Tarlinton, S. G. Tangye, P. D. Hodgkin. 2004. Evidence from the generation of immunoglobulin G-secreting cells that stochastic mechanisms regulate lymphocyte differentiation. Nat. Immunol. 5: 55-63. [Medline]
  37. Phan, T. G., D. Paus, T. D. Chan, M. L. Turner, S. L. Nutt, A. Basten, R. Brink. 2006. High affinity germinal center B cells are actively selected into the plasma cell compartment. J. Exp. Med. 203: 2419-2424. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. V. Misharin, Y. Nagayama, H. A. Aliesky, Y. Mizutori, B. Rapoport, and S. M. McLachlan
Attenuation of Induced Hyperthyroidism in Mice by Pretreatment with Thyrotropin Receptor Protein: Deviation of Thyroid-Stimulating to Nonfunctional Antibodies
Endocrinology, August 1, 2009; 150(8): 3944 - 3952.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le, T.-v. L.
Right arrow Articles by Chaplin, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le, T.-v. L.
Right arrow Articles by Chaplin, D. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS