The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 4685 -4695
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rongvaux, A.
Right arrow Articles by Leo, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rongvaux, A.
Right arrow Articles by Leo, O.

Nicotinamide Phosphoribosyl Transferase/Pre-B Cell Colony-Enhancing Factor/Visfatin Is Required for Lymphocyte Development and Cellular Resistance to Genotoxic Stress1

Anthony Rongvaux2,*, Mara Galli2,*, Sébastien Denanglaire*, Frédéric Van Gool*, Pierre L. Drèze{dagger}, Claude Szpirer{dagger}, Fabrice Bureau{ddagger}, Fabienne Andris* and Oberdan Leo3,*

* Laboratoire de Physiologie Animale and {dagger} Laboratoire de Biologie du Développement, Institut de Biologie et Médecine Moléculaire (IBMM), Université Libre de Bruxelles, Gosselies, Belgium; and {ddagger} Laboratoire de Physiologie, Faculté de Médecine Vétérinaire, Centre de Thérapie Cellulaire et Moléculaire, Université de Liége, Belgium


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Nicotinamide phosphoribosyl transferase (Nampt)/pre-B cell colony-enhancing factor (PBEF)/visfatin is a protein displaying multiple functional properties. Originally described as a cytokine-like protein able to regulate B cell development, apoptosis, and glucose metabolism, this protein also plays an important role in NAD biosynthesis. To gain insight into its physiological role, we have generated a mouse strain expressing a conditional Nampt allele. Lack of Nampt expression strongly affects development of both T and B lymphocytes. Analysis of hemizygous cells and in vitro cell lines expressing distinct levels of Nampt illustrates the critical role of this protein in regulating intracellular NAD levels. Consequently, a clear relationship was found between intracellular Nampt levels and cell death in response to the genotoxic agent MNNG (N-methyl-N'-nitro-N-nitrosoguanidine), confirming that this enzyme represents a key regulator of cell sensitivity to NAD-consuming stress secondary to poly(ADP-ribose) polymerases overactivation. By using mutant forms of this protein and a well-characterized pharmacological inhibitor (FK866), we unequivocally demonstrate that the ability of the Nampt to regulate cell viability during genotoxic stress requires its enzymatic activity. Collectively, these data demonstrate that Nampt participates in cellular resistance to genotoxic/oxidative stress, and it may confer to cells of the immune system the ability to survive during stressful situations such as inflammation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Nicotinamide phosphoribosyl transferase (Nampt)4/pre-B cell colony-enhancing factor (PBEF)/visfatin is a multifunctional, ubiquitously expressed protein with potential immunoregulatory properties. This protein was originally identified as a likely cytokine involved in B cell development and hence designated PBEF (1). Pbef belongs to a group of genes defining an immune "activation signature", being widely expressed within the immune system and positively regulated during in vivo and in vitro immune responses (2). Global gene expression studies have revealed that the expression of this gene is increased in virtually all activated immune cells, including T cells, B cells, monocytes, macrophages, dendritic cells, and neutrophils (3, 4, 5, 6, 7, 8, 9, 10). Extracellular expression of this protein was found to increase under inflammatory conditions, and recombinant forms of PBEF have been shown to exert an antiapoptotic effect on activated neutrophils (11), suggesting a potentially important role for PBEF in immunoregulation. More recently, PBEF has been renamed "visfatin" and described as an adipokine highly expressed by visceral fat (see Ref. 12 for review). Although its mode of action remains controversial (13), soluble visfatin has been found in the serum, a finding that has been interpreted as corroborating its potential role in cell-to-cell communication.

Based on the high similarity between Pbef and the nadV gene of Hemophilius ducrey, we previously demonstrated that PBEF also represents the mammalian Nampt, an enzyme catalyzing the condensation of nicotinamide with phosphoribosyl pyrophosphate, representing the first step in the salvage pathway allowing recycling of nicotinamide to NAD (14, 15). Unlike previous reports, however, Nampt has been found by us and others to be intracellular and not actively secreted, casting some doubts on its potential role as a cytokine (14, 16). Following a series of elegant in vitro and in vivo studies, Imai and colleagues have recently reconciled these two apparently opposing views (17). Based on the analysis of transfected and naturally expressing cells, these authors have suggested that this usually intracellular protein can be actively secreted by selected tissues (such as adipocytes). Both forms of the proteins retain enzymatic activity, leading to the biosynthesis of both intracellular and extracellular nicotinamide mononucleotide, depending on protein location (17).

A growing body of data indicates a possible relationship between NAD metabolism, cell survival, and inflammation, in particular in experimental settings in which cells are exposed to oxidative and/or genotoxic stress (18, 19). Genotoxic damage induced by oxidative stress, ionizing radiations, or alkylating agents activates a series of cellular responses aimed at repairing DNA damage and restoring cellular viability. Poly(ADP-ribosylation) mediated by the abundant nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP-1) represents a well-characterized immediate response to DNA insult. PARP-1 binds to DNA strand breaks and catalyzes the transfer of successive units of the ADP-ribose moiety from NAD to several nuclear proteins, including PARP-1 itself. This posttranslational modification has been shown to facilitate DNA repair and it therefore plays a protective role in response to moderate genotoxic stress (18, 19). However, sustained PARP-1 activation caused by extensive DNA damage promotes a nonapoptotic form of cell death possibly contributing to inflammation (20). In keeping with this conclusion, structurally unrelated pharmacological PARP-1 inhibitors are of remarkable therapeutic efficacy in experimental models of inflammatory-related diseases (21, 22), and PARP-1–/– mice are protected from endotoxic shock (23). Collectively, these findings suggest that excessive PARP activation may promote an inflammatory response by causing excessive cell death.

We previously documented that PBEF/Nampt expression is increased upon lymphocyte activation (14). To directly evaluate the role of Nampt in regulating lymphocyte development and survival during genotoxic stress, we have generated a mouse strain lacking Nampt expression in the T and B cell lineage using mice expressing a conditional allele of Nampt (Nampt-flox) and transgenic mice expressing the Cre recombinase under the control of an hCD2 promoter. We demonstrate herein that in contrast to its putative B cell-specific cytokine role, expression of Nampt is critically required for the development of both T and B lymphocytes. Hemizygote mice displayed reduced levels of intracellular NAD, in keeping with the important and rate-limiting role of Nampt in the biosynthesis of this coenzyme (15). Using a combination of genetic and pharmacological tools, we demonstrate in this work that Nampt regulates cellular sensitivity to genotoxic agents, and that this functional property requires its phosphorybosyltransferase enzymatic activity. Collectively, these data indicate that the nicotinamide salvage pathway represents the main biosynthetic route to NAD in T and B lymphocytes, and that Nampt plays an important role in regulating cell survival in response to stress.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Generation of mice conditionally invalidated for Nampt

A P1 artificial chromosome containing the gene encoding Nampt (see Fig. 1A) was obtained from Geneservice (24). SacI and XhoI libraries were generated from this P1 artificial chromosome. An 8.3-kb SacI fragment was used as a 5' recombination arm. Two contiguous XhoI fragments were used to generate a 10.4-kb 3' recombination arm. The floxed region was amplified by PCR. This fragment encompasses exons 5 and 6 that encode amino acids located in the catalytic site and are required for enzymatic activity. These fragments were assembled into the pFRT-NEO-LOX2 plasmid (T. Van Reeth and C. Szpirer, unpublished) to generate the targeting construct (Fig. 1B). The targeting vector was electroporated into E14 embryonic stem (ES) cells followed by G418 selection. Correctly targeted ES cells were identified by Southern blot after EcoRV restriction of genomic DNA and using a 5' external probe. Several correctly targeted ES cell clones were identified, as shown in Fig. 1, C and F. Chimeric mice were generated using standard protocols (BioVallée). These mice were intercrossed with Rosa-FLP mice to delete the Neo selection marker, generating a floxed allele (Fig. 1D). Positive/floxed mice were then interbred with hCD2-Cre mice to generate Namptflox/flox-Cre, Namptflox/+-Cre, and littermate control mice. Wild-type, floxed, and deleted alleles were identified by PCR using primers P1, TTC CAG GCT ATT CTG TTC CAG; P2, TCT GGC TCT GTG TAC TGC TGA; and P3, CCA ACC CAG ATT TCC AGC TA.


Figure 1
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 1. Generation of mice conditionally invalidated for Nampt. Representation of the Nampt locus (A), targeting vector (B), and targeted allele before (C) and after (D) FLP recombinase-mediated deletion of the Neo selection marker. The mutated allele after Cre-mediated deletion of the floxed exons is shown in E. Restriction sites are E, EcoRV; S, SacI; and X, XhoI. The probe and PCR primers (P1–P3) used for genotyping are indicated. F, Southern blot analysis of ES cells (clone numbers indicated above each lane) targeted with the targeting vector represented in B. Genomic DNA was extracted, digested by EcoRV, separated by pulse-field gel electrophoresis, and the membrane was hybridized with indicated radiolabelled probe. This assays allows to distinguish the wild-type allele (18.4 kb, represented in A) and the targeted allele (15.8 kb, as shown in C).

 
Flow cytometry

Thymus and lymph nodes were collected from 6-wk-old mice. Single-cell suspensions were prepared and stained with anti-TCR{alpha}/β- allophycocyanin, anti-CD19-PE, anti-CD4-PECy7, and anti-CD8-FITC Abs (eBioscience). The cells were analyzed on a FACSCanto II flow cytometer using the FACSDiva software (BD Biosciences).

Plasmids and primers

The open reading frame of mouse Nampt was PCR-amplified and cloned into the pMSCV vector, upstream of an IRES-enhanced GFP (eGFP) reporter sequence. Site-directed mutagenesis of Nampt (D313A) in this plasmid was performed using a standard PCR-based protocol. To inhibit Nampt expression by RNA interference, short hairpin RNAs (shRNAs) were constructed in the pSicoR vector (25) against the following target sequences: shRNA 1, GAACTTTGTTACACTTGAATT; shRNA 2, GGGAATTGCTCTAATTAAATT; and scrambled shRNA, GGAATCTATTGTCCATATATT. Total cellular RNA was isolated from cells with TRIzol reagent (Invitrogen), according to the manufacturer’s instructions. RNA was reverse-transcribed by Moloney murine leukemia virus reverse transcriptase, using oligo(dT) primers. Specific mRNAs were amplified using the following primers: tryptophan 2,3-dioxygenase (TDO) forward, TGACACGCTCATGACCAAAT; TDO reverse, CCTTGTACCTGTCGCTCACA; nicotinic acid phosphoribosyltranferase (Napt) forward, TACTTGGGGCTAGAGGAGCA; Napt reverse, CAGACTCTAGCCAGGGCATC; Nampt forward, ATCTTTACACAGGACACCAGCGGGGAAC; Nampt reverse, TACATACGCACAGGCGCACACATAGG; ribosomal protein L32 (Rpl32) forward, GGCACCAGTCAGACCGATAT; Rpl32 reverse, CAGGATCTGGCCCTTGAAC.

Cell culture, transfection, and infection

The NIH-3T3 mouse fibroblast cell line, the embryonic kidney 293T human cell line, and the murine macrophage-like RAW 264.7 cell line were grown in DMEM supplemented with 5% FCS, 1 mM sodium pyruvate (Invitrogen), 2 mM L-glutamine (Invitrogen), essential amino acids (Invitrogen), and 0.05 mM 2-ME. Nicotinamide and nicotinic acid were obtained from Sigma-Aldrich. Peritoneal exudate cells were harvested from C57BL/6 mice (Harlan Nederland) 5 days following an i.p. injection of thioglycolate (1 ml of a 4% solution). Twenty-four hours after plating 293T cells in 6-well plates (105 cells per well), the pMSCV-Nampt (wild-type and mutant) or the empty control was transiently transfected using Lipofectamine 2000 reagent (Invitrogen). The same plasmids were used to transfect the retroviral packaging cell line Phoenix (26), and the conditioned supernatants were collected 2 days later and used to infect NIH-3T3 cells. Infected cells were identified by eGFP expression and positively selected by fluorescent-activated cell sorting, generating stable cell lines. The pSicoR-shRNA plasmids targeted to Nampt and controls were transfected into 293T cells in combination with the pCMV-R8.91 and pMD2.G plasmids (encoding packaging and envelope proteins, respectively) to produce lentiviruses, following a previously described protocol (27). NIH-3T3 cells were infected at a multiplicity of infection of 15. Efficiency of infection was assessed by flow cytometry using the eGFP reporter expression and was determined to be >90%. The expression level of Nampt in the cell lines was analyzed by Western blotting using the 14A5 rat mAb, as previously described (14). Anti-actin rabbit polyclonal Ab was purchased form Sigma-Aldrich.

Cell survival

Cells (cell lines or primary cells) were incubated for 15 min in the presence of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) (Sigma-Aldrich), washed with PBS, and incubated overnight in fresh complete medium. Alternatively, cells were incubated overnight in the presence of dexamethasone, H2O2 or of TNF-{alpha} (30 ng/ml) (Roche) combined with cycloheximide (2 µg/ml) (Sigma-Aldrich). In some experiments, cells were preincubated for 6 h in medium containing FK866 (obtained from the National Institute for Mental Health, Chemical Synthesis and Drug Supply Program). After MNNG treatment, cells were again incubated in the presence of FK866. To assess viability, culture supernatants were collected, and cells were trypsinized, washed in PBS containing 1% BSA, and stained with propidium iodide (10 µg/ml). Percentage of cellular viability was determined by flow cytometry based on cell size (forward scatter) and propidium iodide exclusion.

Immunofluorescence

Cells were cultured for 24 h on glass slides in 24-well plates. After MNNG treatment, cells were washed in PBS and fixed for 5 min at 4°C in a freshly prepared solution containing methanol and acetone (50:50). Cells were washed three times in PBS containing 0.05% Tween 20 and incubated overnight at 4°C with anti-apoptosis-inducing factor (AIF) Ab (Santa Cruz Biotechnology). A goat anti-rabbit IgG coupled to Alexa 594 (Molecular Probes) was used as a secondary reagent. Nuclei were counterstained with DAPI and cells were analyzed by fluorescent microscopy.

Nampt enzymatic assay

To determine the enzymatic activity of wild-type and mutant (D313A) mouse Nampt, both forms of the enzyme were transiently transfected into 293T cells. Cellular protein extracts were prepared in a 0.01 M NaH2PO4/Na2HPO4 buffer (pH 7.4), incubated in the presence of the AS2 polyclonal Ab specific for mouse Nampt (14), and immunoprecipitated using protein A-coupled Sepharose beads (Amersham Pharmacia Biotech). Immunoprecipitation beads were washed three times in the lysis buffer and split into two aliquots. One of these was used to test immunoprecipitation efficiency by Western blotting and the other one to assess Nampt enzymatic activity, as previously described (14). Briefly, the beads were incubated in 500 µl of a reaction mix containing 50 mM Tris (pH 8.8), 2 mM ATP, 5 mM MgCl2, 0.5 mM 5-phosphoribosyl-1-pyrophosphate, and 5 µM [carbonyl-14C]nicotinamide (American Radiolabeled Chemicals). Reactions were incubated for 2 h at 37°C. Production of labeled nicotinamide mononucleotide from [14C]nicotinamide was analyzed by a precipitation-filtration assay by adding 50 µl of the reaction mix to 2 ml of acetone. This sample was then passed through an acetone-presoaked Whatman GF/A filter, the filter was rinsed three times with 2 ml acetone, and radioactivity ([14C]nicotinamide mononucleotide) was counted.

NAD measurement

Intracellular NAD concentrations were determined by an enzymatic cycling assay following a previously described protocol (28), with slight modifications. Approximately 5 x 105 cells were lysed by freeze/thaw in liquid nitrogen in 200 µl of a buffer containing 100 mM Na2CO3 and 20 mM NaHCO3. Cellular extracts were centrifuged and pellets were discarded. Samples (20 µl/well, in triplicate) were placed in 96-well MaxiSorp plates (Nunc). A cycling buffer containing the following compounds was prepared: 125 mM Tris-HCl (pH 8.8), 1.25 mM phenazine ethosulfate (Sigma-Aldrich), 0.625 mM MTT (Sigma-Aldrich), 0.25 mg/ml alcohol dehydrogenase (Sigma-Aldrich), and 1.25% BSA. This cycling buffer was prewarmed at 37°C, and 160 µl was added to each well. The cycling reaction was initiated by adding in each well 20 µl of 6 M ethanol prewarmed at 37°C. The plate was incubated at 37°C and the OD at 570 nm was measured after 5, 10, 15, and 20 min using an ELISA plate reader. Serial dilutions of NAD were used as a standard.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Conditional deletion of the Nampt gene in lymphocytes

To circumvent the early embryonic lethality of mice lacking Nampt expression (Ref. 17 and our own unpublished observation), a conditional null allele was generated by introducing LoxP sites that flank exons 5 and 6 of Nampt, as illustrated in Fig. 1. Conditional mutant animals lacking Nampt expression in the lymphocyte lineage were obtained by interbreeding with a transgenic mouse expressing the Cre recombinase under the control of the hCD2 promoter (hCD2-Cre, hereafter referred to as Cre) that drives the expression of the Cre transgene in T lymphocytes in the thymus beginning at the CD4+CD8+ double-positive cells and in B lymphocytes from the pre-B cell stage (29). Namptflox/flox-Cre and Namptflox/+-Cre mice were born at the expected Mendelian ratio and developed normally to adulthood. The cellularity and subset composition of the major lymphoid organs (including thymus, spleen, and lymph nodes) did not differ between Namptflox/+- Cre and control (including wild-type (wt), Namptflox/flox, and wt-Cre) mice (see Fig. 2, A–E, supplemental Fig. S1,5 and data not shown). In marked contrast, Namptflox/flox-Cre mice displayed a marked reduction in thymic cell numbers, in excess of 95%, with an almost complete blockade at the level of double-negative T cells (Fig. 2A). Flow cytometry analysis of spleen (data not shown) and lymph node cell suspensions (Fig. 2, B–E) revealed a near complete loss of peripheral T and B cells in these mice. These results suggest an important role for Nampt in the differentiation of both lymphocyte subsets. To determine whether the few lymphocytes present in the periphery of Namptflox/flox-Cre mice were cells that escaped the Cre-mediated deletion of the floxed Nampt allele, or were cells that could develop and survive in the absence of Nampt, we performed PCR analysis of genomic DNA extracted from lymph nodes or from the tail of corresponding mice (Fig. 2F). While the floxed allele was almost completely deleted in the lymph nodes of heterozygous Nampt+/flox-Cre mice (Fig. 2F, lanes 13–16), the floxed alleles were still present in the lymph nodes of homozygous Namptflox/flox-Cre mice (Fig. 2F, lanes 17–20). This observation suggests that peripheral lymphocytes in these mice derived and expanded from rare progenitors in which the floxed alleles were not completely ablated by the Cre recombinase. These observations indicate that Nampt expression is required for optimal B and T cell development.


Figure 2
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 2. Nampt is required for lymphocyte development. Lymphoid organs of Namptflox/flox, Nampt+/flox CD2-Cre, and Namptflox/flox CD2-Cre littermate mice were collected and analyzed by flow cytometry. A, Thymi were stained with anti-CD4- and anti-CD8-specific Abs. B–E, Absolute numbers of T cells (TCR{alpha}/β+), B cells (CD19+), CD4+ T cells, and CD8+ T cells in the lymph nodes. Results are means ± SD of two to four animals per genotype and are representative of three independent experiments. F, Genomic DNA from the tail (lanes 1–10) or the lymph nodes (lanes 11–20) was extracted and analyzed by PCR with primers specific for the wild-type and floxed alleles: 1–2 and 11–12, Namptflox/flox; 3–6 and 13–16, Nampt+/flox CD2-Cre; 7–10 and 17–20, Namptflox/flox CD2-Cre.

 
Nampt regulates the intracellular concentration of NAD

To evaluate the constitutive role of Nampt in controlling intracellular NAD levels in vivo, we analyzed expression of Nampt protein and intracellular NAD concentrations in Namptflox/+-Cre cells expressing a single Nampt allele (referred to as Nampt hemizygous). Western blot analysis on total thymus extracts revealed a moderate but consistent reduction in Nampt protein expression in hemizygous mice when compared with Namptflox/flox mice (Fig. 3A). Accordingly, these mice displayed a significant reduction in intracellular NAD levels (~60% of control values, Fig. 3B). This finding is in keeping with the concept that Nampt represents the rate-limiting step allowing NAD biosynthesis from nicotinamide (15) and strongly suggests that the major developmental block observed in mice lacking Nampt expression in the lymphocyte lineage is due to the inability of these cells to synthesize NAD from alternative precursors. In keeping with this hypothesis, wild-type thymocytes were found to selectively express Nampt, lacking detectable levels of mRNAs encoding Napt and TDO, the enzymes allowing nicotinic acid and tryptophan, respectively, to contribute to NAD biosynthesis (Fig. 3E). Accordingly, splenocytes were found exquisitely sensitive to pharmacological inhibition of the nicotinamide salvage pathway, as shown by their reduced survival in vitro when exposed to graded doses of the Nampt inhibitor FK866 (30, 31) (Fig. 3F). The inhibitory properties of FK866 were antagonized by high doses of nicotinamide (known to reverse the inhibitory activity of FK866 on Nampt, see Ref. 31) but not by exogenous nicotinic acid (Fig. 3G). In contrast, both nicotinamide and nicotinic acid were found to rescue the Nampt- and Napt-expressing human cell line THP-1 (31) from FK866-induced cell death, confirming that exogenous nicotinic acid is a bona fide NAD precursor for Napt-expressing cells (Fig. 3H). To evaluate the possible functional relevance of the decreased NAD content observed in lymphocytes expressing a single Nampt allele, thymocytes from both control and Nampt hemizygous mice were exposed for 15 min to the alkylating agent MNNG, which is known to induce cell death in a PARP-1- and NAD-dependent manner (20). After 16 h of incubation in fresh media, cell viability was analyzed by propidium iodide staining and flow cytometry (Fig. 3C). As a control, thymocytes were exposed to the synthetic glucocorticoid dexamethasone (Fig. 3D), which is known to induce apoptosis in a PARP-1-independent manner (32, 33). Reduced expression of Nampt led to increased sensitivity of thymocytes to MNNG-induced, but not to dexamethasone-induced, cell death, suggesting that Nampt regulates the ability of cells to adapt to genotoxic stress.


Figure 3
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 3. Nampt single allele deficiency affects intracellular NAD biosynthesis and the resistance to oxidative stress in lymphocytes. Thymocytes from Namptflox/flox and Nampt+/flox Cre littermate mice were isolated. A and B, The expression level of Nampt was analyzed by Western blotting, and the intracellular NAD concentration (normalized to protein content) was measured using an enzymatic cycling assay. C and D, Thymocytes were stimulated with MNNG for 15 min followed by 16 h of incubation in normal media, or with dexamethasone for 16 h, and cell survival was measured by propidium iodide staining and flow cytometry. Results are expressed as means ± SD of triplicates and are representative of four independent experiments. E, Expression of the enzymes allowing use of tryptophan (TDO), nicotinic acid (Napt), and nicotinamide (Nampt) as precursors for NAD biosynthesis was evaluated by RT-PCR in livers and thymocytes from three individual wt naive C57BL/6 mice. Each sample was subjected to two PCR reactions differing by three reaction cycles. The number of cycles was adjusted to the primer pair used. The figure represents a single experiment out of three independent determinations. F–H, Spleen cells (F and G) and the human THP-1 cell line (H) were incubated in the presence of graded doses of FK866 in conventional media (containing 24.5 µM tryptophan and 8.2 µM nicotinamide) in the presence or absence of 500 µM of exogenous nicotinamide or nicotinic acid. The proportion of living cells was assessed by propidium iodide (PI) exclusion by flow cytometry. Values represent the means ± SD of two independent experiments.

 
Nampt expression levels alter susceptibility to DNA damage-induced cell death

To further confirm the close relationship between Nampt levels and sensitivity to genotoxic stress, we undertook a detailed analysis using established cell lines suitable for in vitro manipulations, thus allowing the controlled expression of wild-type and/or mutant forms of the Nampt protein. Several lines of NIH-3T3 murine fibroblasts expressing high or low levels of the Nampt protein were generated using a recombinant retroviral vector approach. Expression of the Nampt was evaluated by Western blot, and a representative experiment is shown in Fig. 4A. Cells transduced with Nampt-encoding vector expressed increased levels of the corresponding protein, while cells transduced with Nampt-specific shRNAs displayed lower levels of the target protein, in the same order of magnitude as previously observed in hemizygous vs wild-type thymocytes. Two shRNA constructs directed against distinct regions of the mRNA led to a similar reduction in intracellular Nampt, while neither the empty vector nor a vector encoding a scrambled shRNA corresponding to shRNA 1 affected Nampt expression levels. As expected, intracellular NAD levels correlated with Nampt expression. Cells overexpressing Nampt displayed a 15–25% increase in total intracellular NAD level, whereas shRNA 1 expression led to a reduction in NAD levels ranging from 20 to 40% when compared with control cells (see Fig. 4B for a representative experiment). Note that Nampt appears as a closely spaced doublet in NIH-3T3 cells, indicative of a possible posttranslational modification of the protein that was not further investigated in this study. All cell lines examined to date maintained a stable phenotype following long-term in vitro culture and were indistinguishable from control cells in terms of cell viability and proliferative capacity when maintained in complete media (data not shown).


Figure 4
View larger version (48K):
[in this window]
[in a new window]

  		FIGURE 4. Nampt levels affect intracellular NAD concentrations. A, NIH-3T3 cell lines expressing various levels of Nampt were generated as described in Materials and Methods. Protein extracts were prepared and analyzed by Western blot using the mAb 14A5 anti-Nampt Ab (14 ). Staining with an anti-actin Ab was used as a loading control. Lanes 1 and 4, Wild-type cells; lane 2, stable transduction of control empty murine stem cell virus (MSCV); lane 3, Nampt-encoding MSCV; lane 5, control empty pSicoR; lane 6, pSicoR containing scrambled shRNA; lane 7, Nampt-specific shRNA1; lane 8, Nampt shRNA2. B, The same cell lines were lysed in NAD-lysis buffer. NAD concentrations were measured by an enzymatic cycling assay and normalized to protein concentrations. Values are means ± SD of triplicates, representative of four independent experiments. *, p < 0.05; **, p < 0.005.

 
To confirm the observations performed in thymocytes expressing reduced levels of Nampt, the transduced cell lines were exposed to MNNG as previously described (Fig. 5). Cells expressing low levels of this enzyme displayed a remarkable increased sensitivity to MNNG-induced cell death (Fig. 5A), while infection of cells with a scrambled, control shRNA did not alter cell sensitivity to genotoxic stress (Fig. 5, G and H). Conversely, cells overexpressing Nampt were partially resistant to MNNG (Fig. 5B). A similar response was observed when cells were exposed to the oxidative agent H2O2, also known to induce cell death in a PARP-dependent manner (34) (Fig. 5, C and D). Of note, decreased expression of the Nampt did not sensitize cells to apoptosis induced by TNF-{alpha} (Fig. 5E), while cells overexpressing the Nampt were not protected against TNF-{alpha}-induced cell death, and they often displayed increased sensitivity to this proapoptotic agent (Fig. 5F, an observation that was not pursued futher during this study).


Figure 5
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 5. Nampt expression level affects sensitivity to PARP-1-dependent cell death. A and B, NIH-3T3 cells were exposed to the indicated concentrations of MNNG for 15 min, washed, and incubated overnight in fresh medium. A, Knockdown of Namp: control empty pSicoR (•) or Nampt-specific shRNA 1 ({circ}). B, Nampt overexpression: NIH-3T3 cell line infected with control empty MSCV-derived virus (•) or MSCV-Nampt ({circ}). This result is representative of more than 10 experiments performed on two series of cell lines generated independently. C and D, Cell death was induced in the same cell lines by overnight incubation in the presence of H2O2 (100 µM). C, Nampt knockdown. D, Nampt overexpression. E and F, Cell death was induced in the same cell lines by overnight incubation in the presence of TNF-{alpha} (30 ng/ml) and cycloheximide (2 µg/ml). E, Nampt knockdown. F, Nampt overexpression. G and H, Cell survival after MNNG treatment was compared in control cells (noninfected or infected with empty pSicoR) and in cells infected with constructs expressing shRNAs specific for two distinct regions of Nampt mRNA (G) or with a scrambled control shRNA (H). Cell viability was assessed by propidium iodide staining exclusion and analyzed by flow cytometry. Measures were performed in triplicates and are expressed as means ± SD.

 
PARP-1-mediated cell death has been described as a caspase-independent event, initiated by the translocation of AIF from the mitochondria to the nucleus (34). To evaluate whether Nampt activity was able to inhibit mitochondrial AIF release in response to MNNG, control cells and cells overexpressing Nampt were treated with MNNG, immunostained using anti-AIF Abs, and analyzed by fluorescence microscopy. As shown in Fig. 6, MNNG treatment led to the nuclear localization of AIF in control cells (note the double-stained nuclei in Fig. 6B), while cells transfected with a Nampt construct displayed a cytoplasmic pattern of AIF staining compatible with its mitochondrial localization (Fig. 6D). This observation indicates that Nampt modulates cell viability in response to MNNG by affecting an early event preceding AIF release.


Figure 6
View larger version (66K):
[in this window]
[in a new window]

  		FIGURE 6. Nampt overexpression prevents AIF delocalization. Control MSCV cells (A and B) or cells overexpressing Nampt (C and D) were either left untreated (A and C) or incubated with MNNG (0.5 mM) for 15 min (B and D). Six hours later cells were fixed and stained using a specific Ab to AIF (red fluorescence) and DAPI (blue nuclear staining).

 
Role of the Nampt enzymatic activity in regulating sensitivity to cellular stress

To clearly demonstrate that the ability of Nampt to regulate cell death in response to genotoxic agents is linked to its role in NAD metabolism, a mutant protein lacking the phosphoribosyltransferase activity was generated. The mutant (D313A) was designed based on amino acid sequence alignment with several type II phosphoribosyltransferases and structural data available for the quinolinate phosphorybosyltransferase from Thermotoga maritima and Mycobacterium tuberculosis (35). Human 293T cells were transfected with the constructs encoding wild-type or mutant murine Nampt. Both plasmids led to expression of equivalent amounts of mouse Nampt as judged by Western blot using a murine Nampt-specific Ab (Fig. 7A). The overexpressed, wild-type, or mutant mouse Nampt was immunoprecipitated and its enzymatic activity was evaluated in the presence of radiolabelled nicotinamide. As shown in Fig. 7B, the mutant D313A Nampt protein lacked detectable enzymatic activity and, accordingly, did not increase intracellular NAD levels upon transfection (Fig. 7C). In fact, transfection of the D313A mutant led to a small but significant decrease (–10%, p = 0.0103) in intracellular NAD content. This observation is best explained in light of the finding that the Nampt enzyme is a dimer in solution (36), suggesting that a catalytically inactive enzyme may act as a dominant-negative mutant. In agreement with the previous observations, only cells overexpressing a catalytically active form of Nampt were significantly protected against MNNG-induced cell death (Fig. 7D). A similar result was observed after stable expression of wild-type and D313A Nampt in NIH-3T3 cells (data not shown).


Figure 7
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 7. A catalytically inactive mutant of Nampt fails to protect cells against MNNG-induced cell death. A and B, MSCV empty vector or MSCV containing either wild-type or D313A mutant Nampt were transiently transfected into 293T human cells. Cellular protein extracts were prepared after 48 h and mouse Nampt was immunoprecipitated using the AS2 pAb. A, Immunoprecipitation of mouse Nampt efficiency was analyzed by Western blot using the 14A5 mAb. B, Phosphoribosyltransferase enzymatic activity of bead-associated Nampt was determined as described in Materials and Methods. The last bar represents the background value of the enzymatic assay (no cellular extract). C and D, 293T cells were transfected as previously described and were either lysed in NAD lysis buffer or assayed for MNNG survival. C, NAD concentrations were determined by an enzymatic cycling assay and normalized to protein concentrations. D, Cells were treated for 15 min with MNNG, washed, and cell viability was measured after overnight culture. Results are mean ± SD of duplicates and are representative of at least two independent experiments.

 
To further confirm the role of the enzymatic activity of Nampt in the regulation of sensitivity to genotoxic stress, we used a pharmacological inhibitor of Nampt (FK866) (30, 31) Addition of FK866 in the culture media generally led to a drastic reduction in intracellular NAD (Figs. 8A, 9, A and C, and Ref. 30). NIH-3T3 cells were incubated in control media or in media supplemented with FK866 and treated with MNNG as previously described. FK866 did not affect cell viability in the control group, while it caused reduced survival of cells treated with low doses of MNNG (Fig. 8B). Inhibition of PARP-1 activity by phenanthridinone (Ptd) prevented cell death induced by both MNNG and a combination of MNNG and FK866 (Fig. 8C), confirming the predominant role of PARP overactivation in this experimental setting. The use of FK866 also allowed us to evaluate the effect of reduced intracellular NAD levels on cells of different origins such as the murine, macrophage-like RAW 264.7 cell line and ex vivo-collected thioglycolate-elicited peritoneal murine macrophages. As shown in Fig. 9, FK866 led to a drastic reduction in intracellular NAD levels (Fig. 9, A and C) and enhanced sensitivity to MNNG-induced toxicity (Fig. 9, B and D) in both cell types, further confirming the important role of the enzymatic activity of Nampt in regulating cell sensitivity to genotoxic stress. Therefore, the observations reported herein strongly suggest that Nampt affects cellular sensitivity to stress through its ability to regulate intracellular NAD levels.


Figure 8
View larger version (18K):
[in this window]
[in a new window]

  		FIGURE 8. Pharmacological inhibition of Nampt by FK866 sensitizes cells to PARP-1-induced cell death. A, NIH-3T3 cells were incubated overnight in the presence of FK866 (10 nM). NAD concentrations were measured and normalized to protein concentrations. B, NIH-3T3 cells were preincubated for 6 h in the presence of the indicated concentrations of FK866, stimulated for 15 min with MNNG, and incubated overnight in the presence of the same concentrations of FK866. C, Cells were incubated in the presence of FK866 (10 nM) and phenanthridinone (Ptd, 30 µM) and stimulated with MNNG (0.5 mM) as in B. Results are expressed as means ± SD of triplicates (A and B) or duplicates (C) and are representative of at least three independent experiments.

 

Figure 9
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 9. Pharmacological inhibition of Nampt by FK866 sensitizes cells of the immune system to MNNG-induced cell death. RAW 264.7 cells (A and B) and primary thioglycolate-elicited peritoneal cells (C and D) were incubated in FK866-supplemented media (10 nM) and treated for 15 min with the indicated doses of MNNG. After 16 h of incubation, both intracellular NAD levels (A and C) and cell viability (B and D) were evaluated as previously described. Results are expressed as means ± SD of triplicates and are representative of two independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The main objective of this study was to better understand the physiological role of the multipurpose protein Nampt/PBEF/visfatin, whose expression has been found to be up-regulated during immune and inflammatory responses in both human and animal models. Although originally described as a soluble cytokine potentially involved in B cell development (PBEF) (1), or glucose metabolism (visfatin) (12, 17), the data presented in this study further support the concept that this protein is a major determinant of intracellular NAD biosynthesis in cells of the immune system (14). In particular, expression levels of this protein in thymocytes and in cell lines correlated with levels of intracellular NAD (Figs. 3, 4, and 7), indicating a major role of the nicotinamide salvage pathway in NAD biosynthesis in lymphocytes. Of note, liver cells expressing a single Nampt allele have been recently shown to express control levels of NAD (17), in keeping with the notion that these cells can synthesize NAD from alternative precursors such as nicotinic acid and tryptophan (37). The observed embryonic lethality of Nampt KO mice (Ref. 17 and our own unpublished observations), the lack of lymphocyte survival in the absence of Nampt expression, and the reduced intracellular levels of NAD in mice expressing a single Nampt allele confirm that 1) the major role of Nampt in vivo is to catalyze the first enzymatic reaction allowing NAD biosynthesis from the nicotinamide precursors, and 2) lymphocytes are strictly dependent on the nicotinamide salvage pathway for NAD biosynthesis, a finding that is further confirmed by the high sensitivity of thymocytes to a Nampt-specific inhibitor (see Fig. 3). Based on these considerations, the major developmental arrest observed in Namptflox/flox-Cre mice is best explained by assuming that Cre-mediated deletion of both Nampt alleles abolishes the NAD biosynthetic capacity of developing cells, thus causing their premature death. It is noteworthy that expression of Nampt is ubiquitous, while both TDO and Napt, allowing NAD biosynthesis from tryptophan and nicotinc acid, respectively, display a more limited tissue distribution.

The observation that lymphoid cells expressing a single Nampt allele display altered NAD metabolism led us to further investigate the possible developmental and functional consequences of reduced intracellular NAD levels. Much to our surprise, cells expressing reduced intracellular NAD concentrations secondary to altered Nampt levels did not display an altered developmental program in vivo. In particular, no developmental anomalies were found in thymocytes from Nampt single allele-expressing mice (as assessed by analysis of CD4, CD8, CD25, and CD44 expression on thymocytes; see Fig. 2 and supplemental Fig. S1). Moreover, peripheral lymph nodes from Nampt hemizygous mice displayed a normal size and cellularity (65.5 ± 10.8 x 106 vs 75.8 ± 0.4 x 106 cells, mean from pooled axillary, inguinal, and mesenteric lymph nodes from, respectively, three wt and four single Nampt allele-expressing mice). Peripheral T cells from Nampt hemizygous mice were also found to adequately respond to stimulation to conventional agonists (such as anti-CD3 and anti-CD28 Abs, see supplemental Fig. S2). Similarly, established cell lines incubated in the presence of FK866 and displaying a nearly complete loss in intracellular NAD levels (Figs. 8 and 9) retained cell viability for several days in culture (data not shown and Ref. 31). Collectively, these data suggest that cells can support wide variations in intracellular NAD levels for an extended period of time, with no apparent functional consequences under conventional culture conditions.

Based on the large body of evidence suggesting a major role for NAD in controlling cell survival in response to PARP-activating cellular insults (18, 19), we therefore investigated whether cells expressing altered NAD metabolism displayed an increased sensitivity to environmental stressors. Nampt levels appeared to regulate the ability of cells to respond to cellular stress mediated by PARP-activating insults, leading to an uncontrolled intracellular NAD consumption. Accordingly, both genetic (Figs. 3 and 5) and pharmacological (Figs. 8 and 9) manipulations causing decreased Nampt activity strongly sensitized cells to genotoxic stress. In agreement with previous reports (38, 39), overexpression of an active form of the Nampt enzyme led to increased cellular resistance to DNA-alkylating agents (Figs. 5 and 7), indicating an important role for this enzyme in regulating cellular resistance to NAD-depleting situations. Collectively, our observations indicate that while cells seem to cope with large variations in intracellular NAD levels under standard conditions, they appear extremely sensitive to variations in Nampt levels and/or activity when exposed to genotoxic stress. Although the experimental conditions generally used to evaluate cell resistance to stress (exposure to chemicals) are of dubious physiological significance, it is generally assumed that they help revealing the capacity of cells to resist to natural sources of chronic oxidative stress, as generated by oxidative metabolism or possibly inflammatory conditions. Further studies, however, are warranted to examine the role of Nampt in a more chronic and physiological setting.

The mechanism whereby Nampt regulates cellular sensitivity in response to PARP-activating stresses remains to be clearly established. In particular, several independent observations point to a possible role for sirtuins (39, 40, 41, 42), a class of NAD-dependent enzymes, in regulating cell survival in response to stress. This conserved family of enzymes comprises seven members in mammals (SIRT1 to SIRT7) that use NAD as a cosubstrate to catalyze the deacetylation and/or mono-ADP-ribosylation of several intracellular targets (43, 44). Since poly(ADP-ribosyl)ation reactions lead to a decrease in intracellular NAD (the sirtuin substrate) and the concomitant increase in nicotinamide (a well-described sirtuin inhibitor), it has been suggested that this family of enzymes may represent key sensors of the NAD/nicotinamide intracellular status (42). However, the precise identification of individual sirtuin members regulating cell sensitivity in response to stress has been difficult to establish. In particular, both nuclear (SIRT1 (45, 46) and SIRT6 (47)) and mitochondrial (SIRT3 and SIRT4 (39)) sirtuins have been found to regulate cell survival in response to stress. Moreover, whereas increased Nampt expression has been found to protect cells against DNA-alkylating agents in a sirtuin-dependent manner, Nampt overexpression also confers resistance to apoptosis induced by topoisomerase inhibitors, but in a sirtuin-independent fashion (39), suggesting a complex relationship between sirtuin activity and resistance to genotoxic stress.

Collectively, the available observations indicate a major role for intracellular NAD levels in protecting cells against a variety of insults. Of note, it has been recently demonstrated that Nampt plays a major role in preserving cell viability by increasing mitochondrial NAD biosynthesis (39). Since large differences in relative concentrations of mitochondrial vs cytosolic NAD may occur in distinct cell types (48), further work may be required to establish whether the mechanism by which NAD regulates cell survival is unique or variable according to tissue origin.

In any case, our observations concur with a previous report and indicate that increased Nampt expression inhibits AIF nuclear localization, indicating that Nampt regulates a protective step upstream of this important apoptotic pathway (39).

The high expression of Nampt by cells of the immune system is therefore best explained by assuming that this protein represents an adaptive biological response to cope with an increased NAD consumption, rather than a potential cytokine. Indeed, 1) in contrast to most cytokines/chemokines known to date, this protein is highly conserved through evolution (14) and is constitutively expressed by most tissues (data not shown and Ref. 1); 2) it lacks a conventional signal sequence and, despite being found as a soluble protein in the serum, only a few cell types have been found to release this protein in the supernatant (17, 49); and 3) the ability of this protein to interact with a membrane-borne receptor has been recently challenged (17). Finally, it is noteworthy that expression of Nampt by nonlymphoid tissues is not sufficient to rescue T and B cell development in Namptflox/flox-hCD2 Cre mice, suggesting that, at least for lymphocytes, Nampt regulates NAD metabolism in a cell-autonomous fashion, a conclusion difficult to rationalize with a putative role of Nampt as a soluble cytokine.


   Acknowledgments
 
We thank Thierry Van Reeth for providing the pFRT-NEO-LOX2 plasmid and Rosa-FLP mice, and Georgette Vansanten for cell sorting.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflicts of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Belgian Program in Interuniversity Poles of Attraction Initiated by the Belgian Sate, Prime Minister’s office, Science Policy Programming, by a Research Concerted Action of the Communauté Française de Belgique and by a grant from the "Fonds Jean Brachet". This work was also supported by the "Fonds pour la Formation à la Recherche dans l’Industrie et dans l’Agriculture" (FRIA) and the National Fund for Scientific Research (FNRS), Belgium. F.A. is a Research Associate and C.S. a Research Director of the the FNRS, Belgium. Back

2 A.R. and M.G. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Oberdan Leo, Laboratoire de Physiologie Animale, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires, 12, rue des Professeur Jeener et Brachet, 6041 Gosselies, Belgium. E-mail address: oleo{at}ulb.ac.be Back

4 Abbreviations used in this paper: Nampt, nicotinamide phosphoribosyltranferase; AIF, apoptosis-inducing factor; eGFP, enhanced GFP; ES cell, embryonic stem cell; MNNG, N-methyl-N'-nitro-N-nitrosoguanidine; MSCV, murine stem cell virus; Napt, nicotinic acid phosphoribosyltranferase; PARP, poly(ADP-ribose) polymerase; PBEF, pre-B cell colony-enhancing factor; Rpl32, ribosomal protein L32; shRNA, short hairpin RNA; TDO, tryptophan 2,3-dioxygenase; wt, wild type. Back

5 The online version of this article contains supplemental material. Back

Received for publication February 5, 2008. Accepted for publication July 31, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Samal, B., Y. Sun, G. Stearns, C. Xie, S. Suggs, I. McNiece. 1994. Cloning and characterization of the cDNA encoding a novel human pre-B-cell colony-enhancing factor. Mol. Cell. Biol. 14: 1431-1437. [Abstract/Free Full Text]
  2. Shaffer, A. L., A. Rosenwald, E. M. Hurt, J. M. Giltnane, L. T. Lam, O. K. Pickeral, L. M. Staudt. 2001. Signatures of the immune response. Immunity 15: 375-385. [Medline]
  3. Teague, T. K., D. Hildeman, R. M. Kedl, T. Mitchell, W. Rees, B. C. Schaefer, J. Bender, J. Kappler, P. Marrack. 1999. Activation changes the spectrum but not the diversity of genes expressed by T cells. Proc. Natl. Acad. Sci. USA 96: 12691-12696. [Abstract/Free Full Text]
  4. Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2: 316-324. [Medline]
  5. Fruman, D. A., G. Z. Ferl, S. S. An, A. C. Donahue, A. B. Satterthwaite, O. N. Witte. 2002. Phosphoinositide 3-kinase and Bruton’s tyrosine kinase regulate overlapping sets of genes in B lymphocytes. Proc. Natl. Acad. Sci. USA 99: 359-364. [Abstract/Free Full Text]
  6. Xu, L. G., M. Wu, J. Hu, Z. Zhai, H. B. Shu. 2002. Identification of downstream genes up-regulated by the tumor necrosis factor family member TALL-1. J. Leukocyte Biol. 72: 410-416. [Abstract/Free Full Text]
  7. de Fougerolles, A. R., G. Chi-Rosso, A. Bajardi, P. Gotwals, C. D. Green, V. E. Koteliansky. 2000. Global expression analysis of extracellular matrix-integrin interactions in monocytes. Immunity 13: 749-758. [Medline]
  8. Subrahmanyam, Y. V., S. Yamaga, Y. Prashar, H. H. Lee, N. P. Hoe, Y. Kluger, M. Gerstein, J. D. Goguen, P. E. Newburger, S. M. Weissman. 2001. RNA expression patterns change dramatically in human neutrophils exposed to bacteria. Blood 97: 2457-2468. [Abstract/Free Full Text]
  9. Huang, Q., D. Liu, P. Majewski, L. C. Schulte, J. M. Korn, R. A. Young, E. S. Lander, N. Hacohen. 2001. The plasticity of dendritic cell responses to pathogens and their components. Science 294: 870-875. [Abstract/Free Full Text]
  10. Perrier, P., F. O. Martinez, M. Locati, G. Bianchi, M. Nebuloni, G. Vago, F. Bazzoni, S. Sozzani, P. Allavena, A. Mantovani. 2004. Distinct transcriptional programs activated by interleukin-10 with or without lipopolysaccharide in dendritic cells: induction of the B cell-activating chemokine, CXC chemokine ligand 13. J. Immunol. 172: 7031-7042. [Abstract/Free Full Text]
  11. Jia, S. H., Y. Li, J. Parodo, A. Kapus, L. Fan, O. D. Rotstein, J. C. Marshall. 2004. Pre-B cell colony-enhancing factor inhibits neutrophil apoptosis in experimental inflammation and clinical sepsis. J. Clin. Invest. 113: 1318-1327. [Medline]
  12. Pilz, S., H. Mangge, B. Obermayer-Pietsch, W. Marz. 2007. Visfatin/pre-B-cell colony-enhancing factor: a protein with various suggested functions. J. Endocrinol. Invest. 30: 138-144. [Medline]
  13. Stephens, J. M., A. J. Vidal-Puig. 2006. An update on visfatin/pre-B cell colony-enhancing factor, an ubiquitously expressed, illusive cytokine that is regulated in obesity. Curr. Opin. Lipidol. 17: 128-131. [Medline]
  14. Rongvaux, A., R. J. Shea, M. H. Mulks, D. Gigot, J. Urbain, O. Leo, F. Andris. 2002. Pre-B-cell colony-enhancing factor, whose expression is up-regulated in activated lymphocytes, is a nicotinamide phosphoribosyltransferase, a cytosolic enzyme involved in NAD biosynthesis. Eur. J. Immunol. 32: 3225-3234. [Medline]
  15. Revollo, J. R., A. A. Grimm, S. Imai. 2004. The NAD biosynthesis pathway mediated by nicotinamide phosphoribosyltransferase regulates Sir2 activity in mammalian cells. J. Biol. Chem. 279: 50754-50763. [Abstract/Free Full Text]
  16. Kitani, T., S. Okuno, H. Fujisawa. 2003. Growth phase-dependent changes in the subcellular localization of pre-B-cell colony-enhancing factor. FEBS Lett. 544: 74-78. [Medline]
  17. Revollo, J. R., A. Korner, K. F. Mills, A. Satoh, T. Wang, A. Garten, B. Dasgupta, Y. Sasaki, C. Wolberger, R. R. Townsend, et al 2007. Nampt/PBEF/visfatin regulates insulin secretion in β cells as a systemic NAD biosynthetic enzyme. Cell Metab. 6: 363-375. [Medline]
  18. D'Amours, D., S. Desnoyers, I. D'Silva, G. G. Poirier. 1999. Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem. J. 342: 249-268. [Medline]
  19. Kim, M. Y., T. Zhang, W. L. Kraus. 2005. Poly(ADP-ribosyl)ation by PARP-1: "PAR-laying" NAD+ into a nuclear signal. Genes Dev. 19: 1951-1967. [Abstract/Free Full Text]
  20. Zong, W. X., D. Ditsworth, D. E. Bauer, Z. Q. Wang, C. B. Thompson. 2004. Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes Dev. 18: 1272-1282. [Abstract/Free Full Text]
  21. Jagtap, P., C. Szabo. 2005. Poly(ADP-ribose) polymerase and the therapeutic effects of its inhibitors. Nat. Rev. Drug Discov. 4: 421-440. [Medline]
  22. Virag, L., C. Szabo. 2002. The therapeutic potential of poly(ADP-ribose) polymerase inhibitors. Pharmacol. Rev. 54: 375-429. [Abstract/Free Full Text]
  23. Oliver, F. J., J. Menissier-de Murcia, C. Nacci, P. Decker, R. Andriantsitohaina, S. Muller, G. de la Rubia, J. C. Stoclet, G. de Murcia. 1999. Resistance to endotoxic shock as a consequence of defective NF-{kappa}B activation in poly(ADP-ribose) polymerase-1 deficient mice. EMBO J. 18: 4446-4454. [Medline]
  24. Osoegawa, K., M. Tateno, P. Y. Woon, E. Frengen, A. G. Mammoser, J. J. Catanese, Y. Hayashizaki, P. J. de Jong. 2000. Bacterial artificial chromosome libraries for mouse sequencing and functional analysis. Genome Res. 10: 116-128. [Abstract/Free Full Text]
  25. Ventura, A., A. Meissner, C. P. Dillon, M. McManus, P. A. Sharp, L. Van Parijs, R. Jaenisch, T. Jacks. 2004. Cre-lox-regulated conditional RNA interference from transgenes. Proc. Natl. Acad. Sci. USA 101: 10380-10385. [Abstract/Free Full Text]
  26. Grignani, F., T. Kinsella, A. Mencarelli, M. Valtieri, D. Riganelli, F. Grignani, L. Lanfrancone, C. Peschle, G. P. Nolan, P. G. Pelicci. 1998. High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res. 58: 14-19. [Abstract/Free Full Text]
  27. Naldini, L., U. Blomer, F. H. Gage, D. Trono, I. M. Verma. 1996. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93: 11382-11388. [Abstract/Free Full Text]
  28. Zerez, C. R., S. J. Lee, K. R. Tanaka. 1987. Spectrophotometric determination of oxidized and reduced pyridine nucleotides in erythrocytes using a single extraction procedure. Anal. Biochem. 164: 367-373. [Medline]
  29. De Boer, J., A. Williams, G. Skavdis, N. Harker, M. Coles, M. Tolaini, T. Norton, K. Williams, K. Roderick, A. J. Potocnik, D. Kioussis. 2003. Transgenic mice with hematopoietic and lymphoid specific expression of Cre. Eur. J. Immunol. 33: 314-325. [Medline]
  30. Wosikowski, K., K. Mattern, I. Schemainda, M. Hasmann, B. Rattel, R. Loser. 2002. WK175, a novel antitumor agent, decreases the intracellular nicotinamide adenine dinucleotide concentration and induces the apoptotic cascade in human leukemia cells. Cancer Res. 62: 1057-1062. [Abstract/Free Full Text]
  31. Hasmann, M., I. Schemainda. 2003. FK866, a highly specific noncompetitive inhibitor of nicotinamide phosphoribosyltransferase, represents a novel mechanism for induction of tumor cell apoptosis. Cancer Res. 63: 7436-7442. [Abstract/Free Full Text]
  32. Virag, L., G. S. Scott, S. Cuzzocrea, D. Marmer, A. L. Salzman, C. Szabo. 1998. Peroxynitrite-induced thymocyte apoptosis: the role of caspases and poly(ADP-ribose) synthetase (PARS) activation. Immunology 94: 345-355. [Medline]
  33. Wang, Z. Q., L. Stingl, C. Morrison, M. Jantsch, M. Los, K. Schulze-Osthoff, E. F. Wagner. 1997. PARP is important for genomic stability but dispensable in apoptosis. Genes Dev. 11: 2347-2358. [Abstract/Free Full Text]
  34. Yu, S. W., H. Wang, M. F. Poitras, C. Coombs, W. J. Bowers, H. J. Federoff, G. G. Poirier, T. M. Dawson, V. L. Dawson. 2002. Mediation of poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science 297: 259-263. [Abstract/Free Full Text]
  35. Schwarzenbacher, R., L. Jaroszewski, F. von Delft, P. Abdubek, E. Ambing, T. Biorac, L. S. Brinen, J. M. Canaves, J. Cambell, H. J. Chiu, et al 2004. Crystal structure of a type II quinolic acid phosphoribosyltransferase (TM1645) from Thermotoga maritima at 2.50 Å resolution. Proteins 55: 768-771. [Medline]
  36. Khan, J. A., X. Tao, L. Tong. 2006. Molecular basis for the inhibition of human NMPRTase, a novel target for anticancer agents. Nat. Struct. Mol. Biol. 13: 582-588. [Medline]
  37. Rongvaux, A., F. Andris, F. Van Gool, O. Leo. 2003. Reconstructing eukaryotic NAD metabolism. BioEssays 25: 683-690. [Medline]
  38. Pillai, J. B., A. Isbatan, S. Imai, M. P. Gupta. 2005. Poly(ADP-ribose) polymerase-1-dependent cardiac myocyte cell death during heart failure is mediated by NAD+ depletion and reduced Sir2{alpha} deacetylase activity. J. Biol. Chem. 280: 43121-43130. [Abstract/Free Full Text]
  39. Yang, H., T. Yang, J. A. Baur, E. Perez, T. Matsui, J. J. Carmona, D. W. Lamming, N. C. Souza-Pinto, V. A. Bohr, A. Rosenzweig, et al 2007. Nutrient-sensitive mitochondrial NAD+ levels dictate cell survival. Cell 130: 1095-1107. [Medline]
  40. Van der Veer, E., Z. Nong, C. O'Neil, B. Urquhart, D. Freeman, J. G. Pickering. 2005. Pre-B-cell colony-enhancing factor regulates NAD+-dependent protein deacetylase activity and promotes vascular smooth muscle cell maturation. Circ. Res. 97: 25-34. [Abstract/Free Full Text]
  41. Van der Veer, E., C. Ho, C. O'Neil, N. Barbosa, R. Scott, S. P. Cregan, J. G. Pickering. 2007. Extension of human cell lifespan by nicotinamide phosphoribosyltransferase. J. Biol. Chem. 282: 10841-10845. [Abstract/Free Full Text]
  42. Yang, H., S. Lavu, D. A. Sinclair. 2006. Nampt/PBEF/visfatin: a regulator of mammalian health and longevity?. Exp. Gerontol. 41: 718-726. [Medline]
  43. Blander, G., L. Guarente. 2004. The Sir2 family of protein deacetylases. Annu. Rev. Biochem. 73: 417-435. [Medline]
  44. Dali-Youcef, N., M. Lagouge, S. Froelich, C. Koehl, K. Schoonjans, J. Auwerx. 2007. Sirtuins: the "magnificent seven", function, metabolism and longevity. Ann. Med. 39: 335-345. [Medline]
  45. Vaziri, H., S. K. Dessain, E. Ng Eaton, S. I. Imai, R. A. Frye, T. K. Pandita, L. Guarente, R. A. Weinberg. 2001. hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 107: 149-159. [Medline]
  46. Luo, J., A. Y. Nikolaev, S. Imai, D. Chen, F. Su, A. Shiloh, L. Guarente, W. Gu. 2001. Negative control of p53 by Sir2{alpha} promotes cell survival under stress. Cell 107: 137-148. [Medline]
  47. Mostoslavsky, R., K. F. Chua, D. B. Lombard, W. W. Pang, M. R. Fischer, L. Gellon, P. Liu, G. Mostoslavsky, S. Franco, M. M. Murphy, et al 2006. Genomic instability and aging-like phenotype in the absence of mammalian SIRT6. Cell 124: 315-329. [Medline]
  48. Alano, C. C., A. Tran, R. Tao, W. Ying, J. S. Karliner, R. A. Swanson. 2007. Differences among cell types in NAD+ compartmentalization: a comparison of neurons, astrocytes, and cardiac myocytes. J. Neurosci. Res. 85: 3378-3385. [Medline]
  49. Tanaka, M., M. Nozaki, A. Fukuhara, K. Segawa, N. Aoki, M. Matsuda, R. Komuro, I. Shimomura. 2007. Visfatin is released from 3T3–L1 adipocytes via a non-classical pathway. Biochem. Biophys. Res. Commun. 359: 194-201. [Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
T. Zhang, J. G. Berrocal, K. M. Frizzell, M. J. Gamble, M. E. DuMond, R. Krishnakumar, T. Yang, A. A. Sauve, and W. L. Kraus
Enzymes in the NAD+ Salvage Pathway Regulate SIRT1 Activity at Target Gene Promoters
J. Biol. Chem., July 24, 2009; 284(30): 20408 - 20417.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
Y. Nakahata, S. Sahar, G. Astarita, M. Kaluzova, and P. Sassone-Corsi
Circadian Control of the NAD+ Salvage Pathway by CLOCK-SIRT1
Science, May 1, 2009; 324(5927): 654 - 657.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Nahimana, A. Attinger, D. Aubry, P. Greaney, C. Ireson, A. V. Thougaard, J. Tjornelund, K. M. Dawson, M. Dupuis, and M. A. Duchosal
The NAD biosynthesis inhibitor APO866 has potent antitumor activity against hematologic malignancies
Blood, April 2, 2009; 113(14): 3276 - 3286.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rongvaux, A.
Right arrow Articles by Leo, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rongvaux, A.
Right arrow Articles by Leo, O.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS